ID: 1129269520

View in Genome Browser
Species Human (GRCh38)
Location 15:74412011-74412033
Sequence GTCTGTGTATGGTGGACAGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 259}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129269510_1129269520 8 Left 1129269510 15:74411980-74412002 CCGGTTCCACCACCTTGTGGATA 0: 1
1: 0
2: 2
3: 5
4: 123
Right 1129269520 15:74412011-74412033 GTCTGTGTATGGTGGACAGAGGG 0: 1
1: 0
2: 0
3: 31
4: 259
1129269505_1129269520 17 Left 1129269505 15:74411971-74411993 CCTGCTCCCCCGGTTCCACCACC 0: 1
1: 0
2: 1
3: 27
4: 390
Right 1129269520 15:74412011-74412033 GTCTGTGTATGGTGGACAGAGGG 0: 1
1: 0
2: 0
3: 31
4: 259
1129269509_1129269520 9 Left 1129269509 15:74411979-74412001 CCCGGTTCCACCACCTTGTGGAT 0: 1
1: 0
2: 0
3: 14
4: 146
Right 1129269520 15:74412011-74412033 GTCTGTGTATGGTGGACAGAGGG 0: 1
1: 0
2: 0
3: 31
4: 259
1129269506_1129269520 11 Left 1129269506 15:74411977-74411999 CCCCCGGTTCCACCACCTTGTGG 0: 1
1: 0
2: 0
3: 10
4: 95
Right 1129269520 15:74412011-74412033 GTCTGTGTATGGTGGACAGAGGG 0: 1
1: 0
2: 0
3: 31
4: 259
1129269508_1129269520 10 Left 1129269508 15:74411978-74412000 CCCCGGTTCCACCACCTTGTGGA 0: 1
1: 0
2: 0
3: 11
4: 84
Right 1129269520 15:74412011-74412033 GTCTGTGTATGGTGGACAGAGGG 0: 1
1: 0
2: 0
3: 31
4: 259
1129269512_1129269520 -1 Left 1129269512 15:74411989-74412011 CCACCTTGTGGATAGTGCCCCTG 0: 1
1: 0
2: 0
3: 3
4: 94
Right 1129269520 15:74412011-74412033 GTCTGTGTATGGTGGACAGAGGG 0: 1
1: 0
2: 0
3: 31
4: 259
1129269513_1129269520 -4 Left 1129269513 15:74411992-74412014 CCTTGTGGATAGTGCCCCTGTCT 0: 1
1: 0
2: 0
3: 18
4: 153
Right 1129269520 15:74412011-74412033 GTCTGTGTATGGTGGACAGAGGG 0: 1
1: 0
2: 0
3: 31
4: 259
1129269511_1129269520 2 Left 1129269511 15:74411986-74412008 CCACCACCTTGTGGATAGTGCCC 0: 1
1: 0
2: 2
3: 13
4: 76
Right 1129269520 15:74412011-74412033 GTCTGTGTATGGTGGACAGAGGG 0: 1
1: 0
2: 0
3: 31
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129269520 Original CRISPR GTCTGTGTATGGTGGACAGA GGG Exonic
900330622 1:2132807-2132829 GTGTGTGTATGGTGGGAAGCGGG + Intronic
900810541 1:4798429-4798451 GTCAGTGTGTGGTGGAAAGGTGG + Intergenic
906812251 1:48839823-48839845 CCCAGTGTGTGGTGGACAGAGGG + Intronic
906886151 1:49650996-49651018 CTCTGTGTACGGAGGGCAGATGG - Intronic
906942122 1:50264725-50264747 GTCTGTGTACAGTGTACAGAGGG - Intergenic
907008938 1:50944615-50944637 GTCTCTGTATGGTAGACAGTGGG - Intronic
908098200 1:60762814-60762836 GGCTGTGTGTGGTGGGAAGAGGG + Intergenic
908172645 1:61522583-61522605 GCCTGCATATGGAGGACAGAAGG + Intergenic
909907335 1:81214127-81214149 GTGTGTGTGTGTTGGAGAGAGGG + Intergenic
911203915 1:95073919-95073941 GTAGGTCTATGGTGGACCGAAGG - Intergenic
915897802 1:159825071-159825093 GTCTGTGGCTGGTGGACTGGGGG - Intergenic
