ID: 1129286644

View in Genome Browser
Species Human (GRCh38)
Location 15:74530880-74530902
Sequence CTGGCTCAGCACAGCTCTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129286639_1129286644 13 Left 1129286639 15:74530844-74530866 CCTTCTCCTCTTAGTTTCACCAA No data
Right 1129286644 15:74530880-74530902 CTGGCTCAGCACAGCTCTATGGG No data
1129286642_1129286644 -6 Left 1129286642 15:74530863-74530885 CCAATACTTGACAGAGTCTGGCT No data
Right 1129286644 15:74530880-74530902 CTGGCTCAGCACAGCTCTATGGG No data
1129286640_1129286644 7 Left 1129286640 15:74530850-74530872 CCTCTTAGTTTCACCAATACTTG No data
Right 1129286644 15:74530880-74530902 CTGGCTCAGCACAGCTCTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129286644 Original CRISPR CTGGCTCAGCACAGCTCTAT GGG Intergenic
No off target data available for this crispr