ID: 1129274029

View in Genome Browser
Species Human (GRCh38)
Location 15:74433775-74433797
Sequence TAGGTGGCCCTGGGCGGAGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 293}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129274020_1129274029 7 Left 1129274020 15:74433745-74433767 CCAGACGGCGAAGATGCGGGGTC 0: 1
1: 0
2: 0
3: 0
4: 27
Right 1129274029 15:74433775-74433797 TAGGTGGCCCTGGGCGGAGGCGG 0: 1
1: 0
2: 1
3: 22
4: 293
1129274015_1129274029 16 Left 1129274015 15:74433736-74433758 CCTACCTTTCCAGACGGCGAAGA 0: 1
1: 0
2: 0
3: 6
4: 57
Right 1129274029 15:74433775-74433797 TAGGTGGCCCTGGGCGGAGGCGG 0: 1
1: 0
2: 1
3: 22
4: 293
1129274012_1129274029 29 Left 1129274012 15:74433723-74433745 CCGCGCGGCGCCGCCTACCTTTC 0: 1
1: 0
2: 1
3: 5
4: 61
Right 1129274029 15:74433775-74433797 TAGGTGGCCCTGGGCGGAGGCGG 0: 1
1: 0
2: 1
3: 22
4: 293
1129274016_1129274029 12 Left 1129274016 15:74433740-74433762 CCTTTCCAGACGGCGAAGATGCG 0: 1
1: 0
2: 0
3: 1
4: 20
Right 1129274029 15:74433775-74433797 TAGGTGGCCCTGGGCGGAGGCGG 0: 1
1: 0
2: 1
3: 22
4: 293
1129274014_1129274029 19 Left 1129274014 15:74433733-74433755 CCGCCTACCTTTCCAGACGGCGA 0: 1
1: 0
2: 0
3: 11
4: 50
Right 1129274029 15:74433775-74433797 TAGGTGGCCCTGGGCGGAGGCGG 0: 1
1: 0
2: 1
3: 22
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129274029 Original CRISPR TAGGTGGCCCTGGGCGGAGG CGG Exonic
900176050 1:1291799-1291821 AAGGAGGCCCGGGGCGGAGGGGG + Exonic
900180429 1:1308750-1308772 CACGTGGGCCCGGGCGGAGGCGG + Intronic
900503699 1:3018791-3018813 GAGGTGGCCCTGGGCGGGCTGGG - Intergenic
900626239 1:3609954-3609976 TGGCTGGTCCTGGGAGGAGGTGG + Intronic
901196941 1:7445522-7445544 AAGGTGACCCTGGACGGGGGAGG + Intronic
901235456 1:7665108-7665130 TAGGGTGCCCTGGGCCGAGGCGG - Exonic
901930954 1:12595841-12595863 GAGGAGGGGCTGGGCGGAGGGGG + Intronic
903153944 1:21431285-21431307 GAGGTGGCCCTGCGCGGCGCTGG - Intergenic
906032970 1:42735095-42735117 CAGGGGGCCCTTGGCGGAGGCGG + Exonic
906676756 1:47698779-47698801 TAGTTGGCAGTGGGTGGAGGGGG - Intergenic
907281635 1:53350822-53350844 TGGGTGGGCCTGGGCTGCGGTGG - Intergenic
907324354 1:53627192-53627214 TAGGTAGTCCTGGGAGGGGGAGG + Intronic
907767130 1:57423241-57423263 TAGCTGGGCGTGGGGGGAGGGGG + Intronic
908036680 1:60061999-60062021 TGGGTAGCCCTGGCAGGAGGAGG + Intronic
910449563 1:87331646-87331668 GAGGGGGCAGTGGGCGGAGGCGG + Intronic
913251251 1:116913392-116913414 TAGCTGGAGCTGGGAGGAGGAGG + Intronic
913352880 1:117881518-117881540 GAGGTAGCCATGGGCAGAGGAGG + Intronic
915496553 1:156286122-156286144 GAGGTGGTCCTGGGAGGAGATGG - Intronic
916694556 1:167221769-167221791 GAGGTGGCCTGGGGCGGCGGGGG + Intronic
916713248 1:167430554-167430576 CAGGTTGCCCTTGGGGGAGGAGG - Intergenic
916820406 1:168392793-168392815 TAGGTGGCCGTGGTGGGAGGAGG + Intergenic
917916626 1:179708780-179708802 CAGGGGGCCTTGGGCAGAGGAGG - Intergenic
917965869 1:180178195-180178217 TAGGAGGCCGTGTGGGGAGGGGG - Intronic