916894805 1:169151427-169151449 GTCTGAGGATGGTGGTCAGCTGG - Intronic
917855925 1:179099650-179099672 GTGTGTATGTGGTGCACAGAGGG - Exonic
920091920 1:203460460-203460482 GTGTGGGTATGCTGGACAAAGGG + Intergenic
920256742 1:204660532-204660554 GTCTGTGTAAGGCGGGGAGAAGG - Intronic
921182987 1:212645984-212646006 GGCTGGGTTTGGTGGGCAGATGG + Intergenic
921725717 1:218521306-218521328 GTCTGTGTGTGGGGGCAAGAAGG + Intergenic
922228447 1:223665654-223665676 GGCTCTGTAGGGTGGACAGAAGG + Exonic
1063203890 10:3812179-3812201 GTCAGTGGATGGTGGAGGGAGGG - Intergenic
1063264939 10:4437198-4437220 GTATGTGTATGATCGCCAGATGG + Intergenic
1065059744 10:21887707-21887729 TTTTGTGTATGGTGTAAAGAAGG - Intronic
1065072204 10:22037153-22037175 TTCTGTGTCTGATGCACAGAAGG - Intergenic
1065278024 10:24105894-24105916 GGCTGTGCATTGTGGAAAGAGGG + Intronic
1065961528 10:30737929-30737951 GTGTTTGTATGTTGGACAGTCGG + Intergenic
1066360724 10:34727803-34727825 GTGTGTGTGTGGTGGAGGGAGGG - Intronic
1066589112 10:36973501-36973523 TACTGTGTGTGGTGGAGAGAGGG + Intergenic
1067002053 10:42624744-42624766 GCCTGGGTATGCTGGACACAGGG + Intronic
1067802830 10:49370967-49370989 GTCTGTGGATGGGAGACATAAGG - Intronic
1070053677 10:72913692-72913714 GTCTGTGCATGCTGGAGAGATGG - Intronic
1071290656 10:84186395-84186417 GTGTGTGTGTGGTGTGCAGAGGG + Intergenic
1072384733 10:94913021-94913043 GTCTGTATAAGGTGTAAAGAAGG - Intergenic
1072756491 10:98024784-98024806 GTGTGTGTGTGGTGGAGAGGTGG - Intronic
1073200101 10:101728304-101728326 CTGTGTTTATGGAGGACAGAGGG - Intergenic
1077159515 11:1106318-1106340 GTGGGTGGATGGTAGACAGATGG - Intergenic
1077159526 11:1106364-1106386 GTGGGTGGATGGTAGACAGATGG - Intergenic
1077159550 11:1106450-1106472 GTGGGTGGATGGTAGACAGATGG - Intergenic
1077519329 11:3022465-3022487 GTAATTGTATGGTGGACAAATGG - Intronic
1078131342 11:8616726-8616748 GTTTGTCTAAGGTGGACAGGGGG - Exonic
1078147512 11:8731675-8731697 CTCTGTGTATGGTAAAAAGAGGG + Intronic
1078933795 11:15934981-15935003 GTGTGTGTGTGGTGTAGAGAGGG - Intergenic
1079671380 11:23175547-23175569 TTGTGTGTATAATGGACAGAAGG + Intergenic
1080844213 11:36012619-36012641 GTGTGTGTATGCTGGACAAAGGG + Intronic
1081381167 11:42417058-42417080 GTCTGTGTAGGGTAAACAGAAGG - Intergenic
1082675467 11:56095391-56095413 GTGTGTGTGGGGTGGAGAGATGG + Intergenic
1082717404 11:56631197-56631219 GTATGTGTATGTTGGTGAGAGGG - Intergenic
1082822274 11:57552202-57552224 GTGTGTGTGTGGTGGAGGGAAGG - Exonic
1085326503 11:75610664-75610686 CAGTGTGAATGGTGGACAGAAGG + Intronic
1085607140 11:77911327-77911349 GTGTGAGTTTGGTGGCCAGATGG + Intronic
1090572697 11:128065258-128065280 GTTTGTATATGGTGTAAAGAAGG - Intergenic
1091189653 11:133680473-133680495 GGCTGTGTAGGATGGACAGGGGG - Intergenic
1091609721 12:1995638-1995660 GTCTGTGTATGCTGGGCAGGAGG - Intronic
