ID: 1129270942

View in Genome Browser
Species Human (GRCh38)
Location 15:74418939-74418961
Sequence CTGCCCTACATGGCCTGAGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 169}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129270933_1129270942 14 Left 1129270933 15:74418902-74418924 CCGTGTGCGGCTCAGTCTGGCCA 0: 1
1: 0
2: 0
3: 11
4: 140
Right 1129270942 15:74418939-74418961 CTGCCCTACATGGCCTGAGGAGG 0: 1
1: 0
2: 1
3: 17
4: 169
1129270935_1129270942 -6 Left 1129270935 15:74418922-74418944 CCAAAGTCCACCCGGTCCTGCCC 0: 1
1: 0
2: 3
3: 32
4: 323
Right 1129270942 15:74418939-74418961 CTGCCCTACATGGCCTGAGGAGG 0: 1
1: 0
2: 1
3: 17
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129270942 Original CRISPR CTGCCCTACATGGCCTGAGG AGG Exonic
900313801 1:2047457-2047479 CTGCCCTGCCTGCCCAGAGGCGG + Intergenic
900483466 1:2910464-2910486 CTGCCCGGCTTGGCCTCAGGTGG + Intergenic
900813437 1:4825636-4825658 CTACCCTACATGGTCTAAAGAGG + Intergenic
903058108 1:20650661-20650683 CTGCCCTCCATGAGCAGAGGAGG - Exonic
903657403 1:24957752-24957774 CTACCCAACATGCCTTGAGGGGG + Intronic
904923502 1:34027867-34027889 CAGCCCTACATGGGCAGAGCAGG + Intronic
907036475 1:51220600-51220622 CTGCCCTACTAGGCCGGAGGGGG + Intergenic
910898232 1:92091250-92091272 ATGTCTTACATGGCCGGAGGAGG - Intronic
912503881 1:110142183-110142205 CCTCCCTGCAGGGCCTGAGGAGG - Intergenic
912507465 1:110166028-110166050 CTGCACGACATGGGCGGAGGAGG - Intronic
912873177 1:113328417-113328439 CTGTCCTACATTGGCTGAGTTGG + Intergenic
915974014 1:160373132-160373154 CTGCTCTCTATGGCCTGAGAAGG + Intergenic
916554127 1:165878534-165878556 CTGGCCAACATGGCCAGAGGGGG - Intronic
918602023 1:186375353-186375375 GAGCCCTACAAGGCCTGAAGTGG - Intronic
921212644 1:212913202-212913224 CTTTCCTACAGGGCCTGAGAAGG + Intergenic
923978122 1:239287985-239288007 CTCCCATATATGGCCTGAGTTGG + Intergenic
1063535127 10:6876054-6876076 CTGCCCTGCCTGCCCTGAGGAGG + Intergenic
1063707081 10:8440918-8440940 CTGTCCTGCATGGCCTGCCGTGG + Intergenic
1063939046 10:11108156-11108178 CATCCCTGCATGGCCTGAGGGGG - Intronic
1068255077 10:54498905-54498927 CTTCCTCACATGGCCAGAGGAGG + Intronic
1069502766 10:68968848-68968870 GTGCCCGACTTGGCCTCAGGTGG + Intronic
1070562030 10:77575422-77575444 ATGCCCGCCATGGCCTCAGGTGG - Intronic
1073137139 10:101226315-101226337 CTACCCGACTTGGCCAGAGGAGG - Exonic
1075723078 10:124598517-124598539 CTGCCCACCATCTCCTGAGGTGG + Intronic
1077105647 11:841379-841401 CTCCCCTACAAAGCCTGATGAGG + Intronic
1077532670 11:3104501-3104523 CTGGCCTCCATGGCCTCATGAGG + Intronic
1077919627 11:6632656-6632678 AAGCCGTACATGGCCTGTGGTGG + Exonic
1078428387 11:11269185-11269207 CTGCCCTGCATGGGCTAAGCAGG + Intergenic
1082778461 11:57267229-57267251 CTGCATTCCATGGCCTGAGAAGG + Intergenic
