ID: 1129273954

View in Genome Browser
Species Human (GRCh38)
Location 15:74433458-74433480
Sequence CGCCCGGGCGTTGCGGCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 102}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129273946_1129273954 -10 Left 1129273946 15:74433445-74433467 CCCCCTCCCCTGGCGCCCGGGCG 0: 1
1: 0
2: 0
3: 43
4: 376
Right 1129273954 15:74433458-74433480 CGCCCGGGCGTTGCGGCTCCTGG 0: 1
1: 0
2: 1
3: 4
4: 102
1129273940_1129273954 6 Left 1129273940 15:74433429-74433451 CCGAGAGAGGGGCCCGCCCCCTC 0: 1
1: 0
2: 1
3: 21
4: 228
Right 1129273954 15:74433458-74433480 CGCCCGGGCGTTGCGGCTCCTGG 0: 1
1: 0
2: 1
3: 4
4: 102
1129273935_1129273954 23 Left 1129273935 15:74433412-74433434 CCCAGAGTGGCTCGGGGCCGAGA 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1129273954 15:74433458-74433480 CGCCCGGGCGTTGCGGCTCCTGG 0: 1
1: 0
2: 1
3: 4
4: 102
1129273943_1129273954 -7 Left 1129273943 15:74433442-74433464 CCGCCCCCTCCCCTGGCGCCCGG 0: 1
1: 1
2: 9
3: 113
4: 998
Right 1129273954 15:74433458-74433480 CGCCCGGGCGTTGCGGCTCCTGG 0: 1
1: 0
2: 1
3: 4
4: 102
1129273936_1129273954 22 Left 1129273936 15:74433413-74433435 CCAGAGTGGCTCGGGGCCGAGAG 0: 1
1: 0
2: 0
3: 6
4: 89
Right 1129273954 15:74433458-74433480 CGCCCGGGCGTTGCGGCTCCTGG 0: 1
1: 0
2: 1
3: 4
4: 102
1129273942_1129273954 -6 Left 1129273942 15:74433441-74433463 CCCGCCCCCTCCCCTGGCGCCCG 0: 1
1: 1
2: 19
3: 131
4: 1067
Right 1129273954 15:74433458-74433480 CGCCCGGGCGTTGCGGCTCCTGG 0: 1
1: 0
2: 1
3: 4
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129273954 Original CRISPR CGCCCGGGCGTTGCGGCTCC TGG Intronic
902214302 1:14924619-14924641 CGCCCGGCCCCGGCGGCTCCTGG - Intronic
903458403 1:23504277-23504299 CTCCCGGACGGGGCGGCTCCCGG - Intergenic
903628280 1:24746304-24746326 CCCCCCGGCGTTGCTGCTTCGGG + Intronic
905416493 1:37808027-37808049 CGCCCGGCTGTTGCGGCTCCCGG - Exonic
907216622 1:52869980-52870002 CTCCCGGGCGGGGCGGCTGCCGG + Intronic
913615798 1:120558497-120558519 CGGCCGGCCGCTGCTGCTCCGGG - Intergenic
914574477 1:148952405-148952427 CGGCCGGCCGCTGCTGCTCCGGG + Intronic
915208411 1:154287760-154287782 CGCCCGGACGGGGCGGCTGCCGG - Intergenic
920528748 1:206686164-206686186 CGCCCGCGCGGGGCGGCTCCGGG + Intronic
921476329 1:215615338-215615360 CGGCCGGGCGTGGTGGCTCACGG + Intronic
924624653 1:245688434-245688456 CGCCCGGGGCTTGCAGCTGCGGG + Exonic
1069534321 10:69241763-69241785 CGGCCGGGCGTGGTGGCTCATGG - Intronic
1070257498 10:74825152-74825174 CGCCCAGGCTTTGCGCCTTCGGG - Intergenic
1070580021 10:77711916-77711938 TGCCCAGGCCTTGGGGCTCCAGG + Intergenic
1079296740 11:19241359-19241381 CGCCCGGGCGACACGGCACCGGG - Intronic
1082023878 11:47557166-47557188 AGGCCGGGCGTGGTGGCTCCCGG - Intronic
1083205519 11:61146527-61146549 CGCCTGGGCTGTGCTGCTCCTGG - Intronic
1085228923 11:74947991-74948013 CGGCCGGGCGTGGGGGCTCATGG - Intronic
1089499884 11:118925726-118925748 CCCCCGGGCGGCGCGGCGCCGGG + Intronic
1094219455 12:27975993-27976015 CTCTGGGGCGTTGCGGCCCCTGG - Intergenic