1093282486 12:17211431-17211453 CTGTGTGTATGCTGGACTGACGG + Intergenic
1093511482 12:19934723-19934745 GTCTTTGCATGATGGAGAGATGG + Intergenic
1096181066 12:49550586-49550608 GCCAGTCTATGGGGGACAGAGGG + Intronic
1097201893 12:57286118-57286140 TTGTGTGTATGTTGGAGAGATGG + Intronic
1098484110 12:71000874-71000896 GTGTGTGTATGGGGGATAGCGGG - Intergenic
1101440248 12:104698563-104698585 GGCTGTGTCTGGTATACAGAAGG + Intronic
1101776265 12:107796959-107796981 GCCTGTGTCTTTTGGACAGAAGG - Intergenic
1102181132 12:110913182-110913204 GTGTGTGTAGGGGGGACAGGGGG + Intronic
1103193245 12:119020302-119020324 GTCTGTGTATGTTGGGTACAGGG - Intronic
1103660006 12:122506636-122506658 GTGTGTGTAGGGAGGACAGTGGG + Intronic
1105005979 12:132720847-132720869 GCCTGTGCAGGGAGGACAGAGGG - Exonic
1105280466 13:18960002-18960024 GTCTGCGGGTGGAGGACAGATGG - Intergenic
1105431322 13:20340006-20340028 GTTTGCCTATGGTGGACAGAAGG + Intergenic
1106037079 13:26052483-26052505 GGCTGTGTTTGGTGGACTGGAGG + Intergenic
1106963154 13:35025336-35025358 TTTTGTGTATGGTGAAAAGAAGG + Intronic
1107670732 13:42743877-42743899 GTCTGTGACTGTTGGAGAGAAGG + Intergenic
1107865919 13:44703261-44703283 GTGTGTGTTTGGTGGAGACAGGG + Intergenic
1109269073 13:60234210-60234232 GTGTGGATATGGTGGACAAAGGG + Intergenic
1110741633 13:79004421-79004443 GTGTGTGTGTGGTGCATAGAGGG - Intergenic
1110989972 13:82028045-82028067 GTCTGTGTATGGTGTAAGAAAGG - Intergenic
1112876161 13:104041895-104041917 GTCTGTGTCTGGTACACAGTAGG + Intergenic
1113293438 13:108931343-108931365 GTCTGTGAATGAAGGACAGAAGG + Intronic
1114166510 14:20224196-20224218 GTCTGTGTATGCTGGGTAGGCGG + Exonic
1114560473 14:23586358-23586380 GTTTGTGTAAGGTGTAAAGAAGG + Intergenic
1116161766 14:41276070-41276092 TTTTGTATATGGTGTACAGAAGG - Intergenic
1121625491 14:95382938-95382960 GTCTTTGGATGGGAGACAGAAGG + Intergenic
1125309606 15:38364371-38364393 TTTTGTGTATGGTGCAAAGAAGG + Intergenic
1126301906 15:47206805-47206827 GCCTGTGGATGGTGGGGAGAGGG - Intronic
1127033075 15:54885478-54885500 GTCTGTGTATGGTGTACATGAGG + Intergenic
1127363285 15:58263900-58263922 GTATGTGTATGGTAAACATATGG + Intronic
1129078682 15:73020584-73020606 GTCTTTACATGGTGGAGAGAGGG - Intergenic
1129269520 15:74412011-74412033 GTCTGTGTATGGTGGACAGAGGG + Exonic
1130081966 15:80741937-80741959 GACTCTGTATGCTGGACAAAGGG + Intronic
1130850095 15:87784495-87784517 GTGTTTGTATGTTGGAGAGAGGG - Intergenic
1131024389 15:89127801-89127823 GGCTGAGTATGGTGTACAGACGG - Intronic
1131158620 15:90090284-90090306 GTGTGTGCCTGGTGGACAGTGGG - Intronic
1131744122 15:95427363-95427385 GTGTGTATATGGGGGATAGATGG - Intergenic
1134766888 16:16767074-16767096 GTGTATGGATGGTGGATAGATGG - Intergenic
1135938090 16:26798042-26798064 ATCTCTGTATGGTGGACACCGGG - Intergenic
