ID: 1129270620

View in Genome Browser
Species Human (GRCh38)
Location 15:74417558-74417580
Sequence GCTGGAGCAGGCGCCCCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 443
Summary {0: 1, 1: 0, 2: 5, 3: 43, 4: 394}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129270620_1129270636 28 Left 1129270620 15:74417558-74417580 CCCCCTGGGGCGCCTGCTCCAGC 0: 1
1: 0
2: 5
3: 43
4: 394
Right 1129270636 15:74417609-74417631 AGTTCTCGTCCGGGCTGAAGGGG 0: 1
1: 0
2: 0
3: 3
4: 44
1129270620_1129270629 5 Left 1129270620 15:74417558-74417580 CCCCCTGGGGCGCCTGCTCCAGC 0: 1
1: 0
2: 5
3: 43
4: 394
Right 1129270629 15:74417586-74417608 CCTACCTTCAAACAGAACCAGGG 0: 1
1: 0
2: 0
3: 9
4: 140
1129270620_1129270637 29 Left 1129270620 15:74417558-74417580 CCCCCTGGGGCGCCTGCTCCAGC 0: 1
1: 0
2: 5
3: 43
4: 394
Right 1129270637 15:74417610-74417632 GTTCTCGTCCGGGCTGAAGGGGG 0: 1
1: 0
2: 0
3: 2
4: 52
1129270620_1129270634 26 Left 1129270620 15:74417558-74417580 CCCCCTGGGGCGCCTGCTCCAGC 0: 1
1: 0
2: 5
3: 43
4: 394
Right 1129270634 15:74417607-74417629 GGAGTTCTCGTCCGGGCTGAAGG 0: 1
1: 0
2: 0
3: 12
4: 97
1129270620_1129270631 18 Left 1129270620 15:74417558-74417580 CCCCCTGGGGCGCCTGCTCCAGC 0: 1
1: 0
2: 5
3: 43
4: 394
Right 1129270631 15:74417599-74417621 AGAACCAGGGAGTTCTCGTCCGG 0: 1
1: 0
2: 0
3: 4
4: 92
1129270620_1129270635 27 Left 1129270620 15:74417558-74417580 CCCCCTGGGGCGCCTGCTCCAGC 0: 1
1: 0
2: 5
3: 43
4: 394
Right 1129270635 15:74417608-74417630 GAGTTCTCGTCCGGGCTGAAGGG 0: 1
1: 0
2: 0
3: 3
4: 58
1129270620_1129270627 4 Left 1129270620 15:74417558-74417580 CCCCCTGGGGCGCCTGCTCCAGC 0: 1
1: 0
2: 5
3: 43
4: 394
Right 1129270627 15:74417585-74417607 CCCTACCTTCAAACAGAACCAGG 0: 1
1: 0
2: 0
3: 18
4: 180
1129270620_1129270632 19 Left 1129270620 15:74417558-74417580 CCCCCTGGGGCGCCTGCTCCAGC 0: 1
1: 0
2: 5
3: 43
4: 394
Right 1129270632 15:74417600-74417622 GAACCAGGGAGTTCTCGTCCGGG 0: 1
1: 0
2: 0
3: 2
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129270620 Original CRISPR GCTGGAGCAGGCGCCCCAGG GGG (reversed) Intronic
900087535 1:905513-905535 GCTGGAACATCAGCCCCAGGCGG + Intergenic
900162883 1:1232608-1232630 GCGGGAGCAGGCGCGGCACGGGG + Exonic
900187003 1:1337335-1337357 GGTGGAGCAGAGGCCCCAGTGGG - Intronic
900431197 1:2604016-2604038 ACTGGGCCAGGAGCCCCAGGGGG - Intronic
900570814 1:3357395-3357417 GCTGGAGCTGGAGACCCAGGAGG - Intronic
900991227 1:6099258-6099280 GCAGGGGCAGGGACCCCAGGGGG + Exonic
901050789 1:6424961-6424983 CCTGGAGCAGGCGCTGCAGGCGG + Exonic
902507628 1:16948363-16948385 GCTGGAGCAGGCCCGGCGGGAGG + Exonic
902916779 1:19644383-19644405 GCGGGCCCGGGCGCCCCAGGAGG - Intronic
903296257 1:22345022-22345044 GATGGAGCTGATGCCCCAGGGGG - Intergenic
904563302 1:31413076-31413098 CCTGGGGCAGGTGCGCCAGGAGG - Intronic
904598738 1:31662417-31662439 GCTGGTGCGGGAGCCCTAGGAGG + Intronic
904696937 1:32336121-32336143 GGTGGGGCTGGCGCCCGAGGGGG + Exonic
905183172 1:36178814-36178836 GCAGAAGCAGGTGCCCCCGGCGG + Exonic
905402922 1:37716396-37716418 GCTGGTCCAGGCTTCCCAGGAGG + Exonic
905458161 1:38102753-38102775 GCTGGAGGAGGGGCAACAGGAGG + Intergenic
905491422 1:38346896-38346918 GCTGGGAGAGGAGCCCCAGGGGG - Intergenic
906612351 1:47212246-47212268 GCAGGAGTAGGGGACCCAGGAGG + Intergenic
907592357 1:55687148-55687170 GCTGGAGCAGTGGCCCCATGAGG - Intergenic
909775360 1:79478376-79478398 GCTGGGGCAAGCGCCCCGGCAGG + Intergenic
911420123 1:97630445-97630467 GAAGGAGCAGGCACCCCAAGAGG - Intronic
912756074 1:112325759-112325781 CCTGGAACAGGCTCCCGAGGAGG + Intergenic
913144573 1:115976633-115976655 GGTGGAGGAGGCGTTCCAGGCGG + Exonic
914249816 1:145912441-145912463 TCTGGAGGAGGAGTCCCAGGAGG - Exonic
914702755 1:150149736-150149758 GCTGGAGACCGCTCCCCAGGGGG - Intronic
914719967 1:150281823-150281845 GATGGAGGAGCCGCCCCAGCGGG + Intergenic
914747525 1:150510992-150511014 TCTGGAGAAGGCCGCCCAGGGGG - Exonic
915135551 1:153728710-153728732 GCGGGAGCAGGAGCCCCAGGAGG + Exonic
915490442 1:156247438-156247460 GCAGGCGGAGCCGCCCCAGGAGG + Intronic
918076332 1:181174005-181174027 GCTGGGGCAGCATCCCCAGGAGG + Intergenic
