ID: 1129270613

View in Genome Browser
Species Human (GRCh38)
Location 15:74417537-74417559
Sequence GGATGCTTCTGAACTGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 159}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129270613_1129270629 26 Left 1129270613 15:74417537-74417559 CCCAGCCCAGTTCAGAAGCATCC 0: 1
1: 0
2: 0
3: 23
4: 159
Right 1129270629 15:74417586-74417608 CCTACCTTCAAACAGAACCAGGG 0: 1
1: 0
2: 0
3: 9
4: 140
1129270613_1129270627 25 Left 1129270613 15:74417537-74417559 CCCAGCCCAGTTCAGAAGCATCC 0: 1
1: 0
2: 0
3: 23
4: 159
Right 1129270627 15:74417585-74417607 CCCTACCTTCAAACAGAACCAGG 0: 1
1: 0
2: 0
3: 18
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129270613 Original CRISPR GGATGCTTCTGAACTGGGCT GGG (reversed) Intronic
900929890 1:5729869-5729891 GGATGCTTCTGGACTGAGATGGG - Intergenic
901038296 1:6349444-6349466 GCATGCTTCTGATCAGGGCCAGG + Intronic
901203424 1:7479657-7479679 GGATGCTGCTGAGCTGAGCTAGG - Intronic
902129638 1:14248515-14248537 CCCAGCTTCTGAACTGGGCTAGG - Intergenic
902236923 1:15063581-15063603 AGGTTCTTCTGAACTGGGCCGGG - Exonic
903692232 1:25182751-25182773 GGCTGCTTCTTTACTGGTCTTGG + Intergenic
903943664 1:26948616-26948638 GGATCCTTCTGAACTCATCTGGG + Intergenic
906874512 1:49522547-49522569 GGCAGCTACTGGACTGGGCTGGG - Intronic
911149505 1:94583664-94583686 GGATGGTGCAGAAATGGGCTGGG - Intergenic
911985888 1:104621248-104621270 GGATGCTTCTGAGCTTTGCTTGG - Intergenic
912864357 1:113244152-113244174 GGATTTTTCTCAACTGGTCTAGG - Intergenic
912948250 1:114102642-114102664 AGGTGCTTCTGAACTTAGCTGGG - Intronic
917515813 1:175706944-175706966 GGTTGCTTCTGACCTGTGCAAGG - Intronic
924608219 1:245553120-245553142 GGAGCCTTCTGAACAGTGCTTGG - Intronic
1062988174 10:1789638-1789660 GGTTGCAGCTGAGCTGGGCTGGG - Intergenic
1065881640 10:30042387-30042409 GGATGCTTGAGTACTGGGTTAGG - Intronic
1068697242 10:59980761-59980783 GGATGCTTCTGAGTTGAGTTGGG + Intergenic
1070167627 10:73910804-73910826 GGAGGCTTCAGAGCTGGGCGAGG + Exonic
1073094350 10:100970515-100970537 GGAGGCTTCTGACCTTGGATGGG - Intronic
1073181341 10:101585303-101585325 GGAGGCTCCTGACCTGGGCTTGG + Exonic
1075044979 10:119139648-119139670 GGATGCTGTTGGACTGCGCTGGG + Intergenic
1075260946 10:120963484-120963506 GCAGCCTTCTGACCTGGGCTGGG - Intergenic
1075266423 10:121002783-121002805 GGATGCTTTTATACAGGGCTGGG + Intergenic
1075297218 10:121288339-121288361 TTCTGCTTCTGGACTGGGCTGGG - Intergenic
1076574170 10:131453064-131453086 GGATGCTGCTGAACACGGCTAGG - Intergenic
1077229354 11:1451622-1451644 TGAAGCTTCTCAACAGGGCTGGG - Intronic
1078720372 11:13878576-13878598 GGCTGCCTCTCACCTGGGCTGGG - Intergenic
1080272113 11:30461442-30461464 AGATGCTACAGAACTGGCCTCGG + Intronic