1137911014 16:52378538-52378560 GTGTGTGTGTGTTGGCCAGAGGG + Intergenic
1138604843 16:58081989-58082011 GTCTGTGTGTGCAAGACAGAGGG + Intergenic
1138715816 16:59021138-59021160 GTCTTTGTATGGTGAAGAAAAGG - Intergenic
1140999595 16:80296006-80296028 GTCTGAGTATGGTGGAGGGGAGG + Intergenic
1141642013 16:85346924-85346946 GTGGGTGGATGGTGGACAGGTGG + Intergenic
1141920958 16:87135026-87135048 GTGAGTGAATGGGGGACAGAGGG + Intronic
1142152904 16:88520622-88520644 GTGGGTGGATGGTGGATAGATGG + Intronic
1143674008 17:8417586-8417608 CTCTGTGTATGGTGATCAAATGG + Intronic
1144770888 17:17758818-17758840 GTCTGTGTGTTCTGGACAGAGGG + Intronic
1145391073 17:22455995-22456017 GACTGTGTGGTGTGGACAGAGGG + Intergenic
1147896337 17:43754203-43754225 GTCCGTGAGTGGTGGGCAGAAGG + Exonic
1149177349 17:53889178-53889200 GTGTGGGTATGCTGGACAAAGGG + Intergenic
1151177718 17:72302324-72302346 GCCTGTGGATGGTGCACGGAGGG + Intergenic
1152363265 17:79842076-79842098 CTTTGTGGATGGTGGGCAGATGG + Intergenic
1153517962 18:5922015-5922037 GTCTTTATATGGAAGACAGATGG + Intergenic
1156885828 18:42134678-42134700 GTTTGTATATGGTGTAAAGAAGG + Intergenic
1157245919 18:46055223-46055245 GGATGTGTATGAGGGACAGAGGG - Intronic
1157966542 18:52215231-52215253 GTGTGTGTGTGGTGGAGAGAAGG - Intergenic
1159403728 18:67972817-67972839 TTCTGTGTATGGTGAAAGGAAGG + Intergenic
1160140706 18:76319484-76319506 ATCTGTGTGTGGTGGACTAAAGG + Intergenic
1160349544 18:78164555-78164577 GTCTGTGTATGTGGGTCACATGG + Intergenic
1160627716 18:80223988-80224010 GGCTGGGTAAGGAGGACAGAGGG + Intronic
1161020396 19:2007926-2007948 GTATCTGTAGGGTGGACAGATGG + Intronic
1162300191 19:9840497-9840519 GTCTGGGCATGGTTGAGAGATGG - Intronic
1163949013 19:20566988-20567010 GTCTGTGTACGATGGACGGGTGG + Intronic
1164553844 19:29234615-29234637 ATGGGTGTATGGTGGACGGATGG + Intergenic
925982831 2:9191117-9191139 GTCTGAGTATGCTGGAGACAGGG - Intergenic
926863236 2:17331220-17331242 GTATGTGTATGGTGGCTTGAAGG - Intergenic
927046530 2:19284598-19284620 GTTTGTATATGGTGTAAAGAAGG - Intergenic
927097699 2:19760125-19760147 TTCTGTGTCTGGCTGACAGATGG - Intergenic
927301822 2:21524543-21524565 GTCTGTCTAATGTTGACAGAGGG + Intergenic
927646076 2:24877775-24877797 CTCTCTGTCTGGTGGTCAGATGG - Intronic
929455360 2:42061204-42061226 TTCAGTGTGTGGTAGACAGAAGG + Intergenic
930709077 2:54533143-54533165 GTGTGTGTCTGCTGGACAAAGGG + Intronic
931123352 2:59245632-59245654 GTCTCTGCATAGTGGACACATGG + Intergenic
931132316 2:59350398-59350420 TTCTGTGTATGGTGTAAAGAAGG - Intergenic
931818031 2:65923775-65923797 CTCATTATATGGTGGACAGAAGG + Intergenic
931925651 2:67069436-67069458 TTTTGTGTATGGTGTAAAGAAGG - Intergenic
932469213 2:71942984-71943006 GTGTGTGTGTGGTGGGGAGATGG + Intergenic
933729254 2:85444910-85444932 GTCTGTGAATGGAGGGGAGAGGG + Intergenic