918480771 1:184974503-184974525 CCTGGAGGAGGCGCCCCAGAAGG - Exonic
919991200 1:202709661-202709683 GCTGGGGCAGGGGCCCAAGAAGG - Intronic
920091110 1:203453833-203453855 GCAGGAGCAGGCACCCCACTGGG + Intergenic
920417281 1:205807261-205807283 GCTGGAGCAGGCCCTGCAGATGG - Intronic
921046650 1:211482532-211482554 GATGGAGAAGGGGTCCCAGGTGG + Intronic
921207090 1:212858354-212858376 GTTGGAGGTGGGGCCCCAGGAGG + Exonic
921373822 1:214452597-214452619 GCTGCTGCAGGAGCCCCTGGTGG + Intronic
922472132 1:225883008-225883030 GCTGGAGTAGGTGCCCTTGGCGG - Intergenic
922781566 1:228256841-228256863 GGTGCAGCAGGCGGGCCAGGCGG + Exonic
922881530 1:228984880-228984902 GGTGGGGCAGGCTCCCCTGGTGG + Intergenic
922972028 1:229750255-229750277 GCTGGAGCAGCCCTTCCAGGTGG + Intergenic
923788792 1:237093477-237093499 ACAGGAGCAGGAGCCCCAGGGGG + Intronic
1062883148 10:995010-995032 GCAGGTGCAGGAGACCCAGGAGG + Intronic
1063639769 10:7818343-7818365 GGTGGAGGAGGCGCCCAGGGCGG - Intergenic
1065377764 10:25060280-25060302 GCTGGAACAGGCTCCGGAGGAGG + Intronic
1067526861 10:47044406-47044428 GCAGCATCAGGGGCCCCAGGAGG - Intergenic
1067585564 10:47474265-47474287 GCTGGGGCCGGGGCCACAGGGGG - Intronic
1069828549 10:71268969-71268991 GCAGGAGCAGGCAGCCCAGCTGG + Intronic
1069920422 10:71812516-71812538 CCTGGAGCTGGCCGCCCAGGCGG + Exonic
1070891065 10:79942471-79942493 GCTGGACCAGGCACACCGGGAGG + Exonic
1072782620 10:98260888-98260910 GCTGGCGTAGGCCCCACAGGAGG - Intronic
1073420279 10:103418870-103418892 GCTGGAGAAGGAGGCCCAGTGGG + Intronic
1073425142 10:103451614-103451636 GCTGGAGGAGGAGGACCAGGAGG + Intronic
1073540961 10:104315883-104315905 GCTGGAGCAGTTGCGCCTGGAGG - Exonic
1075664340 10:124219936-124219958 GAAGGAGCAGGCGTCCCAGAGGG - Intergenic
1075911531 10:126129294-126129316 GCTGGAGCATGAGCTCCTGGAGG - Intronic
1075999847 10:126905740-126905762 GCTGGAGCTGACGCCGCCGGGGG - Intronic
1076049913 10:127324129-127324151 GCTGGCGCAGGAGCCCACGGTGG + Intronic
1076264513 10:129099256-129099278 TCTGGAGCAAGCTGCCCAGGAGG + Intergenic
1076566696 10:131404068-131404090 GCTGGAGGAAGCCCCCCAGTAGG + Intergenic
1076792743 10:132785705-132785727 GCCGGGGCAGCCCCCCCAGGAGG + Exonic
1077096748 11:802209-802231 GCTGGAGCTGCAGCCCCATGGGG - Exonic
1077121636 11:911361-911383 GCACGAGCCGGAGCCCCAGGAGG + Intronic
1077147412 11:1052349-1052371 GTGGGGGCAGGTGCCCCAGGAGG - Intergenic
1077221647 11:1420646-1420668 GCTGGAGCTGGGGACCAAGGGGG - Intronic
1077283699 11:1756729-1756751 GCTGGAGCAGCGGCTGCAGGTGG + Intronic
1077387262 11:2275954-2275976 GCAGGAGCCGGCTCCCCGGGGGG - Intergenic
1077444951 11:2586554-2586576 ACTGGAGTAGGGGCCCCAGGTGG + Intronic
1077478938 11:2803900-2803922 GCTGGAGCAGGTGGCAGAGGCGG - Intronic
1077493097 11:2871144-2871166 CCTGCAGCAGGCACCCCATGGGG + Intergenic
1077532630 11:3104356-3104378 GCTGGGCGAGGCGTCCCAGGTGG - Exonic
1077798866 11:5518460-5518482 GGTGGAGCATGAGCCCCAGAGGG + Intronic
1077921019 11:6641697-6641719 GCTGGAGCCAGGGCCCCAGTGGG - Exonic
1078439458 11:11351966-11351988 GCTGGAACAGGCATCCCAAGGGG + Exonic
1078912999 11:15750807-15750829 GCTGGAGCTGCCGCCCCACTGGG - Intergenic
1081249034 11:40806433-40806455 GCTGGGGCAAACGCCCCAAGAGG + Intronic
1081595586 11:44457085-44457107 GCTCTACCAGGCGCCCCTGGTGG + Intergenic
1081858035 11:46316277-46316299 GCTGGAGCAGGGTCCTGAGGAGG - Exonic
1082824559 11:57568132-57568154 GCTGGGGCAGGGGCTCAAGGCGG - Intronic
1083572596 11:63768455-63768477 GCTGGGGCCGGCGGCCCGGGCGG - Intronic
1083595880 11:63918072-63918094 GCTGCAGCACGTGCCCCGGGCGG - Intergenic
1083896219 11:65621046-65621068 GCTTGCCCAGGTGCCCCAGGAGG + Intronic
1083896881 11:65624499-65624521 CCTGGGGCAGGAGGCCCAGGAGG - Exonic
1083931876 11:65850633-65850655 GCTGGAGAAGGGGCCCAAGTGGG + Intronic
1084298115 11:68226277-68226299 GGAGGAGCAGGGTCCCCAGGAGG + Intergenic
1084599015 11:70133863-70133885 GCTGGAGCAGGAGCTGCAGAGGG - Intronic
1084599707 11:70137548-70137570 CCTGGAGCTGGGGCACCAGGAGG - Intronic
1084644716 11:70449105-70449127 GCTGGATCAGGATCCCCAAGGGG + Intergenic
1089202017 11:116730252-116730274 GCTGGAGCTGGCTGCACAGGAGG - Intergenic
1089505406 11:118958799-118958821 GCTGGGGCTGGTGCCCCATGTGG + Intergenic