1095102802 12:38201707-38201729 CGCCCCTGCGTTGCGGCCCCTGG + Intergenic
1096777936 12:53975019-53975041 TGCCCGGGTGCTGCGGCTGCAGG + Intronic
1096983718 12:55743358-55743380 CGCCCTGGAGCTGCGGCCCCGGG + Exonic
1097871971 12:64610006-64610028 GGACTGGGCGTTGCGGCTGCAGG + Intergenic
1101897718 12:108768786-108768808 CGACGGGGCGTCGCGCCTCCAGG + Intergenic
1102566826 12:113802509-113802531 CACCCGGGCGTGTCGCCTCCCGG - Intergenic
1103723664 12:122987542-122987564 CGCCCAGGCGGTGCGACTCAGGG + Exonic
1104028895 12:125049843-125049865 CGCCCGGGCGTTGGGGTCGCGGG + Intergenic
1106478090 13:30115017-30115039 TGCCTGGGCGCTGCGGCTCGCGG - Intergenic
1113921721 13:113917175-113917197 GGCCCTGGCGTTGTGTCTCCTGG - Intergenic
1115398556 14:32934809-32934831 CCCCCGGGCGCGGCGGCTCTGGG - Intergenic
1116841073 14:49821185-49821207 CTCCCGGGCGTGGTGGCTGCCGG - Intronic
1117596980 14:57334047-57334069 CTCCCGGACGGGGCGGCTCCTGG - Intergenic
1119866867 14:77981331-77981353 CGCCCGGGAGCCGCTGCTCCTGG - Intergenic
1120774774 14:88421668-88421690 CGGCCGGGCGTGGTGGCTCATGG + Intronic
1129273954 15:74433458-74433480 CGCCCGGGCGTTGCGGCTCCTGG + Intronic
1137876095 16:51997978-51998000 CCCCAGGGAGTTGCTGCTCCTGG - Intergenic
1139545659 16:67648443-67648465 CGCGCGGACGCTGCGGCACCTGG + Exonic
1140440641 16:74985024-74985046 CGCCCGGCCGCCGCGGCCCCAGG + Exonic
1141453159 16:84119249-84119271 CTCCCTGGAGTTGTGGCTCCTGG + Intergenic
1143016371 17:3893058-3893080 CCCGCGGGCGCCGCGGCTCCGGG + Intronic
1144573602 17:16415799-16415821 GGCCAGGGCGTGGCGGCTGCTGG - Exonic
1147741037 17:42671074-42671096 CGCGAATGCGTTGCGGCTCCGGG + Exonic
1151155671 17:72121913-72121935 CGCCCGGGAGTTGCCGTTCCGGG + Intronic
1152174869 17:78781416-78781438 CTCCCGCGCGTTGAGGCTGCTGG - Intronic
1152231121 17:79114623-79114645 CGCCGGGGCGGTGCCACTCCCGG + Intronic
1155152984 18:23136548-23136570 CGCCCTGGCCTGGCTGCTCCAGG - Exonic
1160931482 19:1572238-1572260 CGGCCGGGCGTGGTGGCTCATGG - Intergenic
1161560300 19:4969288-4969310 CGCCCCCGCGTCGCGGCTCGGGG + Intronic
1161595841 19:5150645-5150667 CGCCCAGGAGCTGCGGCACCAGG - Intronic
1161672626 19:5622639-5622661 GGCCCGGGCGTTGCGGAGACTGG - Exonic
1161818837 19:6516760-6516782 CACCCGGCAGGTGCGGCTCCTGG - Intergenic
1162954361 19:14090210-14090232 CGCGCGTGCGCTCCGGCTCCGGG + Exonic
1164615675 19:29665607-29665629 CGCGCGGTCTTGGCGGCTCCTGG + Intronic
1165393280 19:35550395-35550417 TGCCCAGGCGCTGCTGCTCCAGG + Exonic
926185827 2:10689988-10690010 TGCCCGCGTGTTCCGGCTCCAGG - Intergenic
929065034 2:37964050-37964072 CTCCCGGACGTGGCGGCTGCCGG + Intronic
931584273 2:63809182-63809204 CTCCCGGGCGGGGCGGCTGCCGG - Intronic
932245339 2:70191897-70191919 CGGCCGGGCGTCGTGGCTCACGG + Intronic
940962173 2:159798015-159798037 CGGCCGGGTGTTGCGTCTGCGGG + Intronic
942186783 2:173431740-173431762 CTCCCGGGTTTTGCGGCTGCTGG - Intergenic
949079769 2:242087949-242087971 GGCACGGGGGCTGCGGCTCCTGG + Intergenic
1170889892 20:20368163-20368185 TGCCCGGGCGCGGCGGCTGCGGG - Exonic
1175451279 20:59070799-59070821 CGGCCGGGCGTGGTGGCTCGTGG - Intergenic