935199231 2:100841566-100841588 GCCTGTGTAAAGTGGCCAGAGGG + Intronic
935481817 2:103599047-103599069 TTTTGTGTATGGTGAAAAGAAGG - Intergenic
935785549 2:106545349-106545371 GTCTGTGAATAGTCCACAGAAGG - Intergenic
938019081 2:127891458-127891480 GTAAGATTATGGTGGACAGAAGG - Intergenic
938383716 2:130850469-130850491 GGCTGTGGATGATGGACAGCTGG - Intronic
939146751 2:138424923-138424945 TTCTCTGTATGGTTGTCAGATGG - Intergenic
939176464 2:138753763-138753785 GTCAATGTATGGTGTACAGTGGG - Intronic
940113735 2:150184359-150184381 GTGTGTGTGTGTTGGAGAGATGG - Intergenic
941586863 2:167370478-167370500 GTCTGTGTATGCTGGATTGGAGG - Intergenic
943717724 2:191170658-191170680 TGCTGTGTATGGTGGAAAGTAGG + Intergenic
947660317 2:231861727-231861749 GTCTGTGATTGGTTGAGAGATGG - Intergenic
948617773 2:239212577-239212599 GTCCCTGTATGGGGGGCAGAAGG - Intronic
1168961858 20:1875548-1875570 GTCTGTGTATGGGGGAGTGTGGG - Intergenic
1169111780 20:3038795-3038817 GGCTGTGTTTGGTGGACAGGAGG - Intronic
1169192715 20:3668329-3668351 GTGTGTGTCGGGGGGACAGAGGG - Exonic
1169274575 20:4224856-4224878 GTCTCTGTATGGTGGGAGGAGGG - Intronic
1169413911 20:5399398-5399420 ACCTTTGTAAGGTGGACAGAAGG - Intergenic
1175739514 20:61410929-61410951 GTGGGTGGATGATGGACAGATGG - Intronic
1175739521 20:61410968-61410990 GTGGGTGGATGATGGACAGATGG - Intronic
1176057943 20:63158584-63158606 GGCTGTGGATGGTGGATGGATGG + Intergenic
1180086016 21:45508241-45508263 GTGAGTGGATGGTGGACAGGTGG + Intronic
1180786207 22:18549245-18549267 GTCTGTGTGGGGTGGAGAGGAGG - Intergenic
1181131490 22:20734971-20734993 GTCTGTGTGGGGTGGAGAGGAGG - Intronic
1181243129 22:21488799-21488821 GTCTGTGTGGGGTGGAGAGGAGG - Intergenic
1183617458 22:38954329-38954351 GTGGGGGTATGGGGGACAGAGGG + Intronic
1183724835 22:39582754-39582776 GTGGGTGTATGGGGGAAAGATGG - Intronic
1183724845 22:39582781-39582803 GTGAGTGTATGGGGGAAAGATGG - Intronic
1183756786 22:39774576-39774598 GGCTGTGTAGAGTGGACTGAGGG - Intronic
1184023521 22:41836822-41836844 GTATGTGTATGGTGGGGATAAGG + Intronic
1184284755 22:43464325-43464347 GTGTGTGTGTGGTGGGCATAGGG + Intronic
952613996 3:35247200-35247222 GGCAGTGAATGATGGACAGAGGG - Intergenic
954316540 3:49804559-49804581 GGCCGTGGATGGTGGACAGGTGG - Exonic
954676077 3:52316099-52316121 GGCTGTGGCTGCTGGACAGATGG - Intergenic
954752407 3:52821120-52821142 TTCTGTGTAGGCTGGAAAGAGGG + Exonic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
961720528 3:128892117-128892139 GCCTGGGGATGGTGGACAGATGG + Intronic
962358477 3:134715180-134715202 GGCTCTGTATGGAGGAGAGATGG - Intronic
963269414 3:143271041-143271063 GTATGTGTATGCTGCACAAAGGG - Intronic
964723027 3:159786749-159786771 GTCTGTGTGTAGTGGAGGGATGG + Intronic
966226005 3:177598759-177598781 GTCTGTTTATGCTGTGCAGACGG + Intergenic
966731812 3:183157983-183158005 GTCTCTGGGTGGTAGACAGAAGG + Intronic