1089729887 11:120512867-120512889 GGTGGAGGAGGCGGCCGAGGGGG + Intronic
1090190000 11:124761311-124761333 GCTGAAGCCAGCGCCCCTGGAGG + Intronic
1090381061 11:126328155-126328177 GCTGGAGCAGAGGCCCTAAGCGG + Intronic
1090874326 11:130775348-130775370 GCTAAAGAAGGCCCCCCAGGTGG + Intergenic
1091234992 11:134015660-134015682 CCTGGAGCAGGAGCCTGAGGTGG + Intergenic
1091584411 12:1807835-1807857 GCGGGAGCGGGGGCCCCAGCAGG + Intronic
1096237538 12:49939931-49939953 GCAGGAGGAGGAGCCCCAGGGGG - Intergenic
1096333608 12:50736156-50736178 ACTGGAGTAAGCGCCCCATGGGG - Intronic
1096363062 12:51004859-51004881 GCTGGAGCAGCAGCCCCACAAGG + Exonic
1096788315 12:54030346-54030368 CCTGGAGCAGAGGCCCCAGCAGG - Exonic
1096864421 12:54553476-54553498 GCTGGAGCAGGGACCCCACTGGG + Intronic
1097007900 12:55932061-55932083 GCTGGAGCTGGAGCCCGAGCTGG - Intronic
1100754310 12:97733372-97733394 GCTGGTGCTGGGGCCCGAGGAGG - Intergenic
1102035432 12:109768413-109768435 GGTGGAGCAGGCGCCTCAGGTGG - Exonic
1102386859 12:112517248-112517270 GCTGGAGCTGCAGCCCCAGAAGG + Intergenic
1102532126 12:113554276-113554298 GCTGGAGGAGGGGCCACAGGAGG - Intergenic
1102678493 12:114674336-114674358 GCTGGAGAAGGCGCCCCCCATGG + Exonic
1104412309 12:128569238-128569260 GCTGGAGCAGGCCCCCTGAGGGG + Intronic
1104497588 12:129255409-129255431 GCTGAAGCTGGTGCCCCAGGAGG + Intronic
1104901569 12:132192152-132192174 GCGGGAGCAGGCGCTCCTGGTGG - Intergenic
1104940000 12:132390571-132390593 GCTGGAGCTGGGGACGCAGGAGG + Intergenic
1104953086 12:132451195-132451217 GCTGGAGCAGGGGGCTCAGCTGG - Intergenic
1105065366 12:133192757-133192779 GCTGAAGCAGGAGACCCGGGAGG - Intronic
1106477615 13:30111982-30112004 ACTGGAGCTGGGGCCCCAGAAGG + Intergenic
1107801213 13:44109432-44109454 GCTTGAGAAAGTGCCCCAGGTGG - Intergenic
1107959913 13:45548467-45548489 TCTGGAGCAGCTGCCCCTGGGGG + Intronic
1110219620 13:73059357-73059379 GCTGGGGCACGGGTCCCAGGCGG - Exonic
1111165792 13:84455694-84455716 GCTGTTGCAGGCGGCCCAGTGGG - Intergenic
1114522526 14:23348170-23348192 GCTGGGGGAGGAGGCCCAGGAGG - Exonic
1117343108 14:54808291-54808313 GCTGGAGCAAGAGCTCCAGCAGG + Intergenic
1118849197 14:69571816-69571838 GCTGCAGCACGCGACGCAGGTGG - Exonic
1119428247 14:74549929-74549951 GCTGGAGCTGACTACCCAGGAGG - Exonic
1119545396 14:75468051-75468073 GGTGGAGCGGCCTCCCCAGGGGG - Intronic
1121613181 14:95294897-95294919 GCTGGAGCTGGGGGCCCAGGTGG - Intronic
1122210517 14:100170860-100170882 GCTGGACCAGGCTGCCCTGGGGG + Intergenic
1122290664 14:100678757-100678779 GCTGGAGCAGGAAAGCCAGGAGG + Intergenic
1122406181 14:101502408-101502430 GCTGGAGCCCGTGGCCCAGGAGG - Intergenic
1122720010 14:103716428-103716450 GCTGGAGCTGGCGGCCCCGCAGG + Intronic
1122895347 14:104753851-104753873 GCAGGAGGAGTCGCCACAGGTGG + Intronic
1122997435 14:105272856-105272878 GCTGCAGCTGGTTCCCCAGGTGG + Exonic
1123056247 14:105572043-105572065 CCTGGAGAAGGGGCCCCAGGCGG + Intergenic
1123057686 14:105579764-105579786 CCTGGAGAAGGGGCCCCAGGCGG - Intergenic
1123080676 14:105692171-105692193 CCTGGAGAAGGGGCCCCAGGCGG + Intergenic
1123081965 14:105699697-105699719 CCTGGAGAAGGGGCCCCAGGCGG - Intergenic
1123177408 14:106434031-106434053 GCCAGAGCAGGAGCCACAGGAGG - Intergenic
1125752115 15:42036364-42036386 CTGGGAGCAGGAGCCCCAGGAGG + Intronic
1125811802 15:42548507-42548529 GCTGGGGCAGGAGCCCCAGCCGG - Exonic
1126807186 15:52362777-52362799 GCTGGAGGAGGCGTCACTGGAGG + Intronic
1129270620 15:74417558-74417580 GCTGGAGCAGGCGCCCCAGGGGG - Intronic
1129351062 15:74956304-74956326 CCTGGTGCAGGCCCGCCAGGCGG + Exonic
1129738226 15:77977346-77977368 GATGGACCAGGCGCTCCAGCTGG - Intergenic
1130662678 15:85843006-85843028 GCTGGAGCAGGTGCTGCATGGGG + Intergenic
1131442706 15:92470992-92471014 CAAGGAGCAGGCTCCCCAGGAGG - Intergenic
1132605671 16:792790-792812 GCTGGTGCAGCGGCTCCAGGAGG + Exonic
1132657954 16:1049128-1049150 GGTGCAGCAGGCGGCCGAGGAGG - Intergenic
1132716245 16:1291523-1291545 GCTGGAGCAGGCACACTAAGAGG - Intergenic
1133148289 16:3807112-3807134 GCTGGAGTCGGCTCCCCAGAAGG - Intronic
1134063776 16:11213823-11213845 GCTGGAGTAGGTGGCCCACGGGG - Intergenic