1083487821 11:62994635-62994657 GGATGGTGATGAACTTGGCTGGG + Exonic
1085013999 11:73160433-73160455 GAAGGCTCCTCAACTGGGCTAGG - Intergenic
1085195553 11:74669685-74669707 TGATGCTCCTGAACGTGGCTTGG - Intergenic
1089054256 11:115572434-115572456 GGATGACTCTGGTCTGGGCTGGG + Intergenic
1090494467 11:127196480-127196502 GGATAATTCTGAATTGGACTTGG - Intergenic
1090894020 11:130953230-130953252 AGATGCTTGTAAACTGGGATTGG - Intergenic
1091934263 12:4423006-4423028 GGCTGCCTCTGCCCTGGGCTTGG + Intergenic
1093543597 12:20318316-20318338 GGAAAATTCTTAACTGGGCTAGG - Intergenic
1099847825 12:88051482-88051504 GTGTGCTACTGTACTGGGCTTGG + Intronic
1102140109 12:110607911-110607933 GGATGCTTATGCACTGTGTTTGG + Intergenic
1103285821 12:119800590-119800612 AGATGCTGCTGTACTGTGCTAGG - Intronic
1105428996 13:20319990-20320012 GGGTGCTTCTGGGCTGGGCACGG - Intergenic
1106500200 13:30320965-30320987 TGGTGCTCCTGAACTTGGCTTGG - Intergenic
1106812153 13:33369189-33369211 GGCTACTTCTGAATTGGTCTAGG - Intergenic
1107449847 13:40498411-40498433 TGATGATGCTGAACTGTGCTTGG + Intergenic
1108292419 13:48975459-48975481 GGAAGCCTCTGAAATGGGCTTGG - Intergenic
1110369863 13:74727753-74727775 GGATGCTTCTGATCTGGTCAGGG + Intergenic
1112527254 13:100162458-100162480 AGATGCATTGGAACTGGGCTGGG + Intronic
1113668655 13:112159950-112159972 AGATGTTTCTGAACAGGGCTGGG + Intergenic
1114547058 14:23510750-23510772 GGATGCTGCTGACCTGGGTGGGG + Intergenic
1118857919 14:69638394-69638416 TGAAGGTTCTGAACTGGGGTGGG + Intronic
1129270613 15:74417537-74417559 GGATGCTTCTGAACTGGGCTGGG - Intronic
1129924885 15:79355125-79355147 AGATGCTTCTGAAATGAGCTAGG + Intronic
1130127566 15:81106573-81106595 GGAGTCTTCTGAACTGAGCCTGG + Intronic
1131034249 15:89210779-89210801 GGATGGCTTTGAACCGGGCTGGG + Exonic
1133117275 16:3584635-3584657 GGATGCAGCTGGCCTGGGCTTGG - Intronic
1133538792 16:6727744-6727766 GGATGCTACTGAACTCAGCAGGG - Intronic
1133696213 16:8265347-8265369 GGATGGTTCTGAGCTGGGTATGG + Intergenic
1136002475 16:27305268-27305290 GGATGCTTCTGCAATCTGCTGGG + Intergenic
1136839690 16:33527404-33527426 GGCTGCCTCTGAGCTGGTCTCGG - Intergenic
1138610419 16:58119283-58119305 TGATGCTTCATAACTGGTCTTGG - Intronic
1141662645 16:85449632-85449654 GAATGCATCTCAGCTGGGCTGGG - Intergenic
1144873686 17:18385366-18385388 GGAAGCTTGTGACCTTGGCTTGG + Intronic
1145158779 17:20560415-20560437 GGAAGCTTGTGACCTTGGCTTGG - Intergenic
1148328116 17:46795658-46795680 GGGTGCTCCGGAACTGGGCTTGG - Intronic
1148858878 17:50593745-50593767 GGATGCTTCAGGCCTGGGGTGGG + Intronic
1154304897 18:13223473-13223495 GGATTCTTCAGAAGAGGGCTGGG + Intronic
1154360721 18:13658182-13658204 GGCTGCTTCAGGACTGAGCTAGG - Intergenic
