ID: 1129270613

View in Genome Browser
Species Human (GRCh38)
Location 15:74417537-74417559
Sequence GGATGCTTCTGAACTGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 159}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129270613_1129270627 25 Left 1129270613 15:74417537-74417559 CCCAGCCCAGTTCAGAAGCATCC 0: 1
1: 0
2: 0
3: 23
4: 159
Right 1129270627 15:74417585-74417607 CCCTACCTTCAAACAGAACCAGG 0: 1
1: 0
2: 0
3: 18
4: 180
1129270613_1129270629 26 Left 1129270613 15:74417537-74417559 CCCAGCCCAGTTCAGAAGCATCC 0: 1
1: 0
2: 0
3: 23
4: 159
Right 1129270629 15:74417586-74417608 CCTACCTTCAAACAGAACCAGGG 0: 1
1: 0
2: 0
3: 9
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129270613 Original CRISPR GGATGCTTCTGAACTGGGCT GGG (reversed) Intronic