ID: 1129278565

View in Genome Browser
Species Human (GRCh38)
Location 15:74464812-74464834
Sequence GGTATATTAAGACCACAATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129278560_1129278565 17 Left 1129278560 15:74464772-74464794 CCATTTCTTCAAGAAATTCATAT No data
Right 1129278565 15:74464812-74464834 GGTATATTAAGACCACAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129278565 Original CRISPR GGTATATTAAGACCACAATC TGG Intergenic
No off target data available for this crispr