1159064818 18:63558191-63558213 GGGTGCTTCTGTACTTGGGTTGG - Intronic
1160625355 18:80200825-80200847 GGATGCATCAAAGCTGGGCTGGG - Intronic
1163090687 19:15017820-15017842 GAAGGCTTCTGAACTGGGTAAGG + Intronic
1163212257 19:15849806-15849828 TGATGGGTTTGAACTGGGCTTGG + Intergenic
1163557071 19:17998943-17998965 CGATGCTTCTGGCCAGGGCTGGG - Exonic
1164538634 19:29105876-29105898 TGAAGCTTCCGCACTGGGCTTGG + Intergenic
1165181556 19:33975820-33975842 GGTTGGTTCTGAACTCAGCTAGG + Intergenic
1166440765 19:42813015-42813037 GGATGTTTCTCAGCTGGACTTGG + Intronic
1166460267 19:42981897-42981919 GGATGTTTCTCAGCTGGACTTGG + Intronic
1166488970 19:43241086-43241108 GGATGTTTCTCAGCTGGACTTGG + Intronic
1166769047 19:45269556-45269578 GGATGCTGGTGACCTGGGCGAGG + Intronic
1167142586 19:47662194-47662216 AGGTGCTTCTGGCCTGGGCTGGG + Intronic
1167312344 19:48744351-48744373 GGAAGCTGAGGAACTGGGCTTGG + Intronic
1168188928 19:54724444-54724466 GTGTGCTGCTGAACTGAGCTGGG + Intronic
926247673 2:11132931-11132953 GGGGGCTGCTGAACTGGGCGTGG + Intergenic
927488632 2:23505877-23505899 GGTTGCTCCTGAACTGGGTCAGG - Intronic
928169787 2:28995879-28995901 GGATGGTCCTGAGGTGGGCTCGG + Intronic
928413795 2:31074468-31074490 GGATTCTGCTGACCTGGGCTGGG + Intronic
932763523 2:74455994-74456016 GGTTGGTTCTGAAATGGGTTAGG + Intronic
934240614 2:90268677-90268699 GGCTGCCTCTGAGCTGGTCTCGG + Intergenic
934272578 2:91548082-91548104 GGCTGCCTCTGAGCTGGTCTCGG - Intergenic
934755397 2:96820918-96820940 GGCTGCTCCTGTTCTGGGCTGGG + Intronic
937311250 2:120904717-120904739 GTCTGCTTCTGTACTGGGCTGGG + Intronic
940184234 2:150964818-150964840 TGGTGGTTCTGAACTGGTCTTGG - Intergenic
941324966 2:164103177-164103199 GCAGGCTTTTGAAGTGGGCTTGG - Intergenic
942909712 2:181228401-181228423 GAATGCTTTTTAACTGAGCTGGG - Intergenic
944322373 2:198362714-198362736 TGATGCTTTTGAGCTAGGCTTGG - Intronic
944727667 2:202487641-202487663 GTATTTTTCTGAACTGGTCTGGG + Intronic
948058515 2:235027139-235027161 GGATGCTTCTGGGCGTGGCTTGG - Intronic
1169004514 20:2195493-2195515 GGATCCTGCAGATCTGGGCTGGG - Intergenic
1169326714 20:4682615-4682637 GGAGGCTTTTGCAGTGGGCTGGG - Intergenic
1169399696 20:5269443-5269465 GGATGGTTCAGGCCTGGGCTGGG + Intergenic
1171121707 20:22574361-22574383 GGATGTTTTTGAACTAGGGTTGG - Intergenic
1173361697 20:42350464-42350486 GGCTCCCTTTGAACTGGGCTTGG + Intronic
1174796514 20:53527191-53527213 GGCTGCTCCTCACCTGGGCTGGG + Intergenic
1175121958 20:56722646-56722668 GGATGGTTTTGGACTGAGCTAGG + Intergenic
1175736246 20:61389627-61389649 CGACGCTTCTCAACTGGGCCAGG + Intronic
1175816638 20:61886507-61886529 GCATGCTCCTGTCCTGGGCTGGG - Intronic
1177888524 21:26776456-26776478 AAATGCTTCTGAAATGGGTTTGG - Intergenic