1176125368 20:63472554-63472576 CGCCTCGGCCATGCGGCTCCCGG - Exonic
1179784060 21:43719708-43719730 CGGGCGGGCGGTGCGGCTCCCGG + Intronic
1182149835 22:28020154-28020176 CTCCTGGGGGCTGCGGCTCCGGG + Intronic
1183504617 22:38202321-38202343 CGTCCGGGCGATGGAGCTCCGGG - Intronic
955172991 3:56584167-56584189 CTCCCGGGCGGGGCGGCTGCCGG + Intronic
955688222 3:61564866-61564888 CGGCCTGGCGATGCTGCTCCTGG + Intronic
960602111 3:119468931-119468953 CGCCCACGTGCTGCGGCTCCCGG + Exonic
963173102 3:142271091-142271113 CGGCCGGGCGTGGTGGCTCATGG + Intergenic
968323461 3:197791584-197791606 CCCCCGGCCGGGGCGGCTCCCGG - Intronic
968947367 4:3672278-3672300 CACCCAGGAGTGGCGGCTCCAGG - Intergenic
969053320 4:4387290-4387312 CGCCCGGGTGCGGCGGCCCCAGG + Intronic
976751907 4:88457508-88457530 CGTCCGGGCGCCGCCGCTCCCGG - Exonic
983061492 4:163166411-163166433 CGCGCAGGCTCTGCGGCTCCTGG + Exonic
985995396 5:3594756-3594778 GGCCCTGGCCGTGCGGCTCCCGG - Intergenic
994421944 5:99533940-99533962 CGGACGTGCGTTGGGGCTCCTGG + Intergenic
994460898 5:100066644-100066666 CGGACGTGCGTTGGGGCTCCTGG - Intergenic
994485046 5:100380069-100380091 CGGACGTGCGTTGGGGCTCCTGG - Intergenic
997235913 5:132271797-132271819 GGCCCGGGCCTGGCGGCCCCCGG + Exonic
1002578674 5:180193931-180193953 CGGCCGGGCATTGCGGCCCTGGG + Intronic
1004861042 6:19804938-19804960 CTCCCGGGCCGCGCGGCTCCAGG - Intergenic
1006096702 6:31660740-31660762 CTTCCGGGCTTCGCGGCTCCCGG - Exonic
1008039868 6:46785971-46785993 AGCCCGGGCTTTGTGGTTCCGGG - Intergenic
1019662613 7:2233040-2233062 CTCCCAGGGGTGGCGGCTCCGGG - Exonic
1021313238 7:19117413-19117435 GGCCCGGGCGATGCGGCCCGCGG + Exonic
1022715124 7:32891812-32891834 CGGGCGGGCGGCGCGGCTCCCGG - Exonic
1029640304 7:101816120-101816142 CGCCCGGGGGTGGGGGCTGCGGG + Intronic
1032087287 7:128890878-128890900 CGCCCTGGCGGTGCCCCTCCCGG - Intronic
1032156865 7:129476252-129476274 CTCCCGGGCGGGGCGGCTGCCGG + Intronic
1032398530 7:131607908-131607930 AGCCCCTGTGTTGCGGCTCCCGG - Intergenic
1035353502 7:158263638-158263660 CTCCCGGGCATTCCAGCTCCTGG + Intronic
1035381566 7:158444316-158444338 CGCCTGGGCGCTGGGGCTCACGG - Intronic
1035537818 8:406234-406256 GGCACGGGGGCTGCGGCTCCTGG + Intergenic
1038308283 8:26424187-26424209 CGCCCAGGCCTGGAGGCTCCAGG - Intronic
1041432986 8:57805285-57805307 CGGCCGGGCGTGGTGGCTCATGG + Intergenic
1042512579 8:69626732-69626754 CGGCCGGCCCTTGCGGCCCCGGG - Intronic
1043871506 8:85438623-85438645 CTCCCGGGAGTCGTGGCTCCTGG - Intronic
1044629165 8:94262317-94262339 CGCCCGGCCGCGGCGGCTGCAGG - Exonic
1053073733 9:35115916-35115938 GGCCCGGGCGTTGCGGGGGCGGG - Intronic
1055397918 9:75892687-75892709 CGCCTGGGGGATGCGGCACCTGG + Intronic
1056732567 9:89178485-89178507 CGCCCGGGCGCTGCTGGTGCCGG + Exonic
1057245753 9:93452467-93452489 CGCCCGGCCGTGGCGGCGCTGGG + Exonic
1062113988 9:134797769-134797791 TGGCCGGGCGTGGGGGCTCCGGG - Intronic
1189323163 X:40098089-40098111 CGCCCGAGCGCTGCGCCTGCGGG - Intronic
1199772463 X:150983657-150983679 CGCCCGCCCGTGGCGGCCCCAGG + Intronic