920049946 1:203157835-203157857 GAGGTGGCCCTGGGCAGCAGAGG + Intronic
920398769 1:205664333-205664355 AGGGTGACCCTGGGCTGAGGGGG - Intronic
921110959 1:212036004-212036026 GAGTCGGCCCTGGTCGGAGGTGG - Intronic
921893025 1:220371580-220371602 TAGGTGGCCCTGAGTGTAGGTGG + Intergenic
922478601 1:225923677-225923699 TAGGTGGAGCCGGGCGGAGTGGG - Intronic
922804442 1:228378206-228378228 TGGGTAGACCAGGGCGGAGGGGG - Intronic
922809088 1:228406134-228406156 AAGGTGCTCCTGGGCGGGGGTGG - Exonic
923092315 1:230750032-230750054 TTGGTGGCCCTGGTCCCAGGAGG - Intronic
1062876543 10:947501-947523 TCTGTGGCCCTGGAAGGAGGAGG + Intergenic
1062996411 10:1870792-1870814 CAGGTGGCCCTGGGCCCTGGGGG + Intergenic
1064053578 10:12079051-12079073 AAGGTGGCCTTGGGCAGAGCTGG + Intronic
1064193214 10:13225382-13225404 TAGGTGACTCGGGGCGGGGGCGG + Intronic
1065814323 10:29470578-29470600 TCCCTGGCCCTGGACGGAGGTGG - Intronic
1065938626 10:30543882-30543904 TAGATGGCCCTGGACCCAGGAGG + Intergenic
1067660803 10:48235058-48235080 GAGGTGGGACTGGGCTGAGGAGG + Intronic
1068411678 10:56663454-56663476 TAGGTAGCTCTGGGCGGAAGTGG - Intergenic
1068649057 10:59501378-59501400 TAGGTGGCAGTGGGGGGATGTGG - Intergenic
1069593175 10:69654483-69654505 TTGGTGGCCCAGAGAGGAGGGGG + Intergenic
1069867898 10:71515013-71515035 GGGGTGGCCCTGGGAGGAGCAGG - Intronic
1070278929 10:75034780-75034802 TAGGTAAGCCTGGGTGGAGGAGG - Intergenic
1070722727 10:78768024-78768046 CAGGTGGCCCTGTGGGCAGGAGG + Intergenic
1072007104 10:91262342-91262364 TAGGTGAACCTGGGAGGCGGAGG + Intronic
1072285763 10:93913058-93913080 AAGGTTGCCCTTGGAGGAGGAGG + Intronic
1072637244 10:97185862-97185884 GAGGGCGCCTTGGGCGGAGGGGG + Exonic
1073105459 10:101030127-101030149 TAGGTGGCCTCGGGAGGAGAGGG + Exonic
1073114311 10:101082636-101082658 CAGGTGAACCTGGGCGGTGGAGG + Intergenic
1074221039 10:111438261-111438283 TTGGTGGCTCAGGGAGGAGGTGG - Intergenic
1075562202 10:123476206-123476228 TAGGTGGGTCTGGTGGGAGGTGG + Intergenic
1075849598 10:125576071-125576093 TGGCTGGCCCAGGGAGGAGGTGG - Intergenic
1076372517 10:129964472-129964494 TCGGTGGCGCTCGGCGGCGGCGG - Intergenic
1076850545 10:133090312-133090334 CGGGTGGCCCCGGGCCGAGGAGG - Intronic
1077023440 11:429831-429853 TAGGTGGGCCGGAGAGGAGGTGG + Intronic
1077226401 11:1440716-1440738 TGGGAGGCCCTGGGATGAGGAGG + Intronic
1077423724 11:2464775-2464797 TAGGTGGGCTGGGGCTGAGGCGG + Intronic
1077492591 11:2868974-2868996 GAGGGGGCCCTGGAGGGAGGCGG + Intergenic
1080639786 11:34152048-34152070 TTGGAGGGCCTGGGCGGAGGTGG + Exonic
1081883560 11:46475182-46475204 TAGGTAGCACTGGGCGCTGGAGG - Intronic
1083172964 11:60933874-60933896 TGGGCGGCCCAGGGTGGAGGTGG - Intronic
1083301882 11:61743929-61743951 GAGGCGGCCCTGGGCAGTGGCGG + Exonic
1085319804 11:75567000-75567022 CAGGGGGTCCTGGGAGGAGGAGG - Intronic
1085387258 11:76164336-76164358 GAGGTGTCCCTGGGGGCAGGGGG - Intergenic