968724057 4:2232553-2232575 CTCTGTTTATTCTGGACAGAAGG + Intronic
968936331 4:3612343-3612365 CTGTGTGTATGATGGACCGAGGG + Intergenic
969699936 4:8762416-8762438 GTCTGTGGCTGGAGGGCAGAGGG - Intergenic
970705273 4:18794128-18794150 GTGTGTGTGTGGTGGGAAGAGGG - Intergenic
970869413 4:20798486-20798508 GTGTGTGTGTGGTAGAAAGAAGG - Intronic
971341488 4:25773564-25773586 AGCTGTGTATGGTGAATAGAAGG - Intronic
971502213 4:27329615-27329637 GTTTCTGTTTGGTGGACACATGG + Intergenic
972427481 4:38947505-38947527 GTGTGTGTGTGTTGAACAGATGG + Intergenic
972638093 4:40901933-40901955 GTGTGTGTGTGATGGAAAGATGG + Intronic
973141963 4:46780719-46780741 GTCTTTTTATGGAGCACAGAAGG - Intronic
974431808 4:61808012-61808034 GGCAGTGTATGGGGGACAGGAGG - Intronic
975036148 4:69685527-69685549 TTTTGTATATGGTGGAAAGAAGG + Intergenic
975998923 4:80348117-80348139 TTTTGTATATGGTGTACAGAGGG - Intronic
976409110 4:84692293-84692315 GTCTGTGTAATGAGGACAAATGG + Intronic
978049080 4:104172867-104172889 GTTTGTGTATGGTGTAACGAAGG - Intergenic
979338633 4:119492909-119492931 GTGTGTTTATGGTGGACAAAGGG - Intergenic
980290365 4:130842823-130842845 TTCTGTATATGGTGGACACTTGG + Intergenic
980688725 4:136263269-136263291 GTGTGTGTGTGGTGGAGCGAGGG - Intergenic
981500787 4:145449413-145449435 GTTAGTTTATGTTGGACAGATGG + Intergenic
984049982 4:174853877-174853899 GTGTGGGTATGCTGGACAAAAGG + Intronic
984107107 4:175561756-175561778 GTATGTGTAAGGGGCACAGATGG + Intergenic
985257288 4:188082952-188082974 GTCTGTGTAGGGCTGAAAGAAGG - Intergenic
985543857 5:499611-499633 GTCTGGAGATGGCGGACAGAGGG - Intronic
985585799 5:733324-733346 GACTGTGTGTGGGAGACAGATGG - Intronic
987591411 5:19932555-19932577 GTGTGTGTATTGTGGGGAGAGGG - Intronic
987628502 5:20435126-20435148 GTGTGTGTGTGGTGGGGAGAGGG - Intronic
990008292 5:50967249-50967271 ATGTGTTTATGGCGGACAGATGG + Intergenic
990152936 5:52840908-52840930 ATCTGTGTCTGGTGGAAAGGAGG - Intronic
990536461 5:56728086-56728108 GTCTGTTTTTGGTGGGCGGATGG - Intergenic
990561810 5:56991013-56991035 GACTATGTATGGGGCACAGAAGG - Intergenic
991317202 5:65322037-65322059 TTTTGTGTATGGTGTACAGAAGG + Intronic
992170485 5:74096892-74096914 GTGTGTGTATGGTGGAGATGGGG - Intergenic
995340881 5:111057833-111057855 GTGTGGGTATGGTGGACAAAGGG + Intergenic
997526926 5:134559645-134559667 GTCTCTGCAGGGTGGGCAGATGG + Intronic
998983991 5:147734896-147734918 CTCTGTGTAAAGTGGACAGATGG + Intronic
999181414 5:149672140-149672162 GTGTGTGTGTGTTGGATAGAGGG + Intergenic
999824640 5:155262430-155262452 GGCTGTGTAAGGTGCACAGGTGG + Intergenic
1001104899 5:168844502-168844524 GTCTGTGTGGGGAGGAGAGAGGG - Intronic
1001681125 5:173557622-173557644 GTGTGTGTATGGGGGGCAGGGGG + Intergenic
1004032508 6:11884694-11884716 GTCTCTGAAAGGTGGAAAGAAGG + Intergenic