1179153223 21:38827383-38827405 GGATCCTTCTGAAAGGGTCTCGG + Intergenic
1183667612 22:39254518-39254540 TGGTGCTGCTGACCTGGGCTGGG + Intergenic
1183687016 22:39367019-39367041 GGCTGCTTCTTCCCTGGGCTCGG + Intronic
1183988816 22:41584444-41584466 GGGGGCTTCTGTCCTGGGCTGGG - Intronic
1184365150 22:44046438-44046460 GGATGCATCTCTGCTGGGCTTGG + Intronic
951185382 3:19706659-19706681 AAATGCTTCTCACCTGGGCTGGG + Intergenic
951800678 3:26592448-26592470 GGATGCTGCTGAACTTGTCAAGG + Intergenic
953905013 3:46864362-46864384 GGAGGCTGCTGAACTGGCCTGGG - Intronic
954459323 3:50617435-50617457 TGGAGCCTCTGAACTGGGCTGGG - Intronic
955096760 3:55806397-55806419 GGGAGCTTGTGATCTGGGCTAGG + Intronic
956667075 3:71652067-71652089 GTATGCTACTGAACAGGGCCTGG + Intergenic
961030105 3:123595278-123595300 GGATACTTCTGAACTGGAGGTGG + Intergenic
962355037 3:134686418-134686440 GCACACTTCTGACCTGGGCTAGG + Intronic
963158717 3:142127983-142128005 GGCTGATCCTGAACTGGCCTCGG - Intronic
966893132 3:184422396-184422418 GAATGCTTCTGGGCTGGGCGTGG - Intronic
968516089 4:1016239-1016261 TGATGCTTCTGAAGTGGGGAAGG + Intronic
969355713 4:6624357-6624379 GGATGATTCTGAAGTGCACTGGG + Intergenic
969447301 4:7252663-7252685 GGATGCTTCTGAGAGGGGCTGGG + Intronic
969877741 4:10148454-10148476 GGATGATTCTTCACTGGGGTTGG + Intergenic
972149066 4:36065579-36065601 GGATGCAGCTGAAGTGGCCTGGG + Intronic
972960071 4:44443539-44443561 TGCTGTTACTGAACTGGGCTGGG - Intronic
975781421 4:77844258-77844280 AGATTCTCCTGATCTGGGCTAGG + Intergenic
977504183 4:97880850-97880872 GCATCCTTCTGAACTGGTATTGG - Intronic
978276845 4:106962048-106962070 AGAGGGTTCTGAACTGGACTGGG + Intronic
984886740 4:184456309-184456331 GGGGGCATCTGAACTGGGCCTGG + Intronic
985254991 4:188061140-188061162 AGATGATGCTGAAGTGGGCTCGG + Intergenic
986303323 5:6495707-6495729 GGAAGCTTCTGTAAGGGGCTTGG + Intergenic
986708767 5:10472352-10472374 GAATGCTTGTGATCTAGGCTGGG + Intergenic
992326021 5:75660974-75660996 GGATGATTCTGAACTAGAGTAGG - Intronic
997795960 5:136811247-136811269 GGAAGCTTCTGAGCTGGGATGGG + Intergenic
997981156 5:138467967-138467989 GGAAGCTGCTGACCTGGGCCGGG - Exonic
998418781 5:141965044-141965066 GGACACTTCTGTACTGGGGTAGG + Intronic
998441787 5:142168820-142168842 GGCTGCTTTTGGACTGGGCTGGG + Intergenic
1001311865 5:170616901-170616923 GGATGTCCCTGAGCTGGGCTAGG + Intronic
1002287094 5:178170844-178170866 GGATGGTTCTGACCTGGACCAGG + Intergenic
1003810353 6:9772930-9772952 AGATGCTTTTGAACTGCCCTGGG + Intronic
1006275433 6:33001487-33001509 TGCTGCTTCTGCACTAGGCTTGG - Intergenic
1009798139 6:68498347-68498369 GTATACATCTGAGCTGGGCTTGG + Intergenic
1010590013 6:77701304-77701326 GGCTGTTTCTAAACTGGACTAGG + Intronic