1085909955 11:80811479-80811501 CAGGTGGGCCTGGTGGGAGGTGG - Intergenic
1087039262 11:93783144-93783166 TAGATGGCCGTGTGTGGAGGGGG - Intronic
1088908091 11:114169955-114169977 CAGGTGGCTATGGGCGGAGGAGG - Intronic
1089641898 11:119853311-119853333 GAGGTGGCCCTGGGAGGAGGGGG - Intergenic
1089940814 11:122414856-122414878 TAGCTGGACCTGGGAGGATGGGG + Intergenic
1090635007 11:128685611-128685633 AAAGTGCGCCTGGGCGGAGGCGG + Intergenic
1091634315 12:2185790-2185812 TGTGTGGCCCTGGGCAGAAGCGG + Intronic
1091795235 12:3294294-3294316 AATGTGGCCCTGGGGGCAGGGGG - Intergenic
1091915593 12:4270273-4270295 TAGGCGCCCCTGCGCGGAGAAGG + Intergenic
1092238122 12:6822225-6822247 CAGCTGGGCCTGGGTGGAGGTGG + Intronic
1092788363 12:12050191-12050213 TAGATGGACTTGGGAGGAGGTGG + Intronic
1092899495 12:13044815-13044837 TGGCTGGACCTGGGCGGGGGCGG + Intronic
1095978184 12:47954099-47954121 TGGGTGGGCCTGGGCAGAGGGGG - Intergenic
1096493852 12:52027732-52027754 CTGGTGGCCCTGGGCACAGGGGG + Intronic
1096863408 12:54546642-54546664 CAGGAGGCCCTGTGGGGAGGAGG - Exonic
1097969623 12:65619069-65619091 CAGGAGGCTCTGGGCGGGGGAGG + Intergenic
1100155929 12:91800247-91800269 TAGGAGGCCCTGGGCCAAGGTGG - Intergenic
1100179568 12:92070727-92070749 TAGGTGACCCTGGTCAAAGGAGG + Intronic
1101441446 12:104707004-104707026 GAGGTGGCCTTGGCAGGAGGTGG - Intronic
1103229684 12:119318758-119318780 TGGGTGGAGCTGGGTGGAGGTGG + Intergenic
1103368203 12:120398387-120398409 TAAGTGGCCATGGGGGCAGGAGG - Intergenic
1103551944 12:121744354-121744376 TCTGTGGCCCTGGGCGGTGGAGG + Intronic
1103703712 12:122860525-122860547 TAGGTTGCCCTGGGTGGGGGGGG + Intronic
1103884003 12:124187560-124187582 TAGGTGGGGGTGGGTGGAGGGGG + Intronic
1104781553 12:131423701-131423723 TGGGTGCCGCTGGGCTGAGGAGG + Intergenic
1108070893 13:46627600-46627622 TAGGTGGACCAGGGCTGAGAGGG - Intronic
1108209200 13:48121265-48121287 TGGGAGGCCCTGGGATGAGGTGG + Intergenic
1113798059 13:113070175-113070197 TGAGTGGCCCTGGGTGGAGCCGG + Intronic
1113927245 13:113948429-113948451 CAGGAGGCCCTGGGCTGAGGCGG + Intergenic
1114691057 14:24582059-24582081 TATGGGGCCCAGGGAGGAGGTGG - Intergenic
1117978544 14:61321173-61321195 CAAGAGGCCCTGGCCGGAGGCGG - Intronic
1121009651 14:90512504-90512526 GAGGTGGCCCTGGGGCAAGGAGG + Intergenic
1121181794 14:91934811-91934833 GAGGTGGGCCTGGGAGCAGGTGG - Intronic
1121302903 14:92886007-92886029 TTGGTGGCCGTGGGTGGAGAGGG + Intergenic
1121329925 14:93043556-93043578 TAGGTGGGGCTGGGCGGGGCAGG - Intronic
1122214189 14:100192649-100192671 TGGGGGGACATGGGCGGAGGGGG + Intergenic
1122290513 14:100678262-100678284 GAAGAGGCCCTGGGTGGAGGCGG - Intergenic
1122546310 14:102524631-102524653 CTGGTGGTCCGGGGCGGAGGCGG - Intergenic
1122785449 14:104161287-104161309 CAGGTGCCCCTGGGGTGAGGTGG + Intronic
1124861894 15:33449873-33449895 TGGGTGGGACTGGGAGGAGGGGG + Intronic
1128467420 15:67924601-67924623 TAGGAGGCCCAGGGTTGAGGAGG - Intergenic
1129274029 15:74433775-74433797 TAGGTGGCCCTGGGCGGAGGCGG + Exonic