1004135292 6:12960463-12960485 GTCTGCGTGTTTTGGACAGAAGG + Intronic
1004527621 6:16424128-16424150 ATCTGTCTAAGGTAGACAGAGGG + Intronic
1005226516 6:23649750-23649772 GCCTGTGAAGGGTGGACAGGTGG - Intergenic
1007069649 6:39027046-39027068 GTTTGTTTATGGTGGAGACAGGG - Intronic
1007254681 6:40520524-40520546 TTCTGGCTATGCTGGACAGATGG - Intronic
1008427905 6:51380678-51380700 GTGTGGGACTGGTGGACAGAAGG + Intergenic
1009414017 6:63396165-63396187 GGCTGGGTAGGGTGGAGAGACGG + Intergenic
1009741401 6:67751436-67751458 TGTTGTGTATGGTGGGCAGAGGG + Intergenic
1011801043 6:91016706-91016728 GTCTGTGGGTGGTGGGCTGAGGG - Intergenic
1012243737 6:96902758-96902780 TTCTGTGTATGGTGTAAGGAAGG + Intergenic
1012506430 6:99951672-99951694 GTCTGTGTATGGCTGACACTTGG + Intronic
1012719967 6:102728618-102728640 GTTTGTATATGGTGTAAAGAAGG + Intergenic
1013591457 6:111622471-111622493 CTGTGGGTATGGTGGAAAGAAGG + Intergenic
1015550962 6:134412051-134412073 CTCTGTGTATGGTTCAGAGAAGG - Intergenic
1018558532 6:165075291-165075313 GTCTTCATATGGTGGAAAGAGGG + Intergenic
1019257534 7:61699-61721 GTCTGTGTCTCGGCGACAGAGGG + Intergenic
1019537445 7:1536732-1536754 TTCTGTGCATGGTGGGGAGAGGG + Intronic
1020877674 7:13718511-13718533 GTGTGTGTGTGGTGGGGAGAAGG + Intergenic
1022259446 7:28690294-28690316 CTCTGTGTCTGGTGGGCAGAGGG - Intronic
1022899939 7:34797412-34797434 CTCTGTGTATGGGGGACAGGGGG + Intronic
1023919475 7:44616094-44616116 GACTGTGAAAGGTGGAGAGAAGG - Intronic
1025845863 7:65196891-65196913 GTATGAGTTTGGTGGCCAGATGG - Intergenic
1025850661 7:65240350-65240372 GTGTGTATATGGGGGACAGTTGG + Intergenic
1025896088 7:65702604-65702626 GTATGAGTTTGGTGGCCAGATGG - Intergenic
1028541471 7:91947186-91947208 GTGTGTGTGTGCTGGAGAGAGGG + Intronic
1028827900 7:95294789-95294811 TTCTATTTATGGTAGACAGAGGG + Intronic
1030096642 7:105906518-105906540 GCCAGTGTTTGGGGGACAGAAGG + Intronic
1032000336 7:128261041-128261063 GTATGTGTTTGGGGCACAGATGG - Intergenic
1032153688 7:129451379-129451401 GGCTGTGTGTGGAGGACAGAGGG + Intronic
1032374278 7:131394363-131394385 GGCAGGGTATGGTGGAGAGATGG + Intronic
1033432790 7:141304434-141304456 GTCTGCATATGCTGGGCAGAAGG - Intronic
1034431821 7:151044960-151044982 GGCTCTGTAAGGGGGACAGAGGG + Intronic
1034609705 7:152354881-152354903 GTCTTTGGATGGTTGACAGAGGG + Intronic
1035778845 8:2211263-2211285 GTCTGTGGAAGGTGAACGGAAGG - Intergenic
1039058676 8:33556461-33556483 GTGTGTGTGTGGTGGGCAGGGGG + Intronic
1040570522 8:48605389-48605411 GACTGTGAATGGAGGAGAGAAGG + Intergenic
1040712647 8:50208142-50208164 ATCTGTGTAATGTGGACAGTGGG + Intronic
1040733326 8:50476029-50476051 ATCTGGATATGCTGGACAGAGGG - Intronic
1041344274 8:56879821-56879843 GTCTGTGTATGGGGGACTGGTGG + Intergenic
1041714119 8:60918195-60918217 GTGTGTGTATGGTGGGGAGGGGG + Intergenic