1134170050 16:11961269-11961291 GCTGAAGCAGCTGGCCCAGGAGG - Intronic
1134522063 16:14923333-14923355 GCTGGGGCAGGAGCCCCGGGAGG + Intronic
1134709732 16:16321984-16322006 GCTGGGGCAGGAGCCCCGGGAGG + Intergenic
1134716945 16:16362014-16362036 GCTGGGGCAGGAGCCCCGGGAGG + Intergenic
1134949871 16:18346661-18346683 GCTGGGGCAGGAGCCCCGGGAGG - Intergenic
1134957806 16:18390145-18390167 GCTGGGGCAGGAGCCCCGGGAGG - Intergenic
1135592290 16:23713130-23713152 ACTGGAGCTGGAGCCCCAGCCGG + Exonic
1136114647 16:28087186-28087208 GCAGGAGCTGGGCCCCCAGGGGG + Intergenic
1136683956 16:31983408-31983430 CATGGAGGAGGTGCCCCAGGAGG - Intergenic
1136784582 16:32926960-32926982 CATGGAGGAGGTGCCCCAGGAGG - Intergenic
1136885201 16:33926846-33926868 CATGGAGGAGGTGCCCCAGGAGG + Intergenic
1137023995 16:35455486-35455508 GCTGGGGCAGGCCCTCCAGGTGG + Intergenic
1138344449 16:56311561-56311583 GCTGGAGCAGGCCACCCACCTGG + Intronic
1138581136 16:57941009-57941031 GCTGGAAAAGGGGGCCCAGGTGG + Intronic
1139490749 16:67284754-67284776 GCTGGAGCAGGAACGCCCGGGGG + Exonic
1139697413 16:68685027-68685049 GCAGGTGCAGGAGTCCCAGGAGG - Intronic
1139890648 16:70251516-70251538 GCTGGCGCTGGCGCTGCAGGAGG - Exonic
1141595931 16:85096916-85096938 GCTGGAACAGGCGCCCCCCCAGG + Intergenic
1141640110 16:85335956-85335978 GCTGGGGCTGGGGTCCCAGGAGG + Intergenic
1142055911 16:87995869-87995891 GCTGGAGCGGGAGCCCCTGGAGG + Intronic
1142178912 16:88657769-88657791 CCTGGAGCTGGCGGCCCAGCGGG + Intronic
1142200290 16:88757866-88757888 GCTCCAGCAGATGCCCCAGGAGG + Intronic
1142287194 16:89176264-89176286 GCAGGAGCAGGCGGCACTGGAGG + Intronic
1142410092 16:89911534-89911556 GGTGGAGAAGGGGCCCCACGGGG + Intergenic
1203087241 16_KI270728v1_random:1190966-1190988 CATGGAGGAGGTGCCCCAGGAGG - Intergenic
1142556533 17:782108-782130 GCTGGAACCGGCGCCCGAGCCGG - Intronic
1142564383 17:830284-830306 ACTGGAGGAGGAGCCCCACGAGG - Intronic
1143259345 17:5586407-5586429 GCTGGACCAGCAGCCCCAGTGGG - Intronic
1143321288 17:6070617-6070639 GCGGGTGCGGGCGCCCCAGCCGG + Intronic
1143470834 17:7174161-7174183 GCTGGAGGACGCGCACCTGGTGG - Exonic
1143558280 17:7676136-7676158 GCTGGTGCAGGGGCCACGGGGGG + Exonic
1143572715 17:7770447-7770469 GCTGGAGCCTGTGCTCCAGGAGG - Intronic
1143953411 17:10651461-10651483 GCTGGAGCAGGCACTGCATGAGG - Intronic
1144833363 17:18143877-18143899 GCTGGCCCAGGTGCCTCAGGTGG + Exonic
1144853249 17:18254591-18254613 GCGGGGGCAGGCTCTCCAGGCGG + Exonic
1145272152 17:21410446-21410468 GCTGGAGCAGGCACCTTGGGCGG + Intronic
1145310359 17:21697911-21697933 GCTGGAGCAGGCACCTTGGGCGG + Intronic
1146843703 17:36170943-36170965 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146856010 17:36258877-36258899 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146864610 17:36329498-36329520 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1146871916 17:36382788-36382810 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146879277 17:36433873-36433895 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146883207 17:36455018-36455040 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1147067470 17:37930086-37930108 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147074802 17:37983412-37983434 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147079001 17:38009647-38009669 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147086325 17:38062958-38062980 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147094938 17:38133582-38133604 GATGAAGGAGTCGCCCCAGGAGG + Intergenic
1147102271 17:38186921-38186943 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1147144881 17:38479111-38479133 CATGGAGGAGGTGCCCCAGGAGG - Intronic
1147161604 17:38572258-38572280 GTGGGGGCAGGCGCCCGAGGAGG - Intronic
1147740854 17:42670238-42670260 GCGGGAGCAGGCGGTCCAGGCGG + Exonic
1148387304 17:47243569-47243591 ACTGGAGCAGGGTCCCAAGGAGG + Intergenic
1148562337 17:48613240-48613262 GCTGGAGCGGGCCCCAGAGGCGG - Exonic
1148735527 17:49862752-49862774 GCTGGAGCAGGATCCTCAGCAGG + Intergenic
1148929992 17:51120437-51120459 GCAGGACCAGGAGCACCAGGTGG - Exonic