1129751397 15:78067291-78067313 TAGGTGGCTCTGGGAGCTGGAGG - Intronic
1131107373 15:89744231-89744253 TATGTGACCCAGGGAGGAGGTGG - Intergenic
1132117936 15:99151236-99151258 TGGGTGGCCTGGGGTGGAGGTGG - Intronic
1132160729 15:99539212-99539234 TAGATGGCCCAGGGTGGGGGTGG + Intergenic
1132404322 15:101533249-101533271 TAGGTGGCCCTGAGAAGAGGTGG + Intergenic
1132498148 16:273548-273570 TTGGCTGCCCTGGGAGGAGGAGG + Exonic
1132600267 16:769978-770000 GAGAGGGCCCTGGGCAGAGGGGG + Intronic
1133041061 16:3059877-3059899 TGGGTGGCCTGGGGAGGAGGAGG - Exonic
1134135468 16:11673941-11673963 CAGAGGGCCCTGGGCAGAGGAGG - Intronic
1135582610 16:23641221-23641243 CAGTTGGCCCTGGGCCGGGGAGG + Exonic
1135588873 16:23691265-23691287 CAGGTGGGCCTGGGCGGTGGAGG - Intronic
1137456877 16:48624134-48624156 TGGGAGGCCTTGGGCGGGGGGGG + Intergenic
1138528013 16:57620056-57620078 CCTGTGGCCCTGGGAGGAGGTGG + Exonic
1139534431 16:67562727-67562749 AAGGGGGCCCGGGGTGGAGGAGG + Intronic
1139705636 16:68738426-68738448 CCGGTGTCCCTGGGCGGAGTAGG + Intronic
1142426252 16:90003673-90003695 AAGGTGGCCCGGGCCGGGGGAGG - Intergenic
1142426304 16:90003838-90003860 AAGGTGGCCCGGGCCGGGGGAGG - Intergenic
1142426322 16:90003893-90003915 AAGGTGGCCCGGGCCGGGGGAGG - Intergenic
1142426340 16:90003948-90003970 AAGGTGGCCCGGGCCGGGGGAGG - Intergenic
1142426375 16:90004058-90004080 AAGGTGGCCCGGGCCGGGGGAGG - Intergenic
1142848676 17:2694091-2694113 CAGGTGGGGCTGGGTGGAGGTGG - Intronic
1143550924 17:7630062-7630084 AAGGTTGCCCGGGGAGGAGGGGG - Intronic
1145780930 17:27562601-27562623 GAGGTGGTCCTAGGAGGAGGAGG - Intronic
1147324399 17:39663409-39663431 CAGGAGGCCCTGGGAGGAGGGGG - Exonic
1147517855 17:41139104-41139126 TCGGGGGCCATGGGTGGAGGAGG + Intergenic
1147705264 17:42421713-42421735 CAAGTGGCCCCGGGCGGAGCCGG + Intronic
1148074855 17:44929327-44929349 TAGGTGGCCCTGGACTCAGAAGG + Intronic
1149654761 17:58304466-58304488 CAGGTGGCCCTGCGCAGGGGTGG + Intronic
1149656416 17:58311714-58311736 CAGGTGGGCCTGGGGGCAGGGGG + Exonic
1149991194 17:61384558-61384580 TGGATGGCCCAGGGAGGAGGAGG - Intronic
1152321254 17:79609913-79609935 CTGGTGGCCCCGGGCGGTGGTGG - Intergenic
1152487015 17:80601117-80601139 GAGGAGGCCATGGGAGGAGGTGG + Intronic
1152799887 17:82325943-82325965 TTGGTGCCCATGGGAGGAGGTGG + Intronic
1152894200 17:82901343-82901365 TAGGTGCCTGTGGGTGGAGGTGG + Intronic
1152908503 17:82983740-82983762 CAGGGGCCCCGGGGCGGAGGAGG + Intronic
1156026146 18:32656715-32656737 TAGGTGTCCCTGAGGGGTGGGGG + Intergenic
1157203127 18:45676299-45676321 CAGGTGGCCCGGTGGGGAGGTGG + Intronic
1159902426 18:74060163-74060185 AAGGTGGCCCGGAGCTGAGGAGG - Intergenic
1160029874 18:75249393-75249415 TAGGTGGCGCAGGGTGCAGGCGG + Intronic
1160583409 18:79900225-79900247 GATGTGGCCTTGGGCAGAGGTGG - Intergenic
1160725672 19:616830-616852 TAGGTGGCCCCCGTCCGAGGAGG + Exonic
1160754624 19:751020-751042 CAGGTGGGGCTGGGGGGAGGGGG + Intergenic
