ID: 1129287960

View in Genome Browser
Species Human (GRCh38)
Location 15:74541134-74541156
Sequence CGGGGCCACAGGGGGCGGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 793
Summary {0: 1, 1: 1, 2: 10, 3: 91, 4: 690}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129287960_1129287980 8 Left 1129287960 15:74541134-74541156 CCGCCCCGCCCCCTGTGGCCCCG 0: 1
1: 1
2: 10
3: 91
4: 690
Right 1129287980 15:74541165-74541187 CCGCCCCCGCCCCTGGCTGGCGG 0: 1
1: 0
2: 4
3: 68
4: 504
1129287960_1129287976 5 Left 1129287960 15:74541134-74541156 CCGCCCCGCCCCCTGTGGCCCCG 0: 1
1: 1
2: 10
3: 91
4: 690
Right 1129287976 15:74541162-74541184 CCCCCGCCCCCGCCCCTGGCTGG 0: 1
1: 2
2: 36
3: 203
4: 1393
1129287960_1129287973 1 Left 1129287960 15:74541134-74541156 CCGCCCCGCCCCCTGTGGCCCCG 0: 1
1: 1
2: 10
3: 91
4: 690
Right 1129287973 15:74541158-74541180 CCCGCCCCCGCCCCCGCCCCTGG 0: 15
1: 37
2: 150
3: 755
4: 3140
1129287960_1129287988 21 Left 1129287960 15:74541134-74541156 CCGCCCCGCCCCCTGTGGCCCCG 0: 1
1: 1
2: 10
3: 91
4: 690
Right 1129287988 15:74541178-74541200 TGGCTGGCGGTCCAGCCCCGCGG 0: 1
1: 0
2: 2
3: 25
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129287960 Original CRISPR CGGGGCCACAGGGGGCGGGG CGG (reversed) Intergenic
900100830 1:961275-961297 CGGGGCTGCAGGAGGCGGGCGGG - Exonic
900105374 1:978788-978810 GGGGGCCGCAGGGGCCGGGCAGG - Intronic
900108507 1:996298-996320 TGGGGCCACAGGATGCAGGGTGG + Intergenic
900108532 1:996364-996386 TGGGGCCACAGGATGCAGGGTGG + Intergenic
900108558 1:996430-996452 TGGGGCCACAGGATGCAGGGTGG + Intergenic
900108583 1:996496-996518 TGGGGCCACAGGATGCAGGGTGG + Intergenic
900108607 1:996562-996584 TGGGGCCACAGGATGCAGGGTGG + Intergenic
900108632 1:996628-996650 TGGGGCCACAGGATGCAGGGTGG + Intergenic
900108657 1:996694-996716 TGGGGCCACAGGATGCAGGGTGG + Intergenic
900108681 1:996759-996781 TGGGGCCACAGGATGCAGGGTGG + Intergenic
900108706 1:996825-996847 TGGGGCCACAGGATGCAGGGTGG + Intergenic
900109351 1:999083-999105 CGGGGCCGCAGGGCCCGGGTGGG - Exonic
900120089 1:1045173-1045195 GGGGGCCACAGGCGGCAGCGGGG - Exonic
900305351 1:2003980-2004002 CCAGGCCACAGGCCGCGGGGCGG + Intergenic
900315235 1:2052961-2052983 CAGGCCCACAGGGGGCGGGGTGG - Intronic
900353156 1:2246874-2246896 CCTGGCCACAGTGGGCGAGGTGG - Intronic
900372098 1:2336691-2336713 GGTGCCCACGGGGGGCGGGGAGG - Intronic
900428556 1:2591652-2591674 CGTGGCTACAGGTGGCGTGGTGG + Intronic
900612041 1:3548333-3548355 CGGGGCCAAAGGCCTCGGGGCGG + Intronic
900629334 1:3625298-3625320 CGGGGGCCGAGGGCGCGGGGCGG + Intronic
900631673 1:3639677-3639699 CGGGGACACAAGGTGCGGGGTGG + Intronic
901054061 1:6440510-6440532 CGGGGCCATCAGGGGTGGGGCGG + Intronic
901199166 1:7457039-7457061 CGGCGGCGCAGGGGGCGGGGCGG - Intronic
901417844 1:9129393-9129415 CGGGGGCACACGGGCGGGGGGGG - Intergenic
901659856 1:10792325-10792347 CGGGGCCGGGGGGGGGGGGGCGG - Intronic
901667770 1:10836127-10836149 AGGGGCCACTGGGAGCGGGGAGG - Intergenic
901775846 1:11560097-11560119 TGGTGCCACAGAGGGAGGGGAGG - Intergenic
901798152 1:11692153-11692175 CGGGACCCCAGAGGGCGGCGAGG - Intronic
901829486 1:11883423-11883445 CAGGGCCACATGGGGTGGGCTGG - Intergenic
902612191 1:17603763-17603785 CGTGGCCACCGGGGCCGGGCAGG + Intronic
902633350 1:17718975-17718997 TGGAGCCACAGGGAGAGGGGAGG + Intergenic
902867380 1:19288410-19288432 CGGGGCCAGGGAGAGCGGGGCGG + Intronic
903199163 1:21719190-21719212 CGGAGGGACGGGGGGCGGGGGGG + Intronic
903263328 1:22142812-22142834 CGGGGCCGAGCGGGGCGGGGCGG - Intronic
903499511 1:23793607-23793629 AGGGGCCACCAGGGGCGGCGCGG + Intronic
903499567 1:23793802-23793824 GGGAGCCACAGGGGGCTGGCTGG + Intronic
903952792 1:27005894-27005916 CTGGGCCTCACGGGGTGGGGTGG - Exonic
905433876 1:37943775-37943797 AGGTGCCACAGGGGGCTGGGTGG - Exonic
906147593 1:43569224-43569246 TGGGGCTGCAGGGGGTGGGGGGG - Intronic
906325583 1:44843371-44843393 CGGCGCCGCAGGGGGCGGGGCGG + Intergenic
907069313 1:51519376-51519398 CGGGGCCAGGCGGGGCGGGGCGG - Intergenic
907080434 1:51617019-51617041 CGGGGCCGCAGGGGGCGGGGCGG - Intronic
912376475 1:109213808-109213830 CGGGGCCGCGGAGGGAGGGGAGG - Intergenic
912955657 1:114153005-114153027 GCGGGGGACAGGGGGCGGGGTGG - Intronic
914343596 1:146779870-146779892 CAGTGCCACAGGGAGCAGGGAGG - Intergenic
914829228 1:151158543-151158565 AGGGGCCCCAGGGGGCGGAGAGG + Intronic
915145351 1:153793424-153793446 TGGGGCCACCAGGGGCCGGGAGG - Intergenic
915213340 1:154325584-154325606 CGGGGCCGCAGCTGGGGGGGCGG + Intronic
915246241 1:154558304-154558326 TGGGGCCGGAGGGGCCGGGGCGG - Exonic
915367429 1:155323858-155323880 CCGGGCGAGAGTGGGCGGGGCGG - Intronic
915560038 1:156681719-156681741 GGGGGCCACAGGGGTGGGGGTGG + Intergenic
915587794 1:156853687-156853709 CAGGGTCACATGGGGCTGGGTGG - Intronic
915701893 1:157804244-157804266 ATGGGCCACTGGGGGGGGGGTGG - Intronic
917437509 1:175036059-175036081 CTGGGCCACAGGCAGCTGGGAGG - Intergenic