1149846859 17:60013428-60013450 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1150085207 17:62270005-62270027 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1150334349 17:64319765-64319787 CCTGGAGCATGCGCACCAAGAGG - Exonic
1151941983 17:77298464-77298486 GGTGGGGAAGGCTCCCCAGGAGG - Intronic
1152150870 17:78600217-78600239 GCTGCAGCAGGAGTCCTAGGAGG - Intergenic
1152561331 17:81080228-81080250 GGTGCCGCAGGCGCCCCAGCCGG - Intronic
1152684036 17:81685007-81685029 GCTGGAGCTGCCCCCCCAGAGGG + Intronic
1152702079 17:81824179-81824201 GCAGGGGCAGGGGCCGCAGGAGG + Intronic
1152734585 17:81991223-81991245 GCTGGCGTGGGCACCCCAGGTGG + Intronic
1152758128 17:82095604-82095626 AATGGAGCAGGCTCCCCAGGAGG + Intronic
1152895957 17:82911329-82911351 GCTGGGGCAGGTGTCCCAGATGG + Intronic
1152928862 17:83099987-83100009 GCCGGGGCAGGGGCCCCACGGGG + Intergenic
1153285055 18:3449577-3449599 GCTGGAGGAAGAGCCCCGGGAGG + Intronic
1155392251 18:25350022-25350044 GGTGGAGGAGGCGGCCGAGGAGG + Intronic
1157128678 18:44982338-44982360 CCTGGAGCAGTCGCCTCAGGGGG + Intronic
1157423482 18:47565242-47565264 GCTGGGGCAGGGGCCCCGGTGGG - Intergenic
1157662802 18:49460407-49460429 GCTGGAGCAGATCCCCCAGCCGG - Exonic
1160232421 18:77058320-77058342 CGTGGAGCAGGGGTCCCAGGTGG - Intronic
1160699411 19:498668-498690 GGAGGAGGAGGAGCCCCAGGGGG + Exonic
1160756020 19:757552-757574 TCTGGAGCAGGCGAACAAGGGGG + Exonic
1161003197 19:1921441-1921463 GGTGCAGCAGGGGCCCCCGGTGG + Intronic
1161103046 19:2430741-2430763 GCTGGAGGAGACCCGCCAGGAGG + Exonic
1161672519 19:5622235-5622257 GCTCGATCGGGAGCCCCAGGAGG + Intronic
1161737902 19:6002792-6002814 CCTGGCGCAGGCGGCCCGGGCGG - Exonic
1161770621 19:6228877-6228899 GCTGAAGCAGGCGCCGTGGGGGG - Intronic
1162348609 19:10135837-10135859 GGTGGAGCACGCGGCCCTGGGGG + Exonic
1162585571 19:11556144-11556166 GTTGGAGGAGGCGCCATAGGAGG - Intronic
1162850611 19:13428536-13428558 CCTGGAGCAGGCCCCCTAGTGGG + Intronic
1162954725 19:14091401-14091423 GCTGGGGCTGGCGCGCCAGGAGG - Intergenic
1162958900 19:14114665-14114687 GAGGGAGCAGCGGCCCCAGGGGG - Intronic
1163026888 19:14517887-14517909 GCGGGAGGAGGCGCCCGGGGAGG + Intronic
1163289526 19:16370359-16370381 GCTGGGGCAGACGCCTCAGAAGG - Intronic
1163313976 19:16530527-16530549 GCTGGGGCGGGTTCCCCAGGAGG - Intronic
1163390369 19:17026899-17026921 GGCGGAGCAGGCGTCCCGGGAGG - Intergenic
1163710400 19:18843218-18843240 GATGGAGCCTGCACCCCAGGAGG - Intronic
1164558792 19:29274291-29274313 GCTTATGCAGGAGCCCCAGGAGG + Intergenic
1165384651 19:35503192-35503214 GCTGGAGGAGGCCCGGCAGGTGG - Intronic
1165422130 19:35727544-35727566 CCTGGCGCAGGCCCCCCTGGAGG - Exonic
1166118139 19:40668028-40668050 GCTGGAGGAGGTGTCACAGGTGG - Exonic
1166276705 19:41758853-41758875 GCCGGAGCAGCCGCCCCTGCCGG + Intronic
1166563343 19:43747848-43747870 GCTGGAGCAGGCGGGGCAGCAGG + Exonic
1166701119 19:44882225-44882247 GCAGGCGCAGGGGCCACAGGCGG + Exonic
1166714992 19:44961290-44961312 GCTGGACCAGGGGCCCTTGGAGG + Intronic
1166733647 19:45072034-45072056 GCTGGAGCCGCCGCCACAGCAGG - Exonic
1166793213 19:45410119-45410141 GCTGAGGCAGGCGCATCAGGAGG - Exonic
1167638128 19:50666999-50667021 GCTGGGGCAGGCGGGCCTGGTGG + Exonic
1168339587 19:55615490-55615512 GCTGGAGCCGGTGCACCTGGCGG - Exonic
925668848 2:6290467-6290489 GCTGGGCCAGGCGCCCCAACTGG - Intergenic
925801833 2:7609448-7609470 GCAGGAGCAGCCTCTCCAGGGGG + Intergenic
927510738 2:23642483-23642505 GCGGGAGCTGGGGCCCCACGTGG - Exonic
927916307 2:26938846-26938868 GCTGGAGCAGGGGAGTCAGGTGG - Intronic
927936196 2:27078291-27078313 GCTGGAGCAGGCCTCCCCTGGGG - Intergenic
928990843 2:37231800-37231822 GCTGAGGAAGGCGCCCCACGCGG - Intronic
930853252 2:55984699-55984721 ACTGGAGAAGGAACCCCAGGAGG + Intergenic
931328277 2:61250902-61250924 GCTGGAGCAGGCGGATCATGAGG + Intronic
931632218 2:64311520-64311542 GCTGGAGGAGGTTCCCCTGGCGG - Intergenic
932574316 2:72954503-72954525 GCTGTTGCAGGGGCCCCTGGGGG - Intronic
933743051 2:85550053-85550075 CCTGGAGCAGCTGGCCCAGGAGG - Exonic
934783266 2:96986403-96986425 GCAGGAGCAGGCTCCCCAGGCGG + Exonic
936061699 2:109299033-109299055 GCTGAAGCAGGTGACCCAGAGGG - Intronic