1160884874 19:1341205-1341227 TGGGGGGCCCTGGACGGTGGTGG - Intergenic
1161003770 19:1924424-1924446 TCTGTGGCCCTGGCAGGAGGGGG - Exonic
1161027889 19:2045066-2045088 CAGGTGGCAGTGGGAGGAGGAGG - Intronic
1161153531 19:2721280-2721302 TAGGCGGCCCGGGGCGGGGAGGG - Intronic
1161195293 19:2983128-2983150 TAGCAGGGCCTGGGAGGAGGGGG + Intronic
1161615572 19:5268445-5268467 TGGGTGGCCGTGGACAGAGGTGG + Intronic
1161619285 19:5289875-5289897 TACGTGGCCCTGGGCAGGGAGGG + Intronic
1162329738 19:10020481-10020503 CAGGTGGAGCTGGGAGGAGGTGG + Intronic
1162954590 19:14091013-14091035 GAGTTGGCCCGGGGCGGGGGCGG + Intronic
1163717184 19:18879405-18879427 CAGGAGGCCGTGGGTGGAGGGGG + Intronic
1163727776 19:18932368-18932390 TGGGTGGCGCTGGGCTGAGGCGG + Intronic
1165243985 19:34487461-34487483 TGGGAGGCCCTGGGCAGAGCAGG + Intronic
1165406945 19:35636807-35636829 GAGGTGGCCCTGGGGTGGGGAGG + Intronic
1165421416 19:35723826-35723848 TGGGGGGCCCCGGGAGGAGGTGG + Exonic
1165421478 19:35724114-35724136 AAGGTGGCTGAGGGCGGAGGAGG + Intronic
1165782225 19:38441388-38441410 AAGGAGGCCCTCGGCGGGGGCGG + Intronic
1166144645 19:40825871-40825893 GAGGTGGGGCAGGGCGGAGGGGG - Intronic
1166387476 19:42390300-42390322 TAAGTGGCTCTGGGCTGAGACGG - Intergenic
1166553725 19:43684287-43684309 AAGGTGGCCCAGGGAGGAGCAGG + Intergenic
1166720291 19:44992539-44992561 CAGGTGGGCCTGGGTGGAGAGGG - Intronic
1167239198 19:48333404-48333426 CAGGTGGCTCCGGTCGGAGGTGG - Exonic
1167780072 19:51593328-51593350 TGGGCCGCCCTGGGCTGAGGGGG - Intergenic
1168326372 19:55540778-55540800 CAGGTGGCCCTGGGGGCTGGGGG + Exonic
1168685644 19:58347632-58347654 GAGGGGGTCCTGGGCGGAGCGGG + Exonic
925406881 2:3611674-3611696 TAGGTGGCCCTGCGGGGCTGGGG + Intronic
926823662 2:16880876-16880898 TAGGTATCCCTGGGCTGAAGAGG - Intergenic
927990202 2:27442292-27442314 GAGCGGGCCCGGGGCGGAGGCGG + Intergenic
928116517 2:28548933-28548955 TAGGAGGGACTGGGCAGAGGAGG + Intronic
928938737 2:36706500-36706522 TGTGTGGCCCTGGGAGGAGCAGG - Intronic
930071529 2:47369815-47369837 GAAATGGCCTTGGGCGGAGGCGG + Intronic
931455612 2:62407730-62407752 TAGGTGGAGCTGGGGGGCGGTGG - Intergenic
932459420 2:71872755-71872777 AAGGTGGCTCTGGGCTGAGTGGG - Intergenic
932739209 2:74279007-74279029 AAGGCGGCCCTGGGCACAGGTGG - Intronic
933972859 2:87484124-87484146 TCTGTGGCCCTGGGCTGATGTGG - Intergenic
935270438 2:101429843-101429865 AAGGAGGACCTGGGAGGAGGTGG + Intronic
937276415 2:120686911-120686933 GTGGAGGCCCTGGGAGGAGGGGG + Intergenic
937991388 2:127664282-127664304 TAGGTGGCCAGGGGCGGGGCGGG - Intronic
938036444 2:128038655-128038677 GAGGTGCCCCTAGGAGGAGGAGG + Intergenic
938062877 2:128266390-128266412 GAGGTGGCCCTGCGCGGCGCTGG + Exonic
942328170 2:174793411-174793433 TAGCTAGCCCTGGGAGGAGCAGG - Intergenic
946385358 2:219381224-219381246 TAGATGGCCTTGAGTGGAGGGGG - Intronic
947767906 2:232649206-232649228 TAGCTGGCCCTGGGTGGGGTTGG + Intronic