917974424 1:180229993-180230015 CGGGGCGGCAGGGAGCGGGGCGG - Intergenic
917974430 1:180230008-180230030 CGGGGCGGAGGGGGGCGGGGCGG - Intergenic
919031778 1:192251786-192251808 TGAGCCCACAGGGGGAGGGGTGG - Intergenic
919519653 1:198572010-198572032 TTGAGCAACAGGGGGCGGGGGGG + Intergenic
919810375 1:201405519-201405541 CTGGGCAGCCGGGGGCGGGGGGG - Exonic
919919582 1:202160205-202160227 CAGGGTCACAGTGGGCGAGGTGG + Intronic
919925132 1:202188245-202188267 TGGGGCCACAGGGCATGGGGTGG + Intergenic
920215588 1:204359785-204359807 GGGGGCCCCAGGGGCGGGGGAGG - Exonic
921199545 1:212792004-212792026 CGGGACCAGAGGGAGCAGGGAGG + Intronic
923372435 1:233327592-233327614 CGGGGCGGCTGGGGGAGGGGCGG + Intergenic
923372475 1:233327673-233327695 TGGAGCCGGAGGGGGCGGGGCGG + Intergenic
923545342 1:234919372-234919394 CTGGGCCTCAGGGGGAGGGCAGG - Intergenic
924199026 1:241640422-241640444 CGGGGCCACGGGGGGTGCGCCGG - Intronic
924741204 1:246795111-246795133 CGTGGCCACGGGGAGTGGGGTGG + Intergenic
924940973 1:248812222-248812244 CGAGGGCCCAGGGGGTGGGGAGG + Exonic
1062974022 10:1670547-1670569 CGGGGCCACTGGGAGAGGGGTGG - Intronic
1063097051 10:2917589-2917611 CTGGGTGACAGGGGGTGGGGGGG + Intergenic
1063300608 10:4846001-4846023 TGGGGCCACAGGGGGCGGGCCGG - Intronic
1063960422 10:11301522-11301544 CGGGGGCAGCGGGAGCGGGGTGG - Intronic
1064133761 10:12732672-12732694 GGGAGGGACAGGGGGCGGGGGGG - Intronic
1064552874 10:16520797-16520819 GGGGGCCCCATGGGGCCGGGTGG + Exonic
1066192805 10:33071301-33071323 CCCAGCTACAGGGGGCGGGGTGG - Intergenic
1066351716 10:34642384-34642406 CAGGGCCAGATGGGGCTGGGTGG - Intronic
1067479399 10:46585258-46585280 AGGGGCCCCAGGGGGCCTGGGGG + Intronic
1067585562 10:47474257-47474279 CGGGGCCACAGGGGGTGTCCTGG - Intronic
1067615339 10:47756540-47756562 AGGGGCCCCAGGGGGCCTGGGGG - Intergenic
1067711829 10:48656256-48656278 CGGCGCCTCTGGGGGGGGGGGGG + Intronic
1067837046 10:49648006-49648028 AGGGGACACTGGGGGCGGGAGGG + Intronic
1070280322 10:75043737-75043759 CGGGGCGAGTCGGGGCGGGGCGG + Intronic
1070558150 10:77545949-77545971 CTGTGCCCCAGGGGGCTGGGGGG - Intronic
1071292044 10:84195288-84195310 CGAGCCCACCGGGGGCGGAGTGG + Intronic
1071573904 10:86712161-86712183 CCGGGCCACCGAGGCCGGGGAGG + Intronic
1071630741 10:87216491-87216513 AGGGGCCCCAGGGGGCCTGGGGG - Intergenic
1071695444 10:87864150-87864172 CCGGGCCACGGGGGGTGCGGCGG - Exonic
1072189080 10:93066111-93066133 CGGGGCCGCTGGGGGCAGCGAGG + Exonic
1072359752 10:94647867-94647889 CAGTGCCACTGGGGGCTGGGGGG + Intergenic
1072591524 10:96832435-96832457 TGGGGCGACCGGCGGCGGGGCGG - Intronic
1073045921 10:100638108-100638130 CCGGACCAAGGGGGGCGGGGAGG - Intergenic
1073076690 10:100828919-100828941 CGGGGCCGGGCGGGGCGGGGCGG - Exonic
1073196457 10:101695190-101695212 CCGGGTCACATGGGGCGGCGCGG + Exonic
1074169596 10:110919537-110919559 CGGGGCGAGTGGGGGAGGGGCGG + Exonic
1074700412 10:116087276-116087298 CGGAGGGACAGGGGGCGGTGTGG + Intronic
1075391789 10:122097545-122097567 AGTGGCCCCAGGGGACGGGGAGG + Intronic
1075778688 10:125003532-125003554 TGGGGCCACAGGGTGCGTGGAGG + Intronic
1076149908 10:128153498-128153520 AGGAGCCACAGGAGGTGGGGAGG - Intergenic
1076245487 10:128944663-128944685 ATGGGCCACAGGAGGTGGGGTGG - Intergenic
1076395717 10:130136349-130136371 CGGGGCCACGGGGAGCTGAGCGG - Intergenic
1076481137 10:130786009-130786031 GGGGGCCACAGGGGCTGGTGGGG - Intergenic
1076574276 10:131453591-131453613 AGAGGCCAGAGGGGCCGGGGAGG - Intergenic
1076632229 10:131858073-131858095 CAGGGCCACAGGGCAAGGGGCGG + Intergenic
1076676386 10:132149622-132149644 CGGGGGCGGAGGGGGTGGGGCGG - Intronic
1076683178 10:132185755-132185777 CCGGGCGGCAGGAGGCGGGGGGG + Intergenic
1076746411 10:132517031-132517053 CAGGGCCACAGTGGGGCGGGGGG + Intergenic
1076793354 10:132787767-132787789 CGGGGCCGGGGGGGGCGGGCAGG + Intergenic
1076880072 10:133235738-133235760 CCGGGCTGCAGGAGGCGGGGAGG + Intergenic
1076993907 11:289289-289311 TGGGGCGACCGGGGGCTGGGGGG - Intronic
1077002629 11:332049-332071 AGGGGTCACAGGGTGCTGGGTGG - Intergenic
1077008303 11:369350-369372 CGGGGCGAGGGGAGGCGGGGCGG - Intergenic
1077014135 11:392556-392578 GGGGGCCTCGGAGGGCGGGGTGG - Intergenic
1077050319 11:563490-563512 CGGTGCCCCAGGGGGAGGTGGGG - Intronic
1077063402 11:627269-627291 CGGGGCGACAGCTGGGGGGGCGG - Intergenic
1077065653 11:640008-640030 CGGGGCCGCAGGGGTCCTGGGGG - Exonic
1077065692 11:640104-640126 CGGGGCCGCAGGGGTCCTGGGGG - Exonic
1077079978 11:720928-720950 CGGGGTCGCAGGGGGCGGGGAGG + Intronic
1077181283 11:1218350-1218372 CTGGGGCACAGGGGGCTGAGGGG - Intergenic
1077184116 11:1228829-1228851 GGGGGCCACTGGGGGTGGGGAGG + Intronic
1077231722 11:1460782-1460804 CGGGTCCACTCGGGGCAGGGCGG - Exonic
1077249979 11:1556788-1556810 AGGGCGCACAGGGGGCGGGCGGG - Exonic
1077273694 11:1693669-1693691 CGGGGCCACTGGGGGCAAAGAGG - Intergenic
1077288518 11:1778216-1778238 CAGAGCCACAGGGAGCGGGAAGG + Intergenic
