ID: 1129270627

View in Genome Browser
Species Human (GRCh38)
Location 15:74417585-74417607
Sequence CCCTACCTTCAAACAGAACC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 180}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129270615_1129270627 20 Left 1129270615 15:74417542-74417564 CCCAGTTCAGAAGCATCCCCCTG 0: 1
1: 0
2: 0
3: 18
4: 159
Right 1129270627 15:74417585-74417607 CCCTACCTTCAAACAGAACCAGG 0: 1
1: 0
2: 0
3: 18
4: 180
1129270616_1129270627 19 Left 1129270616 15:74417543-74417565 CCAGTTCAGAAGCATCCCCCTGG 0: 1
1: 0
2: 1
3: 12
4: 139
Right 1129270627 15:74417585-74417607 CCCTACCTTCAAACAGAACCAGG 0: 1
1: 0
2: 0
3: 18
4: 180
1129270621_1129270627 3 Left 1129270621 15:74417559-74417581 CCCCTGGGGCGCCTGCTCCAGCA 0: 1
1: 0
2: 2
3: 17
4: 226
Right 1129270627 15:74417585-74417607 CCCTACCTTCAAACAGAACCAGG 0: 1
1: 0
2: 0
3: 18
4: 180
1129270613_1129270627 25 Left 1129270613 15:74417537-74417559 CCCAGCCCAGTTCAGAAGCATCC 0: 1
1: 0
2: 0
3: 23
4: 159
Right 1129270627 15:74417585-74417607 CCCTACCTTCAAACAGAACCAGG 0: 1
1: 0
2: 0
3: 18
4: 180
1129270612_1129270627 30 Left 1129270612 15:74417532-74417554 CCTCTCCCAGCCCAGTTCAGAAG 0: 1
1: 0
2: 2
3: 40
4: 465
Right 1129270627 15:74417585-74417607 CCCTACCTTCAAACAGAACCAGG 0: 1
1: 0
2: 0
3: 18
4: 180
1129270622_1129270627 2 Left 1129270622 15:74417560-74417582 CCCTGGGGCGCCTGCTCCAGCAC 0: 1
1: 0
2: 1
3: 20
4: 253
Right 1129270627 15:74417585-74417607 CCCTACCTTCAAACAGAACCAGG 0: 1
1: 0
2: 0
3: 18
4: 180
1129270623_1129270627 1 Left 1129270623 15:74417561-74417583 CCTGGGGCGCCTGCTCCAGCACT 0: 1
1: 0
2: 0
3: 27
4: 281
Right 1129270627 15:74417585-74417607 CCCTACCTTCAAACAGAACCAGG 0: 1
1: 0
2: 0
3: 18
4: 180
1129270620_1129270627 4 Left 1129270620 15:74417558-74417580 CCCCCTGGGGCGCCTGCTCCAGC 0: 1
1: 0
2: 5
3: 43
4: 394
Right 1129270627 15:74417585-74417607 CCCTACCTTCAAACAGAACCAGG 0: 1
1: 0
2: 0
3: 18
4: 180
1129270624_1129270627 -8 Left 1129270624 15:74417570-74417592 CCTGCTCCAGCACTGCCCTACCT 0: 1
1: 0
2: 1
3: 50
4: 373
Right 1129270627 15:74417585-74417607 CCCTACCTTCAAACAGAACCAGG 0: 1
1: 0
2: 0
3: 18
4: 180
1129270614_1129270627 24 Left 1129270614 15:74417538-74417560 CCAGCCCAGTTCAGAAGCATCCC 0: 1
1: 0
2: 2
3: 22
4: 197
Right 1129270627 15:74417585-74417607 CCCTACCTTCAAACAGAACCAGG 0: 1
1: 0
2: 0
3: 18
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129270627 Original CRISPR CCCTACCTTCAAACAGAACC AGG Exonic