947812352 2:233012447-233012469 AAGGGGCCCCTGAGCGGAGGGGG + Intronic
948515784 2:238503235-238503257 TAGGGGACTCTGGGCTGAGGTGG + Intergenic
948730641 2:239961662-239961684 TAAGGGGCCCTTGGCGGAGTAGG + Intronic
948815294 2:240507398-240507420 TGGGTGGCCCTGGGTGGCAGGGG - Intronic
949035227 2:241813101-241813123 CCGGTGGCCCAGGGCAGAGGTGG + Intronic
1169196020 20:3682253-3682275 GGGGTGGAGCTGGGCGGAGGAGG + Intergenic
1172098900 20:32474055-32474077 TGGCAGGCCCTGCGCGGAGGCGG + Intronic
1172699764 20:36845841-36845863 TGGGGGGCCCTGGGAGGTGGGGG + Intronic
1172705271 20:36878123-36878145 TAGGTGCCCCTGGGCGTGGCTGG - Intronic
1173249040 20:41354908-41354930 AAGATGGCCCTGGGTGCAGGTGG + Intronic
1175402835 20:58710449-58710471 TCGGTGGCCCTGGGCTCTGGGGG + Intronic
1175715817 20:61253402-61253424 GGGGCGCCCCTGGGCGGAGGCGG + Intronic
1175728162 20:61333595-61333617 CAGGTGGCTCTGGGAGGAGAGGG - Intronic
1175912737 20:62412548-62412570 GAGGTGGCACTGGGGAGAGGTGG + Intronic
1179562114 21:42222084-42222106 TATGTGGCCCGGTGCGGGGGTGG + Intronic
1180246107 21:46548354-46548376 CAGGTGGCCCTGCGAGGGGGTGG - Intronic
1180972308 22:19821995-19822017 GAGCTGGCCATGGGCAGAGGTGG - Intronic
1180997729 22:19973783-19973805 TACGTGGCCCACTGCGGAGGCGG + Exonic
1181032283 22:20154406-20154428 GAGGTGGCCCTGGGGTGGGGTGG + Intergenic
1181511182 22:23389322-23389344 GAGGTGGCCCTGGGGTGGGGTGG - Intergenic
1182103076 22:27671038-27671060 TATGGGGCCCAGGGCGGAGCTGG - Intergenic
1182899380 22:33885302-33885324 TAGCTGACCCTCTGCGGAGGGGG + Intronic
1183369998 22:37427055-37427077 GTGGTGGCGGTGGGCGGAGGCGG - Intronic
1183427372 22:37746810-37746832 GAGGTGGGCCTGGGCTGGGGAGG + Intronic
1184555729 22:45232106-45232128 TAGGTGGACCTGGGGTGAGGTGG - Intronic
1184671463 22:46014093-46014115 AAGGTGGCCGCGGGTGGAGGTGG - Intergenic
1185081245 22:48710520-48710542 TGGGCGGCCCTGGACGGATGCGG - Intronic
953759287 3:45674214-45674236 TAGGTGGCCTTGGGAGGAGAAGG - Intronic
953891749 3:46756260-46756282 CAGGCTGCCCAGGGCGGAGGCGG + Exonic
955351782 3:58198917-58198939 TTGGTGGCCTTGGGTGGGGGTGG - Intronic
956539098 3:70314170-70314192 TTGGTTGCACTGGGGGGAGGAGG - Intergenic
959248084 3:103901598-103901620 TAGGTGGGCATGGGAGGTGGAGG - Intergenic
961135907 3:124511082-124511104 TAGGTGGCTCTGTGGGGATGAGG - Intronic
961384601 3:126516544-126516566 TAGTGGGCACTGGGGGGAGGGGG - Intronic
961479451 3:127170757-127170779 CAGGTGGGCTTGGGGGGAGGTGG + Intergenic
961571775 3:127804440-127804462 TAGGTGGCCATGGCAGGAGTGGG - Intronic
963455354 3:145539593-145539615 TAGGTGACCCTAGGCCTAGGTGG - Intergenic
968494923 4:910258-910280 TAGGTGTCCCTGTGCTGAGCTGG - Intronic
968691317 4:1991869-1991891 AAGGTGGCCCTGGGGTGAGGCGG - Intronic
968881063 4:3300454-3300476 ACGTTGGCCCTGGGAGGAGGAGG + Intronic
969417093 4:7067937-7067959 TTGGTCTCCCTGGGTGGAGGTGG - Intronic
969572407 4:8017176-8017198 TATGAGGGCCTGGGAGGAGGCGG - Intronic
969609419 4:8218725-8218747 TGGAAGGCCCTGGGCCGAGGTGG + Intronic