1077298740 11:1837753-1837775 CGGGACCACATGGGATGGGGCGG + Intergenic
1077963827 11:7105610-7105632 TGGGGCCTCAGGGGGAAGGGTGG - Intergenic
1078012089 11:7580258-7580280 CTGGGCTACAGGAGGTGGGGAGG - Intronic
1078514140 11:12008665-12008687 CGGGGCGGAACGGGGCGGGGCGG - Intronic
1078605978 11:12775999-12776021 CAGGGTCACAGTGGGCAGGGAGG + Intronic
1079169705 11:18081148-18081170 GGGGACCACAGGAGGAGGGGAGG - Intronic
1079489023 11:20966824-20966846 GGGGGCGGCAGGGGGTGGGGAGG - Intronic
1080258723 11:30322989-30323011 CGGGGACGGAAGGGGCGGGGCGG - Intergenic
1080588355 11:33700563-33700585 CGGGGCGCCAGTGGGCGGGGCGG - Exonic
1081636762 11:44726979-44727001 CGGGGCTCCAGGCTGCGGGGCGG + Intronic
1081864568 11:46352486-46352508 CTGGGCCTCAGGGGACGGGAGGG - Intronic
1083013656 11:59428321-59428343 TGGGGCCTCAGGGGGAAGGGTGG + Intergenic
1083267875 11:61555305-61555327 GGGGGCAGCAGGGGGCGAGGGGG - Intronic
1083353078 11:62044914-62044936 GGGGGTCACAGGGGGCAGGGTGG + Intergenic
1083648528 11:64186610-64186632 GCGGGCCGCAGGGGGCGGGGTGG + Intronic
1083709449 11:64539130-64539152 CGGAGCCAGAGGGGGGCGGGGGG + Intergenic
1083758403 11:64803204-64803226 CGGGGCGGCGCGGGGCGGGGCGG + Exonic
1083788968 11:64971746-64971768 AGGGACCTCAGGGGGCAGGGGGG + Intronic
1083798916 11:65035126-65035148 GGGGTCATCAGGGGGCGGGGTGG - Exonic
1083823337 11:65184476-65184498 CAGGACAACGGGGGGCGGGGCGG - Intronic
1083879455 11:65540827-65540849 CGGGGTGAGAGGGCGCGGGGCGG + Intronic
1083887230 11:65578900-65578922 TGGGGCCACAGGGTGCAGGGTGG - Intronic
1084005271 11:66319315-66319337 AGGAGCCCCAGGGGGCGGTGTGG - Intergenic
1084149816 11:67282838-67282860 CAGGGCCGCAGGGGGCTGGGGGG + Intronic
1084172402 11:67406816-67406838 CGTGGCCACAGGAGGCTGTGCGG + Exonic
1084180501 11:67443404-67443426 CGGGGGCACCGGGGGCGCAGGGG + Exonic
1084484072 11:69437937-69437959 AGGGGCCAACGGGGGTGGGGAGG + Intergenic
1084758254 11:71252389-71252411 CGGGGACGCAGGGCGCGGGCCGG - Intronic
1084888128 11:72223837-72223859 CGGGGCGGCGCGGGGCGGGGCGG + Intronic
1085031343 11:73272676-73272698 CGGGGTCAGTGGGGGCGGGGAGG + Intronic
1085747728 11:79129275-79129297 GGTGGCCAGAGGTGGCGGGGTGG + Intronic
1089368233 11:117934131-117934153 CAGGGCAACAGGGGGCAGAGTGG + Intergenic
1090333651 11:125948928-125948950 TGGGGCCACAGTGGGAGGAGAGG + Intergenic
1090385539 11:126355865-126355887 CGGGGGCCCGCGGGGCGGGGCGG + Intronic
1091124552 11:133082913-133082935 GGGGGCGCCAGGGGCCGGGGCGG + Intronic
1091270899 11:134311181-134311203 CCTGGCCACAGGAGGCGGAGTGG + Intronic
1091553262 12:1552875-1552897 AGGGTCCACAGGGGGCCGGAGGG - Intronic
1091888096 12:4031317-4031339 CCGGGCCGCCGGGCGCGGGGAGG - Intergenic
1092329441 12:7569288-7569310 CCGGGCCACAGGTGACGGTGGGG + Intergenic
1092461982 12:8695197-8695219 CGGGGCCGGGCGGGGCGGGGCGG - Intronic
1092487442 12:8914666-8914688 CGGGGGCGCCGAGGGCGGGGTGG - Exonic
1096153411 12:49328952-49328974 CTGGGCCACAGGGGCAGGGGAGG - Exonic
1096191634 12:49623634-49623656 CCGGGCCGCAGGGGGCGCTGTGG - Intronic
1096680447 12:53252191-53252213 CGGAGCCACAGCGGGGAGGGTGG + Intronic
1096946730 12:55414975-55414997 CGGGGGCGCCGAGGGCGGGGTGG + Intergenic
1100444650 12:94650000-94650022 CGGGGCCGCGGGTGGCCGGGTGG + Intronic
1101173810 12:102128169-102128191 TGGGGACACAGTGGGTGGGGTGG - Intronic
1101340820 12:103840908-103840930 AGGGGCCCCAGGCGCCGGGGCGG + Intronic
1101652119 12:106686861-106686883 CTGGGCCACAAGGGGAGGGAGGG - Intronic
1102025770 12:109713762-109713784 CTGGGCCGCGGGGGGCGGGCGGG + Intergenic
1102084348 12:110124184-110124206 CGGGGCGGGACGGGGCGGGGCGG - Intergenic
1103014002 12:117480164-117480186 CTGGGCCACTGGGGGTGGGGTGG + Intronic
1103562510 12:121800065-121800087 CCGGGCCGCTGGGGGAGGGGCGG - Intronic
1103604927 12:122079275-122079297 CGGGGCCTCAGGGGGTCGCGGGG - Intronic
1103699678 12:122842605-122842627 CTGGGCCACAGGGTGCCGCGGGG + Intronic
1103865546 12:124049240-124049262 CTGGGCCTCAGGAGGTGGGGTGG - Intronic
1103906861 12:124332266-124332288 TGGGGCCACAGGTGGGCGGGTGG - Intronic
1103953985 12:124566761-124566783 TGGGGCCACGGGGCGCTGGGCGG - Intronic
1104755302 12:131265411-131265433 CGGAGCCAGCGGGGGCGGTGGGG + Intergenic
1104819489 12:131666658-131666680 CGGGGCTGCAGGGGCCGGGAAGG + Intergenic
1104882941 12:132084702-132084724 AGGGGTCGCAGGGGGAGGGGTGG - Intronic
1104957994 12:132475261-132475283 CGGGGAGAGAGGGGGCGGGGGGG - Intergenic
1108408121 13:50124685-50124707 CGGTTCCACAGGGCGCGGGGAGG - Intronic
1108573252 13:51770284-51770306 TGTGGCCACAGGGGCCTGGGAGG - Intronic
1109124887 13:58505511-58505533 GGAGCCCACTGGGGGCGGGGTGG + Intergenic
1111856169 13:93640681-93640703 AGGGGAAACAGGGAGCGGGGAGG - Intronic
1112467751 13:99658598-99658620 CTCGGCCACAGGCAGCGGGGCGG + Intronic
1112505477 13:99972078-99972100 CGCGGGCAGAGGGCGCGGGGTGG + Intergenic
1113082712 13:106535140-106535162 GGGGCCCTCAGGGCGCGGGGCGG + Intergenic