1083726437 11:64630917-64630939 CTGCCCTCCATGCCCCGAGCTGG - Intronic
1083922593 11:65788536-65788558 CTTTCCTACAAGGCCTGGGGCGG - Intronic
1084606195 11:70173550-70173572 CAGCCCTCCATGGCCAGAGGTGG + Intronic
1088716472 11:112553977-112553999 CTTCCCTACATGGCCTCCAGGGG + Intergenic
1097183365 12:57183596-57183618 CTGCCTGAATTGGCCTGAGGTGG + Intronic
1099724910 12:86412993-86413015 CAGCCTTACATGGCCAGAGCAGG - Intronic
1099921313 12:88960582-88960604 CAGCTCTACCTGGGCTGAGGTGG + Intergenic
1102502019 12:113359251-113359273 CTGGCCTCCATGGGGTGAGGAGG - Intronic
1103976209 12:124704593-124704615 CTGCCATACACGCCCCGAGGGGG - Intergenic
1104600401 12:130149604-130149626 CTGCCCTGCAAGGACCGAGGTGG - Intergenic
1105303158 13:19152770-19152792 CTGCCCAAGGTGGCCTGTGGGGG - Intergenic
1106353188 13:28954775-28954797 CAGCCCTACATGATCAGAGGTGG + Intronic
1110522950 13:76502461-76502483 CTGCCCCAAATTGCCTGAGGAGG - Intergenic
1114785223 14:25589017-25589039 CTGCTCTACATGGCATTAGCAGG - Intergenic
1120808194 14:88775479-88775501 GTGCTCTCCATGGCCTGTGGTGG + Intronic
1122203481 14:100136609-100136631 CTGCCCTAGCTGGGCAGAGGAGG + Intronic
1125610539 15:40966436-40966458 CTGGTCTACATGGCCTGCAGGGG - Intergenic
1126048884 15:44669240-44669262 CTTCCCTTCCTGGGCTGAGGTGG + Intronic
1128268745 15:66290681-66290703 CTGCCCTTCAGGTCATGAGGTGG + Intergenic
1129270942 15:74418939-74418961 CTGCCCTACATGGCCTGAGGAGG + Exonic
1129467703 15:75733129-75733151 CTGCCCTGGATGACCTGAGGAGG - Intergenic
1129719510 15:77870462-77870484 CTGCCCTGGATGACCTGAGGAGG + Intergenic
1129794277 15:78364139-78364161 CTGCCCTACAATGACAGAGGTGG - Intergenic
1131868597 15:96738333-96738355 CTTCCCTCTTTGGCCTGAGGTGG + Intergenic
1132466537 16:79944-79966 CTGCCCTAGATGCCCAGAGCCGG - Intronic
1133287667 16:4698120-4698142 CTCCCCTAGAAGGTCTGAGGTGG - Intronic
1135993312 16:27230476-27230498 CTGACCTACATGGCCTGGTAAGG - Intronic
1141079316 16:81036338-81036360 CTGCCCTCCCCGGCCGGAGGCGG + Intronic
1141299539 16:82801175-82801197 CTGCCCTACAGAGCCTTAGAAGG + Intronic
1141665413 16:85463014-85463036 CTGCCCAGCATGGCCCGCGGCGG - Intergenic
1142768905 17:2082567-2082589 CTGCCCTCAATGGCCTGGGCAGG + Intronic
1143535702 17:7537921-7537943 TTGTCCTGCAGGGCCTGAGGAGG + Intergenic
1143617616 17:8063212-8063234 CTGTCCTGCATAGCCTGAGGAGG + Intergenic
1145757594 17:27404040-27404062 CTGCCCCAGATGCCCAGAGGAGG + Intergenic
1148323926 17:46772463-46772485 CAGCGCTACCTGGCCCGAGGAGG + Intronic
1148392594 17:47283536-47283558 CAGCCCTACCTGGCCGGAGCCGG - Exonic
1150130653 17:62667015-62667037 CCGCCCTACATGGGCTAGGGGGG - Intronic
1150940497 17:69688020-69688042 CTGCACTGCAGGGTCTGAGGTGG + Intergenic
1156613671 18:38757261-38757283 CAGCCCCACCTGGCCTGACGTGG + Intergenic
1156616434 18:38790996-38791018 TTGCCCTGCATGGCCTGAGTTGG + Intergenic