1011450039 6:87482834-87482856 GGATACTTCTGAACTGGGTGAGG + Intronic
1011971908 6:93236012-93236034 GGATGCTTCTGTGATGGACTGGG - Intergenic
1012611966 6:101228866-101228888 GGACTCTTCTTAACTGGGCCAGG - Intergenic
1019441281 7:1048526-1048548 TGCTGCTTCTGAACAGGCCTGGG + Intronic
1020017586 7:4840420-4840442 CGATGCTTCTGAAGGTGGCTGGG - Intronic
1022849661 7:34247231-34247253 GGAAGCTTCTCACCTGGCCTTGG + Intergenic
1024949087 7:54839707-54839729 GGCTGCATCTGCACTTGGCTTGG + Intergenic
1026657833 7:72272801-72272823 GGGTGCTGCTGAAGTGGGTTTGG - Intronic
1029924929 7:104305241-104305263 GTATGTTGCAGAACTGGGCTTGG - Intergenic
1036397170 8:8379149-8379171 GGTGGCTTCTGAACTGGACCTGG + Intronic
1037611057 8:20476667-20476689 GGAAGCTTGTGAACTTGGCCAGG + Intergenic
1039680471 8:39730199-39730221 GGCTGCTTCTGGCCAGGGCTGGG - Intergenic
1040308404 8:46224058-46224080 GGGTGCTTCTGAAATGGGATAGG - Intergenic
1040312076 8:46241999-46242021 GGATGCTGCTGAAATGGGAGAGG - Intergenic
1042897678 8:73688680-73688702 GGTGGCTTCTGAACTGGTTTGGG + Exonic
1047298920 8:123596396-123596418 GGAAGCTGGAGAACTGGGCTTGG + Intergenic
1048019253 8:130523300-130523322 GAAAGCTTCTGAGCAGGGCTGGG - Intergenic
1049563320 8:143324376-143324398 AGAGGCTTCTGAGATGGGCTGGG - Intronic
1050318022 9:4423147-4423169 AGATGGTGATGAACTGGGCTGGG - Intergenic
1053073109 9:35112484-35112506 GACTGGGTCTGAACTGGGCTGGG - Intronic
1053288214 9:36863534-36863556 GCATGTTCCTGAACTGTGCTGGG - Intronic
1053602065 9:39620840-39620862 GGATACTTCTGAACTTGACTAGG - Intergenic
1053859723 9:42374604-42374626 GGATACTTCTGAACTTGACTAGG - Intergenic
1054251471 9:62721593-62721615 GGATACTTCTGAACTTGACTAGG + Intergenic
1054565582 9:66756111-66756133 GGATACTTCTGAACTTGACTAGG + Intergenic
1055236183 9:74126112-74126134 GGCTGCTTGTGAACTGGGCAGGG - Intergenic
1056729998 9:89157189-89157211 GGATGTTACTGAACTGAACTGGG - Intronic
1056754565 9:89373689-89373711 GGCTGCTTTGGAACTTGGCTGGG - Intronic
1057317067 9:93976368-93976390 GGATGCTGCTGATCTGTGCAGGG + Intergenic
1060147823 9:121267852-121267874 GGCAGCTCCTGAGCTGGGCTGGG - Intronic
1060483562 9:124032437-124032459 GGTTGCGCCTGAACTTGGCTCGG - Exonic
1061591320 9:131599542-131599564 GGAGGCTTCTGGAATGGGATGGG + Intronic
1061595047 9:131623585-131623607 GGCTGCTTTTGAAATGGACTGGG - Intronic
1061883896 9:133581885-133581907 GGATGCTGCAGCAATGGGCTGGG - Intronic
1062450541 9:136614013-136614035 GGCTGCTTCCAAACGGGGCTAGG - Intergenic
1186979206 X:14940914-14940936 GGAGGCATTTGAACTGGCCTTGG + Intergenic
1188538058 X:31219276-31219298 AGATGCTTCTGTCCTGGGGTAGG - Intronic
1198741751 X:139850234-139850256 GGATGATTCTGATGAGGGCTCGG + Intronic
1201735907 Y:17261404-17261426 GGAGGCTTCAAAATTGGGCTTGG - Intergenic