936703730 2:115044593-115044615 GCTGGAGGTGGGGCACCAGGTGG - Intronic
937289355 2:120772816-120772838 GCTGGAGAAGAGGCCCCAGAAGG - Intronic
937312374 2:120910141-120910163 GGTGGACCAGATGCCCCAGGGGG - Intronic
939032648 2:137094950-137094972 CTTGGAGCAGGGGCTCCAGGAGG - Exonic
939475882 2:142686122-142686144 GCTGGAGCAGGCGGAAGAGGGGG - Intergenic
942965868 2:181891935-181891957 GCTGAAGCGGGCGCCGGAGGAGG - Exonic
945042375 2:205752931-205752953 GCTGGAGCTGCTGGCCCAGGTGG - Exonic
946203116 2:218083143-218083165 GCTGGAGCAGAAGCAACAGGAGG + Exonic
947714693 2:232333654-232333676 GCTGCACAAGGGGCCCCAGGGGG - Intronic
948708534 2:239810793-239810815 CGTGGAGCAGGCGGCCCAGCAGG - Intergenic
948873951 2:240817754-240817776 GCTGGAGGAGGAGGCCCTGGAGG - Intronic
1168780362 20:483983-484005 GCTGGAACAGGCATCCCAAGGGG + Exonic
1171388188 20:24784344-24784366 ACTGGAGCAGGAGGCACAGGTGG - Intergenic
1172623728 20:36335793-36335815 GCTGGAGAAGGCTTCCCAGAGGG - Intronic
1173770282 20:45650466-45650488 GCTGGATTAGGGGCCACAGGAGG - Intronic
1174182389 20:48683045-48683067 TGTGGGACAGGCGCCCCAGGTGG + Intronic
1175479571 20:59301597-59301619 GCAGGAGCAGGCGGCCGAGGGGG + Exonic
1176082665 20:63281838-63281860 GATGGAGCATGGGCCCCCGGGGG + Intronic
1176415266 21:6471108-6471130 GCAGGAGCAGAGCCCCCAGGAGG + Intergenic
1178441820 21:32604585-32604607 GGGGGAGCAGGCACCGCAGGTGG + Intronic
1178576533 21:33797406-33797428 GCTGGAGCATGTGCAGCAGGAGG + Exonic
1179189119 21:39108332-39108354 GCTGGAGCGGGCGCCCGAGGAGG - Intergenic
1179690766 21:43079441-43079463 GCAGGAGCAGAGCCCCCAGGAGG + Intergenic
1180070072 21:45431561-45431583 GCAGGACCAGGCGGCCCTGGGGG + Intronic
1180080023 21:45482401-45482423 GCTGGAGACCGCTCCCCAGGGGG - Intronic
1180115861 21:45704494-45704516 CCTGGCAGAGGCGCCCCAGGGGG + Intronic
1181031425 22:20150313-20150335 GCAGGGGCAGGGGCGCCAGGTGG + Intronic
1181031448 22:20150362-20150384 GCAGGGGCAGGGGCGCCAGGTGG + Intronic
1181031465 22:20150399-20150421 GCTGGGGCAGGGGTACCAGGCGG + Intronic
1181099883 22:20531991-20532013 GCAGGAGCAGGCTCCTCAGTGGG + Intronic
1181653069 22:24271422-24271444 GGAGGAGCAGGGGCCACAGGCGG + Intronic
1181653083 22:24271477-24271499 GCTGTGGCCGGCGCCCGAGGCGG + Intronic
1182436985 22:30337144-30337166 GCTGGGACAGGTGCCACAGGTGG + Exonic
1182716273 22:32358269-32358291 GCTGCAGAAGGAGCCCCATGGGG + Exonic
1182977433 22:34636610-34636632 GCTGGAGCTGGCGCCACAGAGGG + Intergenic
1183252784 22:36742235-36742257 GCTGGACCAGGAGCTCCATGAGG - Intergenic
1183328203 22:37205660-37205682 GCTGGAGTAGGGGCCCCCGGGGG - Exonic
1183639870 22:39086391-39086413 GCTGAAGCAGGGGCTCCAGGAGG - Exonic
1184764014 22:46562178-46562200 GGTGGAGCAGCCCCCCCAGAGGG + Intergenic
1185159365 22:49213654-49213676 GCTGGAGCAGATGACCCATGAGG - Intergenic
1185269606 22:49922984-49923006 ACCGGGGCAGGCGCCCCATGAGG - Intronic
950053921 3:10010893-10010915 CCTGGAGCAGCCGCGCCCGGCGG + Intronic
950622301 3:14215599-14215621 GCTGGAGCAGGTAGCCCAGGAGG + Intergenic
954456216 3:50601136-50601158 GGTGGAGGACACGCCCCAGGGGG - Intergenic
955359811 3:58263636-58263658 GCTGGAGAAGGTGTGCCAGGAGG - Intronic
955485501 3:59430580-59430602 GAGGGAGCATGCTCCCCAGGGGG - Intergenic
957533681 3:81473456-81473478 GCTGGTGAAGGGGCCTCAGGAGG - Intergenic
960608360 3:119531541-119531563 GCAGGAGCATGCACCACAGGCGG + Intronic
961651823 3:128420750-128420772 GCAGGAGCAGGGGGCCCTGGAGG - Intergenic
966749431 3:183307849-183307871 GCTAGAGCAGGTGGGCCAGGAGG - Intronic
967818584 3:193819278-193819300 GCTGGTCCAGGCTCCCCACGGGG - Intergenic
967886348 3:194336333-194336355 GCTGCAAGAGGCGGCCCAGGAGG - Intergenic
967930581 3:194687609-194687631 GCTGGAGCAGGAGCTGCAGGAGG + Exonic
970828983 4:20313292-20313314 GCTGGAGCAGGCACATCACGTGG + Intronic
971382042 4:26107933-26107955 GATGAAGCAGGAGCCCAAGGAGG - Intergenic
976186715 4:82449476-82449498 GCCGGAGCAGGCGTCTCAGATGG + Intronic
976480211 4:85534430-85534452 GCTGGAGCAGGCGGCGAAAGGGG - Intronic
977622675 4:99154910-99154932 GCTGGAGTTGGAGCCCCAGAGGG + Intronic
977712663 4:100145551-100145573 GCAGGAGCAGGAGCCACAGCTGG - Intergenic
978885428 4:113761788-113761810 GCGGGAGGAGGCGCCGGAGGAGG - Intronic