1160423363 18:78764560-78764582 CTGCCCTACATTGTCTGATGGGG + Intergenic
1160628511 18:80229426-80229448 CTGACTTCCTTGGCCTGAGGGGG - Intronic
1163143955 19:15368530-15368552 ACTCCCCACATGGCCTGAGGCGG + Intronic
1165444463 19:35849267-35849289 CTGCCGTGCGTGGCCCGAGGGGG - Exonic
1165660816 19:37578755-37578777 CTGCCCTACCTCCTCTGAGGCGG + Intronic
1165831699 19:38733806-38733828 CTGCCCTCCATGCCCTGAAGAGG + Intronic
1167406014 19:49309257-49309279 GTGCCCTACAAGGCCTGACGGGG + Intronic
925790195 2:7476801-7476823 CTGCCATACCTGGGCTCAGGTGG - Intergenic
928310598 2:30206471-30206493 CAGACCTAATTGGCCTGAGGAGG + Intergenic
929440167 2:41959556-41959578 CTGCTCTAGAGGTCCTGAGGTGG + Intergenic
929539946 2:42811412-42811434 CTGCCCCACATCGCCAGGGGGGG + Intergenic
930025912 2:47029055-47029077 CTGCCCCAGATGGCCTGGCGAGG - Intronic
932110335 2:68993451-68993473 CTGCCTCTCATGGCATGAGGTGG + Intergenic
932366911 2:71159177-71159199 CTGTCCTACAGGGTCTGAGAAGG - Intergenic
933228701 2:79780637-79780659 ATCCCCTAAATGGCCTAAGGAGG + Intronic
937301096 2:120842652-120842674 CTGCCCCACATGGCGTGGGCTGG + Intronic
937700423 2:124857536-124857558 CTCCCCTGCCTGGCCTGAGTTGG - Intronic
937961894 2:127466457-127466479 CGGCCCTGCTTGGCCGGAGGTGG + Intronic
938610627 2:132944235-132944257 TTGTTCTACATGGCCTTAGGAGG + Intronic
938999578 2:136718528-136718550 ATGCCCTACATGGCTGGAGCAGG - Intergenic
941896847 2:170637572-170637594 ATGCCCTCCCTGACCTGAGGAGG - Intronic
943691174 2:190871215-190871237 ATGTCTTACATGGCCGGAGGAGG + Intergenic
944659729 2:201911388-201911410 CTTCCCTTCATGGCCTGAACTGG + Intergenic
945469529 2:210211611-210211633 ATGTCCTACATGGCCAGAGAAGG - Intronic
948856657 2:240733389-240733411 CGGCCCTGCAGGGCCTGAGCAGG - Intronic
1171858896 20:30376902-30376924 CTGCCCTCCCCGGCCTGCGGCGG - Intergenic
1173919186 20:46731228-46731250 CTTTCCTGCATGGCCTAAGGAGG + Intronic
1175943187 20:62547279-62547301 CTGGCCTACAAGGCCTGACGTGG + Intergenic
1177489427 21:21803263-21803285 ATGCCCTACATGGCTGGAGCAGG - Intergenic
1178467091 21:32858750-32858772 AGGCCCTCCCTGGCCTGAGGTGG + Intergenic
1180297992 22:10961770-10961792 CTGCCCTCGTTGGCCTGCGGCGG + Intergenic
1180913599 22:19470205-19470227 CTGCCCAACCTGGCCTGTTGGGG - Intronic
1181045082 22:20210575-20210597 GTGGCCTGCAGGGCCTGAGGTGG + Intergenic
1182083350 22:27544292-27544314 CTGACCTCCATGGGCTGGGGTGG + Intergenic
1182357792 22:29730076-29730098 CTGCCTGGCATAGCCTGAGGAGG + Exonic
1182715195 22:32352632-32352654 CAGCCCTGCCTGGCCTGGGGTGG - Intergenic
949571619 3:5299457-5299479 CTGGCCTATAAGGTCTGAGGGGG + Intergenic
949831867 3:8223388-8223410 CTGCCCAGCATGGCTAGAGGAGG + Intergenic
950387573 3:12672252-12672274 CTGCCCATTATGGCATGAGGGGG - Intergenic
