ID: 1129285742

View in Genome Browser
Species Human (GRCh38)
Location 15:74523094-74523116
Sequence AATCAGAGGGAGACAGTCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129285734_1129285742 9 Left 1129285734 15:74523062-74523084 CCTAGTTATATGGGCCTGCCTGC No data
Right 1129285742 15:74523094-74523116 AATCAGAGGGAGACAGTCTATGG No data
1129285737_1129285742 -9 Left 1129285737 15:74523080-74523102 CCTGCCAGTGGCCGAATCAGAGG No data
Right 1129285742 15:74523094-74523116 AATCAGAGGGAGACAGTCTATGG No data
1129285736_1129285742 -5 Left 1129285736 15:74523076-74523098 CCTGCCTGCCAGTGGCCGAATCA No data
Right 1129285742 15:74523094-74523116 AATCAGAGGGAGACAGTCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129285742 Original CRISPR AATCAGAGGGAGACAGTCTA TGG Intergenic
No off target data available for this crispr