1113517555 13:110915065-110915087 CGCGCACAGAGGGGGCGGGGCGG + Exonic
1113778838 13:112964093-112964115 CAGGGTTGCAGGGGGCGGGGGGG + Intronic
1113799290 13:113078158-113078180 TGGGGCCACAGGTGGTGGCGTGG - Intronic
1113841585 13:113364217-113364239 AGGGGCGGCTGGGGGCGGGGAGG + Intergenic
1113929001 13:113956688-113956710 TGGGGGCACAGGAGGCGGGACGG - Intergenic
1114836214 14:26205322-26205344 CGTGTCCACAGGGAGCTGGGAGG + Intergenic
1116817850 14:49599757-49599779 CGCGGCGACCGGGGCCGGGGCGG + Intronic
1117156902 14:52950878-52950900 CGGGACCCGAGGGGGCGCGGCGG - Intronic
1117157033 14:52951257-52951279 CGGGGCGGCGTGGGGCGGGGCGG + Intronic
1117545941 14:56794874-56794896 TGGGGGCACCGGGCGCGGGGAGG + Intergenic
1119410289 14:74426105-74426127 CGGGACCGCGCGGGGCGGGGCGG - Intergenic
1119438286 14:74611934-74611956 CGCGGCCTCATGGCGCGGGGCGG + Exonic
1121547048 14:94770149-94770171 AGCGGACGCAGGGGGCGGGGAGG - Exonic
1121562780 14:94887142-94887164 CAGAGCCCCAGGGAGCGGGGTGG - Intergenic
1122005111 14:98697016-98697038 TGGGGCCACAGGTGGGGGTGGGG + Intergenic
1122066180 14:99175690-99175712 CGGGGACACGGGCGGCGGCGTGG + Exonic
1122108692 14:99480569-99480591 CGGGGCCACAGCGGCCGGCGGGG + Intronic
1122243372 14:100383772-100383794 CGGTGCCACTGGGGACGTGGGGG + Intronic
1122897715 14:104768776-104768798 AGGGGCTGCAGGGGGCGGGAGGG - Intergenic
1123204035 14:106694773-106694795 TGGAGCCACCGGGGGGGGGGGGG - Intergenic
1125536318 15:40442400-40442422 CGGGGGCCGAGGGGCCGGGGTGG + Intronic
1128153513 15:65377733-65377755 CGGGGCCAGAGCGGGGCGGGCGG + Exonic
1128593649 15:68925364-68925386 CGGGGCGGGACGGGGCGGGGAGG + Intronic
1129263560 15:74382214-74382236 CGAGGCCAGAAGGGGCTGGGAGG + Intergenic
1129287960 15:74541134-74541156 CGGGGCCACAGGGGGCGGGGCGG - Intergenic
1129518413 15:76170849-76170871 AGGGGCCACCCGGGGTGGGGTGG + Intronic
1129643520 15:77408377-77408399 TGGGGACACAGGGGGAAGGGTGG + Intronic
1129741415 15:77991422-77991444 GCTGGCCACAGGGAGCGGGGTGG + Intronic
1129844248 15:78760985-78761007 GCTGGCCACAGGGAGCGGGGTGG - Intronic
1129854040 15:78811544-78811566 CGGGGCCGGCCGGGGCGGGGCGG - Intronic
1130526945 15:84715810-84715832 AGGGCCTACCGGGGGCGGGGCGG - Intronic
1130656535 15:85795090-85795112 GGGGGGGACCGGGGGCGGGGCGG + Intergenic
1131144348 15:90001683-90001705 CGGGGGCGCGGGGGGCGCGGGGG + Intronic
1131912647 15:97224574-97224596 CGGGGCCGCAGAGCACGGGGTGG - Intergenic
1132178461 15:99733541-99733563 CGGGACCACAGGGCCCGGGGCGG + Intronic
1132313876 15:100877264-100877286 AGGGACCACAGGGGCCGGGAAGG - Intergenic
1132480642 16:164835-164857 CGGGGCCCGGCGGGGCGGGGCGG + Intronic
1132498781 16:275747-275769 CGGGGGCGCGCGGGGCGGGGCGG - Intronic
1132541005 16:509751-509773 AGGGGCCACAAGTGGGGGGGGGG - Intronic
1132547045 16:538103-538125 CGGGGCCACGGGAGTCGTGGCGG - Intronic
1132569357 16:637290-637312 AGGGGCGGCAGAGGGCGGGGCGG + Intronic
1132583429 16:695352-695374 CGGGGCTGCACGGGGCGGGGCGG - Intronic
1132603242 16:783136-783158 CAGGGCCCCAGTGGGTGGGGAGG - Intronic
1132683462 16:1153040-1153062 CGGGGCCAGCGTGGCCGGGGCGG - Intergenic
1132758909 16:1499592-1499614 AGGGGCCTGAGGGGGTGGGGTGG + Intronic
1132767353 16:1541264-1541286 CGGGGCCCCAGGAGGTGAGGGGG + Intronic
1132833492 16:1941231-1941253 AGAGGCCACAGGGGTGGGGGAGG - Intronic
1132875707 16:2135948-2135970 CGGGGCGAGGGGGGGCGGGGCGG + Intergenic
1133015611 16:2938136-2938158 TGGGGCCACAGGGGCCTGGGTGG - Intronic
1133026885 16:2992441-2992463 CGGGGCCGAAGGGGCTGGGGTGG + Intergenic
1133171120 16:3983071-3983093 CTGGGGCACAGGGCTCGGGGAGG + Intronic
1133197862 16:4183875-4183897 CGTGGGCGCTGGGGGCGGGGCGG - Intergenic
1133293393 16:4737426-4737448 CAGGGTCACAGGGGATGGGGAGG + Intronic
1133550243 16:6847457-6847479 GGGAGCCACAGGGGGTGGGCTGG + Intronic
1133771933 16:8871751-8871773 CGGGGACACTGGGGTGGGGGTGG + Intergenic
1134519279 16:14911405-14911427 CGGGGCGAGGGGGGGCGGGGCGG - Intronic
1134706949 16:16310060-16310082 CGGGGCGAGGGGGGGCGGGGCGG - Intergenic
1134960591 16:18402064-18402086 CGGGGCGAGGGGGGGCGGGGCGG + Intergenic
1135321813 16:21502369-21502391 TGGGGCCGTGGGGGGCGGGGCGG - Intergenic
1136333297 16:29595491-29595513 TGGGGCCGTGGGGGGCGGGGCGG - Intergenic
1136460634 16:30407972-30407994 CAGGGCCACGGTGGGCGGGGGGG + Intronic
1136683714 16:31982209-31982231 GGCGGCCACAGAGGGCGGGCGGG + Intergenic
1136784343 16:32925765-32925787 GGCGGCCACAGAGGGCGGGCGGG + Intergenic
1136885442 16:33928041-33928063 GGCGGCCACAGAGGGCGGGCGGG - Intergenic
1137710860 16:50565980-50566002 CGGGGGCACAGGGCAAGGGGTGG - Intronic
1137825785 16:51493690-51493712 CAGGGCCACAGGGAGCAGGTGGG + Intergenic
1138210331 16:55157812-55157834 GGGGGCTGCAGGAGGCGGGGTGG - Intergenic
1138317986 16:56086807-56086829 CAGGGCCACAGGGGCAGGTGGGG + Intergenic
1138631217 16:58295552-58295574 CGGAGCCACAGGGGGAGGGTGGG + Intronic
1138651354 16:58463363-58463385 CGCGGCCACAGGGGGCCTGGAGG + Intronic