953710279 3:45264161-45264183 CAGCCTGACATGGCCTGAGCTGG + Intergenic
954004199 3:47578783-47578805 CTGCCCATCGTGGGCTGAGGCGG - Exonic
954800902 3:53186424-53186446 CTGCCTTAAGTGGCCTGAAGGGG - Intronic
957165756 3:76671269-76671291 ATGTCCTGCATGGCGTGAGGGGG - Intronic
957262517 3:77920194-77920216 CTGCCATTCATGACCAGAGGAGG - Intergenic
961171852 3:124802745-124802767 CTGGCCTGCATGGCCTGGTGTGG + Intronic
961819126 3:129566314-129566336 CTGCTCTACCTGGCCTGCGGGGG + Intronic
965049558 3:163627579-163627601 CTGCCCTACATGCCTGGAGTAGG - Intergenic
969198967 4:5586473-5586495 CTTCCCTTCATGGCCTGAACTGG - Intronic
969338792 4:6527777-6527799 CTGTCCTCCATGGGCTGAGGTGG - Intronic
970028885 4:11654936-11654958 CTTTCCTACAGGGTCTGAGGAGG - Intergenic
970667429 4:18353852-18353874 GTACTCTTCATGGCCTGAGGTGG - Intergenic
970809838 4:20079343-20079365 ATGTCCTACATGGCCAGAGCAGG + Intergenic
975674414 4:76812183-76812205 CTGCCACACATGGTCTGAGTCGG + Intergenic
979205954 4:118038251-118038273 CTGCCCTATATGACTTAAGGGGG - Intronic
979568039 4:122179162-122179184 CTTAGCTACTTGGCCTGAGGTGG + Intronic
981948253 4:150375273-150375295 CAGCCCTACAAGGCATAAGGGGG + Intronic
982090359 4:151875216-151875238 CTGGTCTACAAGGCCTTAGGTGG - Intergenic
983622388 4:169774746-169774768 CTGCCCTTCATCGCCTAAGTGGG - Intergenic
984759199 4:183349163-183349185 TTGCCCTATATGGTCTAAGGGGG + Intergenic
985437034 4:189940570-189940592 CTGCCCTCGCTGGCCTGCGGCGG - Intergenic
985675014 5:1226437-1226459 CAGCCCGGCCTGGCCTGAGGAGG - Intronic
985858991 5:2455431-2455453 CTTCCCCACGTGGCCTGATGAGG + Intergenic
985931292 5:3059607-3059629 CTGCCATTCATTTCCTGAGGAGG - Intergenic
986199612 5:5569436-5569458 CTGCCCTCCAGGGCCTGCTGTGG + Intergenic
987434701 5:17880938-17880960 CTGCCCTACATAGGTTTAGGGGG - Intergenic
989660266 5:43790639-43790661 CTTTCCTACAGGGTCTGAGGAGG + Intergenic
989767278 5:45102534-45102556 CTTCCCTACATGACATAAGGTGG - Intergenic
991701853 5:69323592-69323614 CTGCTGTGCGTGGCCTGAGGTGG - Intronic
994975393 5:106797767-106797789 TTCCCCTACATGGCCTAGGGTGG + Intergenic
995250221 5:109984587-109984609 ATGCCCTACATGGCTAGAGCAGG - Intergenic
996126332 5:119729017-119729039 ATGCCTTACATGGCCAGAGCAGG - Intergenic
998426218 5:142030823-142030845 CTGCCCCACGTGCCCTGAGCTGG - Intergenic
998587729 5:143445799-143445821 TTGTCCCACATGGCCTCAGGAGG - Intergenic
999282680 5:150375448-150375470 CTTCCCCACCTGGGCTGAGGGGG - Exonic
1003826475 6:9958291-9958313 CTGCCCTGAATGGCCCGAAGAGG - Intronic
1004778867 6:18882367-18882389 CTGTCTTACATGGCCAGAGCAGG - Intergenic
1005418523 6:25626404-25626426 CTGCCCTGCTGGGCCTGGGGTGG - Intergenic
1006520233 6:34567091-34567113 CTGCCCCACAGGGCCTGGGCTGG + Intergenic
1006914386 6:37585167-37585189 CTGCCCTACATGGCAGGAGGCGG - Intergenic