970544862 4:17117482-17117504 TAGGTGGGGCTGGGCGCAGTGGG + Intergenic
976080637 4:81351128-81351150 TACGTGGCCCTGGCAGAAGGAGG - Intergenic
979732773 4:124045055-124045077 TAGCTGCCCCTTGGCAGAGGGGG + Intergenic
981822503 4:148902034-148902056 AAGATGACCCTGGGCTGAGGAGG + Intergenic
982222891 4:153140098-153140120 TGGGTGGGCATGGGGGGAGGGGG - Intergenic
983789675 4:171781008-171781030 GAGGTTGCCCTGAGCCGAGGTGG + Intergenic
984619565 4:181937088-181937110 GAGGTGGCCCTGGGCAAAGCAGG + Intergenic
985488764 5:166686-166708 TCGGTGGCCCTGGGGGTTGGAGG + Intronic
985574297 5:666418-666440 GTGGTGGCCCCGGGAGGAGGAGG - Intronic
986030874 5:3891346-3891368 AAGCTGCCCCTGGGAGGAGGGGG + Intergenic
986451420 5:7869280-7869302 GAGGCGGCCCGGGGCGGGGGTGG + Intronic
989113359 5:37928498-37928520 TCGGTGGCACTGGGAGGTGGGGG - Intergenic
999257283 5:150216673-150216695 TTGGTGGCCCTGGGTGGAGAAGG + Intronic
1001125303 5:169013674-169013696 TAGGTGGCCCAGGGCAGCCGGGG + Intronic
1001547076 5:172576953-172576975 AAGGTGGGCTTGGGTGGAGGTGG + Intergenic
1001597405 5:172907044-172907066 TGGATGGGACTGGGCGGAGGAGG - Intronic
1001633924 5:173196450-173196472 GAGGTGGCCCTGGACAGGGGCGG - Intergenic
1003248000 6:4400505-4400527 TAGGTTGCCTGGGGAGGAGGAGG - Intergenic
1003638395 6:7855672-7855694 TAGCTGGGCATGGGCTGAGGTGG - Intronic
1003979111 6:11372848-11372870 TATGTGGCCATGGGCAGAGGAGG - Intronic
1004546449 6:16603100-16603122 TAGGAGGCCCTTAGCAGAGGTGG - Intronic
1006022476 6:31125558-31125580 TAGGAGCACCTGGGCTGAGGAGG - Intronic
1006829090 6:36958137-36958159 TGGGTGACCCTGAGGGGAGGTGG - Intronic
1007678583 6:43618569-43618591 TAGGTGGCGCTGGGTGAAGTGGG + Intronic
1014764718 6:125393191-125393213 TGGGTGGCCTTGGGTAGAGGTGG + Intergenic
1017103084 6:150865683-150865705 TAGGGGCCCCTGGGACGAGGAGG + Exonic
1018799240 6:167209984-167210006 AAGGGGGTCCTGGGTGGAGGAGG - Intergenic
1019591919 7:1839887-1839909 TAGGTGGTTATGGGGGGAGGCGG - Intronic
1019718795 7:2555531-2555553 CAGGTGGCACTGTCCGGAGGCGG - Exonic
1020109150 7:5438419-5438441 GAGGGGGACCTGGGCAGAGGTGG - Intronic
1020260167 7:6526560-6526582 AAGGAGGCCCTGCGCGGGGGCGG + Exonic
1020274724 7:6617085-6617107 TGGGTGGCCCGAGGCAGAGGTGG + Intronic
1022232077 7:28423843-28423865 GTGGTCGCCCTGGGAGGAGGGGG - Intronic
1022289547 7:28987870-28987892 TTGGTGGCTTTGGGCAGAGGGGG + Intergenic
1024024625 7:45400100-45400122 TGGGTGGCCATGGGCGGACCTGG - Intergenic
1024240216 7:47429005-47429027 TCTGTGGCCCTGGGTGAAGGTGG - Intronic
1027233142 7:76283260-76283282 TAGGGGGCCAGGGGAGGAGGGGG + Intronic
1028613118 7:92734401-92734423 TAGGTGGGCTTTGGCTGAGGGGG - Intronic
1029598233 7:101548937-101548959 GACGAGGCCCTGGGAGGAGGAGG + Intronic
1030143733 7:106331764-106331786 CAGGTTGCCCTGGGGGGAAGGGG + Intergenic
1033584740 7:142765821-142765843 TATGTGGCCCAGGTAGGAGGTGG - Intergenic
1034377560 7:150659423-150659445 GAGGTGGCTCTGGAAGGAGGAGG - Intergenic
