ID: 1129275327

View in Genome Browser
Species Human (GRCh38)
Location 15:74441683-74441705
Sequence CTGGGTAAGCAGAAAGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129275314_1129275327 12 Left 1129275314 15:74441648-74441670 CCCAGGGCCAGAGGGGACCCCAC No data
Right 1129275327 15:74441683-74441705 CTGGGTAAGCAGAAAGAGGGAGG No data
1129275316_1129275327 5 Left 1129275316 15:74441655-74441677 CCAGAGGGGACCCCACCTGCTGG No data
Right 1129275327 15:74441683-74441705 CTGGGTAAGCAGAAAGAGGGAGG No data
1129275315_1129275327 11 Left 1129275315 15:74441649-74441671 CCAGGGCCAGAGGGGACCCCACC No data
Right 1129275327 15:74441683-74441705 CTGGGTAAGCAGAAAGAGGGAGG No data
1129275320_1129275327 -5 Left 1129275320 15:74441665-74441687 CCCCACCTGCTGGAGAGGCTGGG No data
Right 1129275327 15:74441683-74441705 CTGGGTAAGCAGAAAGAGGGAGG No data
1129275322_1129275327 -6 Left 1129275322 15:74441666-74441688 CCCACCTGCTGGAGAGGCTGGGT No data
Right 1129275327 15:74441683-74441705 CTGGGTAAGCAGAAAGAGGGAGG No data
1129275308_1129275327 23 Left 1129275308 15:74441637-74441659 CCTGAGCCCAGCCCAGGGCCAGA No data
Right 1129275327 15:74441683-74441705 CTGGGTAAGCAGAAAGAGGGAGG No data
1129275313_1129275327 16 Left 1129275313 15:74441644-74441666 CCAGCCCAGGGCCAGAGGGGACC No data
Right 1129275327 15:74441683-74441705 CTGGGTAAGCAGAAAGAGGGAGG No data
1129275323_1129275327 -7 Left 1129275323 15:74441667-74441689 CCACCTGCTGGAGAGGCTGGGTA No data
Right 1129275327 15:74441683-74441705 CTGGGTAAGCAGAAAGAGGGAGG No data
1129275312_1129275327 17 Left 1129275312 15:74441643-74441665 CCCAGCCCAGGGCCAGAGGGGAC No data
Right 1129275327 15:74441683-74441705 CTGGGTAAGCAGAAAGAGGGAGG No data
1129275324_1129275327 -10 Left 1129275324 15:74441670-74441692 CCTGCTGGAGAGGCTGGGTAAGC No data
Right 1129275327 15:74441683-74441705 CTGGGTAAGCAGAAAGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129275327 Original CRISPR CTGGGTAAGCAGAAAGAGGG AGG Intergenic
No off target data available for this crispr