ID: 1129281731

View in Genome Browser
Species Human (GRCh38)
Location 15:74490300-74490322
Sequence CAGGGTGAGCAGCCGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129281731_1129281735 -7 Left 1129281731 15:74490300-74490322 CCCTCTTCCGGCTGCTCACCCTG No data
Right 1129281735 15:74490316-74490338 CACCCTGCTGTAGCCACACCGGG No data
1129281731_1129281734 -8 Left 1129281731 15:74490300-74490322 CCCTCTTCCGGCTGCTCACCCTG No data
Right 1129281734 15:74490315-74490337 TCACCCTGCTGTAGCCACACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129281731 Original CRISPR CAGGGTGAGCAGCCGGAAGA GGG (reversed) Intergenic
No off target data available for this crispr