1034911855 7:155003507-155003529 TTCTTGGCCCTGGGCGGAGTGGG + Intergenic
1034965337 7:155387317-155387339 TGGGTGGTGATGGGCGGAGGTGG - Intronic
1034972084 7:155425528-155425550 TTTGTGGCTCTGGGCTGAGGTGG - Intergenic
1035044780 7:155956434-155956456 TAGGTGCCCCTGGGGAGGGGAGG - Intergenic
1035266623 7:157693064-157693086 GAGGTGGCGCTGGGGGGCGGGGG + Intronic
1035944881 8:3951268-3951290 AAGGTGGGCCAGGGCTGAGGAGG - Intronic
1041211172 8:55552513-55552535 TAGGAGCCCCTGGGAGGAGAAGG - Intergenic
1041304720 8:56447062-56447084 GAGGGGGCCCAGGGAGGAGGCGG - Intergenic
1041364940 8:57092166-57092188 TAGCTGGCCCTGGGAGGACTCGG + Intergenic
1045509500 8:102803771-102803793 TAGGTGGGCCAGGGATGAGGGGG + Intergenic
1045547530 8:103141392-103141414 GAGGCGGCCCTGGGCGGATCAGG - Intronic
1048555275 8:135469815-135469837 TAGGTGGTCCTGGCCGGGCGCGG - Intronic
1048577489 8:135704659-135704681 TATCTGGCCCTGGGCTAAGGGGG - Intergenic
1048982125 8:139708226-139708248 AAGGTGGCCCTGGTGGCAGGTGG - Intergenic
1049607474 8:143536396-143536418 GAGGTGGCTCTTGGCGGTGGCGG + Exonic
1049697990 8:143993049-143993071 TTGGTGCCCCTTGGCGGGGGCGG - Exonic
1049710169 8:144059842-144059864 CAGGTGGGCCAGGGCGGAGCGGG - Exonic
1049724258 8:144138183-144138205 GCAGTGGCCCTGGGCCGAGGAGG + Exonic
1051837987 9:21362442-21362464 TAGATGTTCCTGGGTGGAGGTGG + Intergenic
1051845739 9:21449351-21449373 TAGATGTTCCTGGGTGGAGGTGG - Intergenic
1053152138 9:35749840-35749862 GAAGTGGCCGTGGGCGGAAGGGG - Exonic
1057123036 9:92594333-92594355 TAGGTGGCCCCGTGAGCAGGTGG + Intronic
1057750576 9:97789385-97789407 TGGCAGGCCCTGGGGGGAGGTGG + Intergenic
1059262655 9:112993563-112993585 TAGCTGCCCCTTGGCAGAGGAGG + Intergenic
1059884503 9:118730522-118730544 TACATGGCACTGGGCAGAGGAGG - Intergenic
1061370726 9:130195994-130196016 TTGGAGGCTCTGGGAGGAGGGGG + Intronic
1062008269 9:134252641-134252663 GGGGTGGCCCTGGCAGGAGGAGG + Intergenic
1187547613 X:20267949-20267971 AGGCTGGCCGTGGGCGGAGGAGG + Intergenic
1189007243 X:37009142-37009164 TGGGAGGCTCTGGGCGGAGATGG - Exonic
1189007369 X:37009754-37009776 TGGGAGGCTCTGGGCGGAGATGG - Exonic
1189007415 X:37009970-37009992 TGGGAGGCTCTGGGCGGAGATGG - Exonic
1189007436 X:37010078-37010100 TGGGAGGCTCTGGGCGGAGATGG - Exonic
1189007488 X:37010294-37010316 TGGGAGGCTCTGGGCGGAGATGG - Exonic
1189007561 X:37010618-37010640 TGGGAGGCTCTGGGCGGAGATGG - Exonic
1192369331 X:70500249-70500271 TAGGGGGCCCTGGACAGATGTGG + Intronic
1192464907 X:71347887-71347909 GAGGTGGCGATGGGGGGAGGGGG - Intergenic
1192591888 X:72367269-72367291 CATGTGGGCCTGGGCAGAGGAGG - Intronic
1196208739 X:112971098-112971120 TTGGTGGCCCTGGGCAGTGATGG + Intergenic
1197308198 X:124869835-124869857 TAGGGGGCTGTGGGGGGAGGTGG + Intronic
1197787399 X:130212608-130212630 TAGGTGGCGTTGGGGGGTGGGGG + Intronic
1199388025 X:147246025-147246047 GTGGTGGCCCTGTGGGGAGGTGG - Intergenic
1200219309 X:154383327-154383349 AAGGTGGACCTGTGAGGAGGTGG - Intergenic