1044308585 8:90666282-90666304 GCCTGTGTATGGAGCAGAGAGGG + Intronic
1045146559 8:99351856-99351878 GTCTGTGGATGGTAGATAAATGG + Intronic
1045376643 8:101581029-101581051 GGCAGTATATGGTGGAGAGAGGG - Intronic
1046119890 8:109832508-109832530 TTCTGTGTATGGTGTAAAGAAGG - Intergenic
1046619207 8:116510150-116510172 GTGTGTGTATGTGGGAGAGAGGG - Intergenic
1046785003 8:118256216-118256238 TCCTGTGTATGGTGGATAAATGG + Intronic
1047599472 8:126411733-126411755 GTGTGTGTATGGGGGATAGAGGG + Intergenic
1048554364 8:135459247-135459269 GTGTGTGTGTGGTTGACCGATGG + Intronic
1049017157 8:139928782-139928804 GTCTGTGTATGGCGCTCACAGGG + Intronic
1050479979 9:6079296-6079318 GTCTTGTTATGGTGGCCAGAGGG + Intergenic
1052224847 9:26073292-26073314 TTCTGTGTAAGGTGTAAAGAAGG + Intergenic
1052349239 9:27441541-27441563 GTGTGGGTATGCTGGACAAAGGG + Intronic
1055208375 9:73761382-73761404 GTGTGTGTGTGGTGGTCACAGGG + Intergenic
1056404227 9:86258810-86258832 CTGTGTGTATGGTGCAGAGAAGG - Intronic
1057272439 9:93658572-93658594 GTCTGTGGGTGGGGGACAGATGG + Intronic
1057284086 9:93734667-93734689 TTTTGTGTATGGTGTAAAGAAGG - Intergenic
1057837310 9:98455552-98455574 GTGTGTGTGTGGTGGAGGGAGGG + Intronic
1060706811 9:125810390-125810412 GTGTGTGTATGGTGGAGCAATGG + Intronic
1061892848 9:133631854-133631876 CCCTGTGTATGGAGGAGAGATGG + Intergenic
1061970230 9:134040978-134041000 GTCTGTGCAAGGAAGACAGAGGG + Intronic
1062321416 9:135992339-135992361 CTCTGGGTAGGGTGGCCAGAGGG - Intergenic
1062443148 9:136582482-136582504 CTCTGTGTCTGGTGTACAGCTGG - Intergenic
1062524819 9:136973915-136973937 GGCTGTCTGTGGGGGACAGATGG - Intergenic
1185762686 X:2700719-2700741 ATGAGTGGATGGTGGACAGATGG - Intronic
1186619620 X:11224835-11224857 GGCTGTGTATGTTGGGAAGATGG + Intronic
1187170435 X:16846469-16846491 GTCTGTGTACGTTGGAAAGATGG - Intronic
1187990771 X:24869757-24869779 GTTTGTGGATGGAGGAAAGAAGG - Intronic
1188164019 X:26839045-26839067 TTTTGTATATGGTGTACAGAAGG + Intergenic
1189297701 X:39930363-39930385 CTCTGTGTGTGCTGGACAGATGG + Intergenic
1190827472 X:54030721-54030743 GTCTGTGAATGTTGTACGGAAGG - Intronic
1192208642 X:69112729-69112751 GTCTGTGTATGCAGGAGGGAGGG - Intergenic
1192253832 X:69437780-69437802 GTTTGTGTATGGTGTAAGGAAGG + Intergenic
1196857826 X:120000278-120000300 GTGTGTGTGTGGCGGACGGAAGG + Intergenic
1196909155 X:120468606-120468628 GTGTGTGGGTGGGGGACAGATGG - Intronic
1197128864 X:122980402-122980424 GGCTGTGTATGGAGGAAAGGAGG - Intergenic
1198510827 X:137349828-137349850 GGCTCTGAAAGGTGGACAGAAGG - Intergenic
1198778523 X:140207907-140207929 ATATGTGTATGGTGGGCAGGAGG + Intergenic
1198867685 X:141142056-141142078 TTCTGTGTATTGTGGAAAGGAGG - Intergenic
1198882310 X:141294879-141294901 CTCTGTGTATGGGGGTCAGCTGG - Intergenic
1201291061 Y:12421151-12421173 GCCTCAGTATGGAGGACAGACGG - Intergenic