1139390552 16:66604618-66604640 CGGGGTCCGAGGGGGAGGGGCGG + Intronic
1139451153 16:67029080-67029102 TGGGGCCGGCGGGGGCGGGGTGG + Intergenic
1139545226 16:67646846-67646868 TGGGGCCACAAGGGGCAGGGAGG - Intronic
1139664932 16:68448618-68448640 CGGGGCCGGAGGGAGAGGGGAGG - Exonic
1139841256 16:69882636-69882658 CTGGGCCGCAGGGGTCGGGAGGG + Intronic
1139990395 16:70935464-70935486 CAGTGCCACAGGGAGCAGGGAGG + Intronic
1140686140 16:77435194-77435216 AGGGGGCGAAGGGGGCGGGGAGG + Intergenic
1140715486 16:77722417-77722439 GGCGGAGACAGGGGGCGGGGCGG - Intergenic
1141378627 16:83555015-83555037 CGGGGCCAGAGGTGGAGGGTAGG + Intronic
1141607559 16:85163444-85163466 GTGGGGCACAGTGGGCGGGGTGG - Intergenic
1141616835 16:85214672-85214694 CGGGGCCACAGAGGCCAGAGAGG - Intergenic
1141618257 16:85222148-85222170 CAGAGCCACAGGGAGCGGGGAGG - Intergenic
1141983161 16:87562257-87562279 TGCTCCCACAGGGGGCGGGGGGG - Intergenic
1142090405 16:88206861-88206883 CGGGGACGGAGGGGGAGGGGAGG + Intergenic
1142090418 16:88206887-88206909 CGGGGACGGAGGGGGAGGGGAGG + Intergenic
1142090490 16:88207037-88207059 CGGGGACGGAGGGGGAGGGGAGG + Intergenic
1142090515 16:88207088-88207110 CGGGGACGGAGGGGGAGGGGAGG + Intergenic
1142145330 16:88490671-88490693 CGGGGCCACAGAGAGAGGGGTGG + Intronic
1142200657 16:88759761-88759783 CGGGGCGTCTGGGGGCGGGCTGG - Intronic
1203087000 16_KI270728v1_random:1189771-1189793 GGCGGCCACAGAGGGCGGGCGGG + Intergenic
1142752679 17:1998128-1998150 CGGCGGCGGAGGGGGCGGGGAGG + Intronic
1143099840 17:4499013-4499035 CGGGGCGGCGGGGGGCGCGGGGG - Exonic
1143108520 17:4541212-4541234 CGGGGTGAGAGGGGGTGGGGTGG - Intronic
1143452121 17:7042545-7042567 GGGCGCCACAGGGGGTGAGGTGG + Exonic
1143621137 17:8080804-8080826 CTGGGATCCAGGGGGCGGGGAGG + Exonic
1144020979 17:11240411-11240433 CGGGCGCTCAGGGTGCGGGGCGG - Intergenic
1144340312 17:14304262-14304284 AGGGGGCACAGGGCCCGGGGCGG + Intronic
1144781685 17:17811590-17811612 AGGGGGCACAGGGGCGGGGGAGG - Intronic
1145019097 17:19416043-19416065 GGGGGCCACAGGGGCCGCTGTGG + Exonic
1145799132 17:27672154-27672176 TGTGGCCACAGGGTGAGGGGAGG - Intergenic
1145901631 17:28493943-28493965 CAGGGCCACAGGGTGGAGGGTGG - Intronic
1145941212 17:28744272-28744294 AGGGGACAGCGGGGGCGGGGCGG + Intronic
1146255915 17:31391598-31391620 AGGGGCAATAGGGGGCGGGGAGG - Intergenic
1146703327 17:34980827-34980849 CGGGGCCGCGTGAGGCGGGGAGG + Intronic
1147189454 17:38730286-38730308 CGGGGACCGAGGGGGCGGGGAGG + Exonic
1147602547 17:41755220-41755242 CAGGGCCACAGGGGCGGGGAGGG + Exonic
1147789404 17:43004049-43004071 GGGAACCAGAGGGGGCGGGGTGG + Intergenic
1148139346 17:45317168-45317190 CGGGGCCACGGGTCGCGGTGCGG - Intergenic
1148323644 17:46771493-46771515 CGGGGGCGGCGGGGGCGGGGCGG + Intronic
1148332908 17:46822570-46822592 CGGGCCCGCAGGGAGCGGAGTGG - Intronic
1148474290 17:47916832-47916854 CACAGCCACAGGGGGCTGGGAGG - Exonic
1148830199 17:50426181-50426203 CGGGCGCGCAGCGGGCGGGGAGG - Exonic
1148842510 17:50508243-50508265 CTAGGCCACGGGGGGCGGGTGGG - Intergenic
1149563758 17:57627670-57627692 GGTGGACACAGGGAGCGGGGAGG - Intronic
1149662033 17:58339079-58339101 CGGGGTCTCAGGAGGAGGGGTGG - Intergenic
1150268018 17:63843112-63843134 CTGGGCCAAAGGTGGGGGGGTGG - Intergenic
1150428949 17:65100643-65100665 CAGGGCCCCGGGGGGCGGAGGGG - Intergenic
1150489043 17:65561774-65561796 CGGGGCCGCGGGGGGCTGGCAGG - Intronic
1151289840 17:73141718-73141740 TGGGGCACTAGGGGGCGGGGTGG + Intergenic
1151356095 17:73559582-73559604 GGGGGGCACAGGGAGCGGAGTGG - Intronic
1151438576 17:74113790-74113812 CGCGGCCACAGTGGGCGCCGAGG + Intergenic
1151537108 17:74745219-74745241 CTGGGCCACTGGGAGAGGGGAGG + Intronic
1151577472 17:74959972-74959994 CGGGGCCACGGGTTGTGGGGAGG - Intronic
1151705566 17:75765238-75765260 CGGGGCGTCCGGGCGCGGGGCGG - Exonic
1151880966 17:76894147-76894169 CGGGGGAACAGGGAGCCGGGTGG - Intronic
1151954399 17:77373290-77373312 CGGGGGCGCAGCGCGCGGGGAGG + Intronic
1152162618 17:78678330-78678352 CGATGCCACAGGGGGAGGGGCGG + Intronic
1152357242 17:79813276-79813298 CGGGGCGAGCGGGGGAGGGGCGG - Intergenic
1152396549 17:80036577-80036599 GGGGGCCGCCGGGGGCGGCGCGG - Intergenic
1152608270 17:81303687-81303709 CGGAGCCACCTGGGGAGGGGAGG - Intergenic
1152632784 17:81418025-81418047 TGGAGCCACAGGTGGTGGGGAGG + Intronic
1152677924 17:81651200-81651222 CAGGGCCACAGGGGATGGGGGGG - Intronic
1152714476 17:81891867-81891889 CGAGGGCGCAGGGGGTGGGGCGG + Intronic
1153226933 18:2906795-2906817 CGGGGCCTCTGCGGGCGGCGGGG - Exonic
1153515027 18:5894933-5894955 CGGGGACCCGAGGGGCGGGGAGG + Intronic
1153636558 18:7117878-7117900 CGGGGCGGGACGGGGCGGGGCGG - Intergenic
1153970906 18:10226169-10226191 TGGGGGGGCAGGGGGCGGGGGGG - Intergenic
1154274482 18:12947750-12947772 CGGGGCTTGAGGGGGCGGGAGGG + Intronic
1157095105 18:44680212-44680234 CGGGGCCCCCGGGCGCGCGGAGG - Intronic