983541540 4:168916768-168916790 GCTGAGGCAGGAGACCCAGGAGG - Intronic
984526822 4:180867236-180867258 GCTGGAGCAGGTGCCCAGAGTGG + Intergenic
985495235 5:200418-200440 GCTGGAGCAGGCCAGGCAGGGGG + Exonic
985949229 5:3210689-3210711 TCTGCAGCAGGCTCCCCTGGAGG + Intergenic
986253282 5:6080692-6080714 CCAGGAGCAGGCTCCCAAGGGGG + Intergenic
986299725 5:6468324-6468346 GCTGGAGCAGGGGCGCGGGGTGG + Intronic
988497693 5:31758763-31758785 GGTGGAGAAAGCACCCCAGGTGG + Intronic
991494520 5:67214352-67214374 GCTGGAGCAGGTGAGCTAGGTGG + Intergenic
992089404 5:73303863-73303885 GCTGGAGGAGGCCCCGCAGGTGG - Intergenic
997585192 5:135039673-135039695 GCTGGATCCGGGGCCCCAGCCGG - Intronic
997596080 5:135108213-135108235 GCTGCAGCATGAGCCCCAGCAGG - Intronic
998261248 5:140633390-140633412 GATGACTCAGGCGCCCCAGGCGG + Exonic
999062823 5:148654189-148654211 GCTGGAGCCCGCACCCGAGGGGG - Intronic
999206069 5:149848840-149848862 GCTGGGGCAGGGGAGCCAGGAGG + Exonic
1001136600 5:169107717-169107739 GCTGGAGCAAGAGAGCCAGGTGG - Intronic
1001225025 5:169936691-169936713 GCTGGAGCGCGCCCCCCAGGAGG - Intronic
1001564890 5:172693569-172693591 TCTGGAGCAGGCCCACCTGGGGG - Intergenic
1001574583 5:172754777-172754799 GCTGGAGCAGGAGGCCCAGGTGG + Intergenic
1002055336 5:176595384-176595406 CCTGGACCAGAGGCCCCAGGAGG + Intronic
1002279365 5:178121653-178121675 GCAGGAGCAGGCCCCTCGGGAGG + Exonic
1002575077 5:180169900-180169922 CCTGGAGCAGGGAGCCCAGGGGG - Intronic
1002601467 5:180356273-180356295 TCTGGATCAGGGGGCCCAGGAGG + Intergenic
1002661784 5:180796244-180796266 GCTGGTGAAGTCTCCCCAGGAGG - Intronic
1004851094 6:19699836-19699858 GGTGGAGTAGGAGCTCCAGGTGG - Intergenic
1005898307 6:30196623-30196645 GCTGGAGCAGGAGCTCACGGAGG - Exonic
1006512710 6:34530264-34530286 GCTGGAGCAGGCCATCCGGGGGG + Exonic
1006727687 6:36211514-36211536 GCTGGAGCAGGCCTTGCAGGAGG + Exonic
1006793548 6:36718386-36718408 CCTGGCCCAGGCACCCCAGGTGG + Intronic
1007178619 6:39912909-39912931 GCTGGAGAAGGTGCCAGAGGAGG - Exonic
1007415919 6:41691156-41691178 GCGGGAGCAGGCGCAGCAGGAGG - Exonic
1007435339 6:41806458-41806480 GCTGGAGCAGCGGCGGCAGGAGG - Exonic
1007654096 6:43441837-43441859 GATGGAACAGGTGCCCCAGTGGG - Intronic
1007935331 6:45727541-45727563 GCTGGAGCAGGAGCTCTGGGAGG + Intergenic
1008381873 6:50845972-50845994 CCAGGAGCCGGCGCCCCGGGTGG - Exonic
1012707879 6:102556917-102556939 GCTGAGGCAGGAGGCCCAGGTGG - Intergenic
1014229745 6:118890080-118890102 GCTGGGGGAGGCTCCCCACGGGG - Intronic
1014446662 6:121535828-121535850 GCTGAAGCAGGAGGCCCAGCAGG + Intergenic
1016590141 6:145735288-145735310 GGTGGAGCTGGCGGCCGAGGAGG - Exonic
1017657674 6:156645595-156645617 CCTGGGGCAGTCTCCCCAGGTGG + Intergenic
1018612933 6:165661775-165661797 GCAGGAGCCGGTGCCCCTGGCGG - Intronic
1018964795 6:168475912-168475934 GCAGGAGCAGGTGGACCAGGAGG + Intronic
1019254474 7:40551-40573 GAGGGCGCAGGAGCCCCAGGTGG - Intergenic
1019287500 7:231106-231128 GCAGGAGCAGCAGCCCCAGCAGG + Intronic
1019605653 7:1908925-1908947 GCATGAGCAGCGGCCCCAGGGGG + Intronic
1019609307 7:1928912-1928934 GCTGGCGCTGGCCCCACAGGTGG - Intronic
1019621677 7:1995533-1995555 GCGGGCGCAGGAGCCCCAGGCGG + Intronic
1020081408 7:5287912-5287934 GCTGGAGGAGGCGGCGGAGGCGG + Exonic
1020094704 7:5361854-5361876 GCCGGGGCAGGGGCCCCACGGGG + Intronic
1020263640 7:6545980-6546002 ACTGTAGCACGGGCCCCAGGAGG - Intronic
1020271676 7:6600301-6600323 GCTGGCGCAGGCTCTGCAGGTGG + Exonic
1021796818 7:24263825-24263847 CCTGGAGCAGGTGGCCCTGGTGG - Intergenic
1022121696 7:27314620-27314642 GCTGCAGGAGGGGACCCAGGCGG + Intergenic
1022230179 7:28406616-28406638 GGTGGTGCTGGCACCCCAGGGGG + Intronic
1022286087 7:28957059-28957081 GCTCGCGCAGCCGGCCCAGGTGG + Exonic
1022873492 7:34503997-34504019 GCTGGAGCAGGAGCAAGAGGAGG + Intergenic
1024886839 7:54152063-54152085 GCTGCAGGAGGCACTCCAGGAGG + Intergenic
1025197505 7:56944236-56944258 GCTGGAGGAGGCGGCGGAGGCGG - Intergenic
1025614522 7:63106507-63106529 GCTGGAGCAAGAGCCCCAACAGG - Intergenic
1025674442 7:63632703-63632725 GCTGGAGGAGGCGGCGGAGGCGG + Intergenic
1025850256 7:65238842-65238864 AGTGGAGCAGGTGGCCCAGGGGG - Intergenic