1007495982 6:42260666-42260688 CTGGCCTGCAGGGCCTGAGAGGG - Intronic
1009596109 6:65738866-65738888 ATGTCCTACATGGCCAGAGCAGG - Intergenic
1013332530 6:109119176-109119198 GAGCCCTATATGCCCTGAGGAGG + Intronic
1018091107 6:160347832-160347854 CTGCCCCACATGGGCGCAGGAGG + Intergenic
1021603830 7:22391341-22391363 GTGCCCTGCATAGCCTGAGAGGG - Intergenic
1023857710 7:44194872-44194894 CAGGCCTCCATGGCCTGAGTAGG - Intronic
1024062819 7:45711304-45711326 CTTCCCTCCATGGCCTCTGGAGG - Intronic
1025814992 7:64903145-64903167 CTGTCATTCAGGGCCTGAGGGGG + Intronic
1026899401 7:74028511-74028533 CTGCCCTGCGAGGGCTGAGGGGG + Intronic
1028486597 7:91365365-91365387 TTACCCTATATGGTCTGAGGAGG + Intergenic
1029300631 7:99580100-99580122 CTGCCCTTCATCGCCTAAGTGGG - Intronic
1034076236 7:148233951-148233973 ATGTCTTACATGGCCTGAGAAGG - Intronic
1036746470 8:11413481-11413503 CTACCCTATATGGCCTGAAAGGG + Intronic
1037626178 8:20609081-20609103 CTGGCCTACATGGTCTGTGTTGG - Intergenic
1042501490 8:69514309-69514331 CTGTCCTACATGGCTGGAGCAGG + Intronic
1045561975 8:103272387-103272409 ATGCCCTACATGGCTGGAGCAGG - Intergenic
1045569746 8:103356611-103356633 ATGTCCTACATGGCCGGAGCAGG + Intergenic
1046455434 8:114453683-114453705 CTTACCTTCATGGCCAGAGGTGG - Intergenic
1048875703 8:138835586-138835608 CAGCCCTGCAGGTCCTGAGGGGG - Intronic
1049419883 8:142511760-142511782 CTGCACCCCCTGGCCTGAGGTGG + Intronic
1050138149 9:2490011-2490033 CTCCCTCACATGGCCTGTGGGGG + Intergenic
1050615775 9:7400435-7400457 ATGCCCTACATGGCTGGAGCAGG + Intergenic
1051233829 9:14978416-14978438 CTGCCCTTCATCGCCTAAGAGGG + Intergenic
1052237963 9:26235245-26235267 CTGCCCTAAATAGGATGAGGTGG - Intergenic
1056855891 9:90129313-90129335 ATGCCCTCTATGGCCTGAGATGG - Intergenic
1057626647 9:96684077-96684099 CTTGCCTTCATGGCCTTAGGCGG + Intergenic
1060103384 9:120858665-120858687 CTGCACTGCATGGCCTCAGGAGG - Intronic
1060504682 9:124188894-124188916 CTGAGCTACTTGGGCTGAGGAGG - Intergenic
1062023423 9:134329709-134329731 CTGTCCTTCAGGGCCTGTGGGGG + Intronic
1188431380 X:30107858-30107880 CTTTCCTACAGGGTCTGAGGAGG + Intergenic
1189414899 X:40804915-40804937 CTGAACTACTTGGCCAGAGGAGG + Intergenic
1190281595 X:48934640-48934662 CTGCCCAACCTGGCCTGCTGTGG - Intronic
1190913178 X:54790394-54790416 CTTCCCTCCAGGGCCTGAGATGG + Intronic
1192873703 X:75208002-75208024 CTGCTCTACATGGCCTCACATGG - Intergenic
1194197878 X:90917875-90917897 CTGCTCTACTTGGCATAAGGTGG - Intergenic
1194358473 X:92918123-92918145 GTACTCCACATGGCCTGAGGTGG - Intergenic
1198956715 X:142139987-142140009 ATGTCCTACATGGCTGGAGGAGG - Intergenic
1199453469 X:147999404-147999426 CTGTCCTACATGACATGAGAAGG - Intronic
1200543860 Y:4494944-4494966 CTGCTCTACTTGGCATAAGGTGG + Intergenic
1200666653 Y:6033814-6033836 GTACTCCACATGGCCTGAGGTGG - Intergenic