1157383927 18:47247057-47247079 CTGGGCCAGAGGGGGCGGCGGGG + Intronic
1157580162 18:48769447-48769469 ATGGCCCACAGGGGGCAGGGCGG - Intronic
1158961477 18:62591290-62591312 CGGGGAGACAGGGGAGGGGGAGG - Intergenic
1159586595 18:70288831-70288853 GGGGGCCGCGCGGGGCGGGGCGG - Intergenic
1159670133 18:71212498-71212520 AGGGGCGGCGGGGGGCGGGGCGG + Intergenic
1159670162 18:71212547-71212569 CGGGGCGGCGGGGGGCGGGGCGG + Intergenic
1159670174 18:71212567-71212589 CGGGGCGGCGGGGGGCGGGGCGG + Intergenic
1159875967 18:73811523-73811545 CGAGACCACTGGGGGCTGGGAGG + Intergenic
1160288879 18:77572198-77572220 CCTGGCCACAGGAGGCTGGGTGG + Intergenic
1160567811 18:79798068-79798090 CGGGGCCGCAGTGGGCGGTGGGG + Intergenic
1160683286 19:422335-422357 GGGGGCCACAGGGGCCCGGCGGG + Exonic
1160720275 19:594206-594228 CGGTGACACCGGGGGCAGGGAGG - Intronic
1160740001 19:681187-681209 GGGGCTCACGGGGGGCGGGGGGG + Intronic
1160787372 19:907347-907369 CGGGGCCTCAGGGGGGGCTGTGG - Intronic
1160802135 19:975023-975045 CGGGGCCACCTGAGGCAGGGAGG - Exonic
1160904466 19:1445934-1445956 GGGGGCCCGAGGCGGCGGGGAGG - Intergenic
1160909777 19:1469152-1469174 CCGGGCCCCAGGGGCCGGGCGGG + Exonic
1160927700 19:1555027-1555049 CGCGGCCGGAGGGGGCAGGGGGG - Exonic
1161006700 19:1940847-1940869 CATGGCAACAGCGGGCGGGGAGG + Intergenic
1161057788 19:2199423-2199445 GGAGGCCACAGGGCGCTGGGGGG - Intronic
1161152284 19:2716237-2716259 CTGGGGCACAGGTGGTGGGGAGG + Exonic
1161183434 19:2900658-2900680 TCGGGCGACAGGAGGCGGGGCGG + Intergenic
1161203379 19:3028411-3028433 CCGGCCCACATGGGGCGGGTGGG - Intronic
1161220258 19:3115080-3115102 CCGGGCCACAGCAGGCGGGGAGG + Intronic
1161270714 19:3387929-3387951 GGCTGCCAGAGGGGGCGGGGAGG - Intronic
1161412430 19:4123914-4123936 GGGGCCCATAGGGGGCGGGCCGG + Exonic
1161428224 19:4216228-4216250 CTGGGCCACAGGGGGACAGGAGG - Intronic
1161502326 19:4623186-4623208 CGGGGACACTGGGGGCGGGGTGG + Intergenic
1161543722 19:4867523-4867545 AGGGGCCGGAGGGGTCGGGGAGG - Intronic
1161800715 19:6415619-6415641 TGGGGCCGCAGGGGCCGGTGCGG + Exonic
1161827333 19:6577082-6577104 CGGGGTCACAAGGTGCGGTGGGG - Intergenic
1161851370 19:6739634-6739656 CGGGGCCGGGCGGGGCGGGGCGG + Intronic
1161983537 19:7642565-7642587 CAGGCCCACAGTGGGCGGTGGGG - Intronic
1162079030 19:8208219-8208241 CAGGGGCGCGGGGGGCGGGGCGG - Intronic
1162105384 19:8366871-8366893 GGGGGCCGGCGGGGGCGGGGAGG - Intronic
1162372929 19:10289865-10289887 CGGCGGCAGAGGCGGCGGGGGGG - Intergenic
1162381714 19:10335319-10335341 GGGGGCCACGAGGCGCGGGGGGG + Exonic
1162421047 19:10566204-10566226 CCGGAGCACAGGGGGTGGGGCGG - Intergenic
1162573143 19:11483887-11483909 CGGGGTCAGAGTGGGCGGGGCGG + Intronic
1162915830 19:13873895-13873917 TGGGGGCACCCGGGGCGGGGGGG + Intronic
1163021419 19:14482807-14482829 CGGGGCCGCAGGGCTGGGGGAGG + Exonic
1163116439 19:15191714-15191736 TGCGGCCAGAGGGAGCGGGGAGG - Intronic
1163135495 19:15308141-15308163 CGGGGCCGGGGGGGGGGGGGGGG + Intronic
1163161032 19:15464265-15464287 CTGGCACACAGGGGGCGGTGGGG - Exonic
1163262698 19:16200672-16200694 CGTGGCCACACTGGGCTGGGAGG + Intronic
1163421429 19:17215674-17215696 CGGGGCCAGTGGGGGAGGGGCGG - Intronic
1163462814 19:17448841-17448863 TAGGGCGGCAGGGGGCGGGGTGG - Intronic
1163633811 19:18429455-18429477 GCGGGTCGCAGGGGGCGGGGGGG + Intronic
1163642280 19:18468665-18468687 CAGGACCACAGGGGGCAGTGGGG - Intronic
1163686636 19:18715618-18715640 CGGGGCCACAGGTGGCTGAGGGG - Intronic
1163830924 19:19546852-19546874 CGGGGCTACAGCAGGCAGGGAGG + Intergenic
1164574169 19:29396101-29396123 CAGGGGCACAGGGGGTGGGGAGG - Intergenic
1164643848 19:29844492-29844514 CGGGGAGACGCGGGGCGGGGCGG - Intergenic
1165242907 19:34481852-34481874 CGGGACCCCTGGGCGCGGGGCGG - Exonic
1165349677 19:35269054-35269076 CGGGGCCCGGGGGGGAGGGGAGG - Exonic
1165781128 19:38434828-38434850 CAGGGCCCCGGGGGGAGGGGCGG - Intronic
1165809934 19:38606114-38606136 CAGGGCCACTGGGGGCCAGGAGG - Intronic
1165832176 19:38735677-38735699 CGGGGGTTCTGGGGGCGGGGCGG + Intronic
1165832187 19:38735697-38735719 CGGGGGTTCTGGGGGCGGGGCGG + Intronic
1165832198 19:38735717-38735739 CGGGGGTTCTGGGGGCGGGGCGG + Intronic
1165832209 19:38735737-38735759 CGGGGGTTCTGGGGGCGGGGCGG + Intronic
1165832220 19:38735757-38735779 CGGGGGTTCTGGGGGCGGGGCGG + Intronic
1165832234 19:38735782-38735804 CGGGGGTTCTGGGGGCGGGGCGG + Intronic
1165832248 19:38735807-38735829 CGGGGGTTCTGGGGGCGGGGCGG + Intronic
1165832259 19:38735827-38735849 CGGGGGTTCTGGGGGCGGGGCGG + Intronic
1165832295 19:38735897-38735919 CGGGGGTTCTGGGGGCGGGGCGG + Intronic
1165832312 19:38735927-38735949 CGGGGGTTCTGGGGGCGGGGCGG + Intronic
1165832326 19:38735952-38735974 CGGGGGTTCTGGGGGCGGGGCGG + Intronic
1165939861 19:39409702-39409724 CGGGGCCGCGGGAGGCGGGAGGG + Intergenic
1166104029 19:40588936-40588958 CAGGGCCAGAGAGGGCTGGGGGG - Intronic
1166117827 19:40666867-40666889 TGGGGGCCCAGGAGGCGGGGAGG - Exonic