1026906007 7:74063194-74063216 GGTGGAGTAGGCATCCCAGGCGG + Exonic
1026959699 7:74400489-74400511 GCTGGACCAGGCTCAGCAGGTGG + Exonic
1029193750 7:98789950-98789972 GCTGAGGCAGGCGGCCCATGAGG - Intergenic
1029419573 7:100465944-100465966 GCTGCAGCTGTAGCCCCAGGAGG - Intronic
1029478228 7:100797864-100797886 GCTGAGGCAGGAGGCCCAGGAGG - Intergenic
1029524792 7:101088044-101088066 GCGGGAGCAGGCGGCCCGGGTGG + Exonic
1029746405 7:102517770-102517792 GCTGGACTGGGCGCCGCAGGGGG + Exonic
1029764342 7:102616749-102616771 GCTGGACTGGGCGCCGCAGGTGG + Exonic
1029989054 7:104946423-104946445 GCTGGGGCATGCCCCCCAGTTGG + Intergenic
1030277815 7:107738572-107738594 GCTTCAGCAGGCACCTCAGGAGG - Intergenic
1030820369 7:114085792-114085814 GCTGGAGAAGGCGGAGCAGGAGG + Intergenic
1031998152 7:128246342-128246364 GCTGGTGCAGAGGACCCAGGTGG + Intronic
1033705663 7:143882929-143882951 GCTGGAGTGGGAGCTCCAGGGGG + Intronic
1034172242 7:149071532-149071554 CCTGCAGCAGGCGGCGCAGGCGG + Exonic
1034274639 7:149818670-149818692 TCTGGAGCAGGGGGACCAGGAGG - Intergenic
1034424465 7:151007310-151007332 GCAGGAGGAGGCATCCCAGGGGG - Intronic
1034555854 7:151849961-151849983 GCAGGAGCAGCTTCCCCAGGTGG - Intronic
1036659445 8:10698482-10698504 GCTGGAGCTGGGGCCCAGGGAGG + Intronic
1036748895 8:11430766-11430788 GCTGGAGGAGACGGCCAAGGCGG + Intronic
1036810835 8:11867156-11867178 GCTGGGGTGGGCGACCCAGGTGG - Intronic
1038544429 8:28414143-28414165 ACTTGAGGAGCCGCCCCAGGTGG + Intronic
1039923551 8:41909362-41909384 GCTGCAGTATGAGCCCCAGGAGG + Intergenic
1042769514 8:72364698-72364720 GCTGGAGCAGGCTTCCAAGGTGG - Intergenic
1043502765 8:80873733-80873755 GCGGGAGCAGGCGGCGGAGGGGG - Intronic
1044857790 8:96494083-96494105 GCGGGAGCAGGCGCAGGAGGAGG + Exonic
1045860512 8:106811091-106811113 GCTGGAGCAGAGGCCTCAGTGGG - Intergenic
1049093175 8:140532295-140532317 GCTGGAGCCGGCACCCCAGAAGG - Intronic
1049223107 8:141436847-141436869 CCTGGAGCAGGCTTCCCTGGGGG + Intergenic
1049399423 8:142418289-142418311 GGTGGAGCGGGAGCCCCAGGAGG + Intergenic
1049411860 8:142477138-142477160 GCTGGAGCACACGCTCCACGGGG - Exonic
1049441852 8:142613176-142613198 CCTGGAGCAGGCGGCCGAGCCGG - Exonic
1049714788 8:144084755-144084777 ACTGGTGCAGGCGCTCCAGGAGG - Exonic
1049724172 8:144137851-144137873 GCTGGCGCTGGCGCCTCGGGAGG + Exonic
1055783153 9:79842436-79842458 GCTGGCGAAAGCACCCCAGGGGG + Intergenic
1056310157 9:85332709-85332731 GCTGGAGTTGGTGCCCCTGGTGG - Intergenic
1056512208 9:87316704-87316726 GGTTGAGGAGGAGCCCCAGGAGG + Intergenic
1057784240 9:98074567-98074589 GGTGGCGCTGGCTCCCCAGGAGG + Intronic
1059461327 9:114432313-114432335 GCAGGCGCAGGAGCCCCAGGAGG + Intronic
1060027887 9:120188330-120188352 GCTGGAGCAAGAGCCCAGGGAGG - Intergenic
1060348816 9:122839459-122839481 GCTGGAGCAGCCCACCGAGGTGG + Intergenic
1060832021 9:126722941-126722963 GCGGGGGCGGGCGCCCCGGGGGG - Intergenic
1062035125 9:134379556-134379578 CCTGGAGCAAGCCCCCCATGAGG - Intronic
1062165213 9:135104246-135104268 GCTGGGGCCGGCACACCAGGTGG + Intronic
1062276677 9:135734688-135734710 CATGGAGCAGCCGCCCCGGGTGG + Intronic
1062431001 9:136526872-136526894 GGTGGGGCAGGAGCCCCAGCCGG + Intronic
1062476362 9:136729311-136729333 GCTGGAGCTGGCACCACAGCAGG + Intergenic
1062572551 9:137192285-137192307 GCTGGAGCAGGCCCCGAGGGAGG - Exonic
1185614658 X:1413490-1413512 CCTGATTCAGGCGCCCCAGGAGG + Intronic
1186430519 X:9500659-9500681 GCTACTGCAGGAGCCCCAGGAGG - Intronic
1187825879 X:23333631-23333653 GCTGGCGCGGGCGCCCCTGCGGG - Intergenic
1190747332 X:53332363-53332385 GCAGGAGCAGCCGCCACAGTGGG - Intergenic
1192429627 X:71103327-71103349 GGTGGAGAAGGAGCCCCAGATGG - Exonic
1192698900 X:73447332-73447354 GCTGGGACAGGCGGCACAGGGGG + Exonic
1196871236 X:120115589-120115611 GCCGGAGGAGCCGGCCCAGGCGG - Exonic
1197707683 X:129646362-129646384 GCTTGAGCAGGGTTCCCAGGAGG - Exonic
1197760145 X:130022178-130022200 GCTGGAGCAGGTCCCAGAGGAGG - Intronic
1198312366 X:135435245-135435267 GCTGGAGCAGGCTCGGCTGGAGG + Intergenic
1198428882 X:136546301-136546323 GCTGGAGCAGTTGGCCCAAGAGG + Intronic
1198915637 X:141668476-141668498 GCTGGAGCAAGAACCCCACGTGG + Intronic