1166231420 19:41427445-41427467 GAGGGCCCCAGGGGCCGGGGCGG + Exonic
1166316764 19:41993892-41993914 TGGGGCCGCAGGGGGCGGCGGGG - Intronic
1166373164 19:42313569-42313591 AGGGGCGGCAGGGGGCGAGGCGG - Intronic
1166677483 19:44748631-44748653 CGGGGGGGCCGGGGGCGGGGAGG + Exonic
1166678677 19:44754559-44754581 GCGGGCCGCAGGGGGTGGGGCGG - Intronic
1166749667 19:45158896-45158918 CGCTGCCGCAGGGGGCTGGGAGG + Exonic
1166810000 19:45508886-45508908 CGGGGCCAGTGTGGGCAGGGGGG + Intronic
1166894516 19:46015495-46015517 CGGAGCCTAAGGGGGCGGGGCGG + Intronic
1167216871 19:48170791-48170813 AGGTGCCGCAGCGGGCGGGGAGG + Intronic
1167300049 19:48672896-48672918 CGGGGCCTCAGGGCTCGGGTTGG - Intronic
1167437461 19:49487664-49487686 CGGGGCGGCAAGGGGCCGGGTGG + Intronic
1167638712 19:50668774-50668796 CGGGGCCCCCGGGGTCGGGCTGG + Exonic
1167641874 19:50686842-50686864 GGGAGCCCCCGGGGGCGGGGCGG + Intronic
1167647588 19:50714031-50714053 CGGGGCCAGAGGCTGTGGGGTGG - Intronic
1168272639 19:55258489-55258511 CGGAGCCGCCGGCGGCGGGGCGG - Exonic
1168386256 19:55965808-55965830 CGGGGCCTCTGGGGGGGTGGGGG - Intronic
1168573337 19:57488268-57488290 GGGGGCCACAGTGGCCGCGGAGG + Intronic
1168574754 19:57500398-57500420 GGGGGCCACAGTGGCCGCGGAGG + Intronic
1168694559 19:58397039-58397061 CGTGGCCACGGGGCGCGAGGAGG + Exonic
924985010 2:263444-263466 CGGGGCCACAGGGCGAGCGCGGG - Intronic
925317832 2:2939031-2939053 GTGGGACACAGGGGACGGGGAGG - Intergenic
926089887 2:10043218-10043240 CGGGGGCGGAGGGGGCGGCGGGG - Intronic
926089897 2:10043236-10043258 CGGGGGCGGAGGGGGCGGCGGGG - Intronic
926268124 2:11344490-11344512 CGGGGCCCCAGAGGGCGGGGCGG - Exonic
926337475 2:11875191-11875213 TAGGGGCACAGGGGGCGGAGGGG - Intergenic
926914369 2:17878592-17878614 CGGGGCCGGACGGGACGGGGCGG - Intronic
927698306 2:25252150-25252172 CGGGGAGACCGGGGGCGGGGAGG - Intronic
927743695 2:25595880-25595902 CGGGGGAACTGGGGGTGGGGGGG - Intronic
927917694 2:26947419-26947441 CGGGGCCTAAGGGGTGGGGGAGG - Exonic
929547058 2:42862706-42862728 AGGGGCCACTGAGGGCAGGGGGG + Intergenic
929602060 2:43210619-43210641 CGGGGCCTCAGGTGGCGGGAAGG + Intergenic
929746634 2:44666410-44666432 GGGGGCCAAAGGGCTCGGGGGGG - Intronic
929775711 2:44929475-44929497 GGGGGCCGCAGGGGGCTGGAAGG + Intergenic
929961481 2:46499832-46499854 CGGGGAGCCAGGGGTCGGGGTGG - Intronic
929966835 2:46542813-46542835 CGCGGCGACCGGGGCCGGGGCGG + Exonic
930124428 2:47784173-47784195 CGGGGCCTAATTGGGCGGGGCGG + Intronic
930136365 2:47906549-47906571 CGGGGCGGCGGGGGGAGGGGTGG + Intergenic
930358074 2:50346227-50346249 CCTGGCCCCGGGGGGCGGGGAGG - Intronic
931052315 2:58428520-58428542 CGGGGCCGCCGGGGGCGGGGAGG - Intergenic
931253762 2:60553820-60553842 CGCGGCCCCCGGGGGAGGGGCGG + Intergenic
931711052 2:64989291-64989313 CAGCGCCACAGGGGGCGGGACGG + Intronic
931739367 2:65228058-65228080 CGGGGCGAAGGGGCGCGGGGCGG + Intronic
932493227 2:72134301-72134323 CAGGGGCCTAGGGGGCGGGGGGG + Intronic
932623920 2:73283830-73283852 AGGGGCCAGAGGGAGGGGGGAGG - Intronic
933876117 2:86623356-86623378 CGGGGCCCGAGGGGCCGTGGGGG + Exonic
934067089 2:88350552-88350574 GGCGGCCACCGGGGGAGGGGAGG - Intergenic
934260971 2:91477360-91477382 CGAGGCGGCGGGGGGCGGGGGGG - Intergenic
934562591 2:95320879-95320901 TGGGGCCGAGGGGGGCGGGGAGG - Intronic
934712899 2:96527411-96527433 CGGGGCCCGAGGGGCCGGCGAGG + Intergenic
934883667 2:98005980-98006002 AGGGGCCTCAGGAGGCAGGGAGG - Intergenic
935645322 2:105329650-105329672 CGGGGCCCCAGGCCGCGGGGCGG - Exonic
936172677 2:110190316-110190338 GGAGCCCACAGAGGGCGGGGAGG + Intronic
937224134 2:120358495-120358517 CGGGGGAGCAGGGGGCGGTGTGG - Intergenic
937363089 2:121242553-121242575 CAGGGCCCCAGGGCGCAGGGAGG + Intronic
938266949 2:129934490-129934512 CGGGGACTCGGGGGGGGGGGCGG - Intergenic
938455591 2:131460762-131460784 CGCGGCGACCGGGGCCGGGGCGG + Intergenic
939822714 2:146977127-146977149 GGAGGCCAAAGGGGGCGGGGGGG - Intergenic
940774941 2:157875875-157875897 CGGGGCGGCGCGGGGCGGGGCGG + Intergenic
940779678 2:157919296-157919318 CGGGGGCACAGGGAGGTGGGGGG + Intronic
941476154 2:165953810-165953832 CCGGGCCCCAGCGGGAGGGGCGG + Exonic
942068634 2:172295513-172295535 CAGGGACTCAGGGTGCGGGGAGG - Intergenic
942314209 2:174682959-174682981 CGCGTCCACATGTGGCGGGGCGG - Intergenic
947748501 2:232521433-232521455 CTGGGGCACGGGGGGCAGGGTGG - Intronic
947873908 2:233455703-233455725 CGAGGCCACAGGGGGCCACGTGG - Intronic
948074722 2:235156861-235156883 CCTGGCCACAGGGGGAGGAGAGG - Intergenic
948446768 2:238039306-238039328 GGGGGCCACAGAGGGCCGGGTGG + Intronic
948473837 2:238203761-238203783 CGGGGCGGCTGGGGGCGGGGCGG + Intergenic
948610610 2:239163991-239164013 CGGGGCCACAGAGGGAGGGAAGG + Intronic
948707946 2:239806868-239806890 CGGGGGCACATGGGGCAGAGTGG + Intergenic
948824204 2:240566549-240566571 CGGGGCCTCCTCGGGCGGGGCGG + Intronic
948853882 2:240721203-240721225 AGGGGCCACAGGGGCTGGAGGGG - Intronic
948865291 2:240771940-240771962 CGGGACCACACGGGGTGTGGGGG + Intronic
948914956 2:241029891-241029913 TGGGGCCGCAGGAGGCGAGGCGG - Intronic
1168965088 20:1894251-1894273 CGGGGGCGCGGGGGGCGGGGGGG - Exonic
1169244596 20:4015582-4015604 CGGGCCCGCCGGGGGAGGGGCGG + Intronic
1171388537 20:24786477-24786499 TGGGGCCTCGGGGGACGGGGAGG - Intergenic
1171452824 20:25248003-25248025 CGGGGCCTCGGGGGGCGGGGCGG - Intergenic
1172064190 20:32207684-32207706 CGGGGCCTGAGGGGGCCTGGCGG - Exonic
1172387489 20:34544490-34544512 CGGGCCCACAGTGGAAGGGGCGG - Intergenic
1172497492 20:35398741-35398763 CAGGGCCAAAGGTGGGGGGGGGG + Intronic
1172944092 20:38674558-38674580 CCGGGGCTCTGGGGGCGGGGTGG - Intergenic
1173279961 20:41618726-41618748 CGCGGGCCGAGGGGGCGGGGCGG + Intergenic
1173657693 20:44711739-44711761 CAGGGCCATACGGGGCAGGGAGG - Intergenic
1173873801 20:46357386-46357408 CGGGGCCGCAGGTGCAGGGGGGG + Intronic
1173930177 20:46811461-46811483 GGGGGAGACAGGGGGCGGCGCGG - Intergenic
1174186218 20:48708211-48708233 CTGGGCCGCAGGGGGCCAGGAGG - Intronic
1174194483 20:48763410-48763432 CGGGGCCCCAGGATGCAGGGCGG + Intronic
1174294978 20:49539536-49539558 GGGGGCCCCAGTGGGTGGGGGGG - Intronic
1174398258 20:50261125-50261147 CCAGGCCACAGAGGGCGTGGAGG - Intergenic
1174452906 20:50630796-50630818 TGGGGACACAGGGGCCGTGGGGG - Exonic
1175210443 20:57350865-57350887 CGGGGGGACGGGGGGCGGGGGGG + Intergenic
1175562279 20:59940340-59940362 CGGCGTCACGAGGGGCGGGGCGG - Intronic
1175749217 20:61483678-61483700 TGGGGGCAGCGGGGGCGGGGCGG - Intronic
1175856361 20:62122858-62122880 CGGGGCGCCCCGGGGCGGGGAGG - Intronic
1175870806 20:62208546-62208568 CGGGGACACTGGGGGTGGGACGG - Intergenic
1175909156 20:62396439-62396461 CGGGGCCAGAGGGTCCTGGGAGG - Intronic
1175944035 20:62550519-62550541 CGGAGACACAGGGGCGGGGGAGG - Exonic
1176002771 20:62840405-62840427 AGAGGCCACAGCGGGTGGGGAGG - Intronic
1176092534 20:63325513-63325535 GGGGGCCACAGGGGTTGGTGGGG + Intronic
1176161703 20:63652010-63652032 CGGGGATACTGGGGGTGGGGGGG - Intronic
1176178621 20:63739741-63739763 CGGGACGAGACGGGGCGGGGCGG + Intronic
1176223177 20:63979555-63979577 CGGGGCCGGCTGGGGCGGGGCGG - Exonic
1176235946 20:64053604-64053626 GAGGGCCACAGGGGGCTGGTGGG + Intronic
1176365128 21:6028121-6028143 CGAGGCCACAGGGGGAAGGCAGG - Intergenic
1178610226 21:34073454-34073476 CGGGCGGAGAGGGGGCGGGGCGG + Intronic
1179471754 21:41614895-41614917 CGGGGCCACAGTGGGGGAGTGGG + Intergenic
1179758390 21:43510424-43510446 CGAGGCCACAGGGGGAAGGCAGG + Intergenic
1179805147 21:43832640-43832662 TGGGGGCACAGGGTGAGGGGAGG - Intergenic
1179933820 21:44590437-44590459 CGAGGCCGCATGGGGCAGGGGGG + Intronic
1179935560 21:44601686-44601708 TGGGGCCACAGCAGGCCGGGCGG - Exonic
1179967953 21:44817813-44817835 CGGGGCTCTAGAGGGCGGGGAGG + Intronic
1180177690 21:46098350-46098372 CGGAGCCACAGGGGCAGGCGCGG - Intronic
1180259884 21:46661951-46661973 CGCGGGCACGGGGTGCGGGGTGG + Intronic
1180749043 22:18111634-18111656 CAGGGGCACTGGGGGCGGAGAGG - Intronic
1181014742 22:20062428-20062450 AGGGGCCCCAGGGGGAGGAGTGG - Intronic
1181064160 22:20297845-20297867 AGGGGCCACAGGAGGAGGGATGG + Intergenic
1181064567 22:20299399-20299421 CGGGGCCTCAGGGGTGGGGTTGG + Intergenic
1181107746 22:20584862-20584884 CGGTGGCACCGGGGGCGGTGGGG - Exonic
1181273438 22:21674029-21674051 AGGGCCCACGGAGGGCGGGGAGG + Intronic
1181485781 22:23230920-23230942 CGGGGCCACAGGTGGAGTAGAGG + Intronic
1181622070 22:24098083-24098105 CTGGGCCAGAGGAGGAGGGGAGG - Exonic
1181645980 22:24232105-24232127 CGTGGCCACAGAGGGCGTGGAGG - Exonic
1182123788 22:27802093-27802115 CGGGTGGGCAGGGGGCGGGGAGG + Intergenic
1182354988 22:29718917-29718939 TTGGGCCAAAGGGGGCAGGGAGG + Intergenic
1182386674 22:29949147-29949169 CAGGGCCTCGGGGGGGGGGGGGG - Intronic
1182661341 22:31927370-31927392 CTGGGCAACTGGTGGCGGGGAGG - Intergenic
1183106299 22:35617527-35617549 TCAGGCCACAGGGGGTGGGGTGG + Intronic
1183228151 22:36564291-36564313 CGCGGTCCCCGGGGGCGGGGCGG - Exonic
1183318537 22:37149785-37149807 CTGGTCCACAGGGGCCGGGAGGG + Intronic
1183369181 22:37422935-37422957 CTGGGCCTCGGGGGGGGGGGGGG + Intronic
1183546145 22:38455610-38455632 CGGGGCCGCAGGAGGCAGGGAGG - Intergenic
1184119017 22:42438403-42438425 GGGGGGCAGAAGGGGCGGGGAGG - Intergenic
1184189545 22:42885717-42885739 CAGGGCCCTAGAGGGCGGGGTGG - Intronic
1184472119 22:44702113-44702135 CGGGGGCATCGCGGGCGGGGCGG - Intronic
1184472138 22:44702145-44702167 CGGCGCCCCGGGGGGCGGGGCGG - Intronic
1185074758 22:48677282-48677304 CGGGAGCACAGCGGGCGGGCAGG - Intronic
1185142363 22:49109632-49109654 CGGGGCTACAGGGGTGGGGAAGG - Intergenic
1185375697 22:50481819-50481841 CGGGGCTGCAGGGGAGGGGGCGG - Exonic
1185401515 22:50620614-50620636 AGGGGCCACAGGGAGGGGAGGGG + Intergenic
950158597 3:10742456-10742478 CTGGGCCACAGGGGGACTGGGGG + Intergenic
950334178 3:12180614-12180636 AGGGGCTACGGGAGGCGGGGAGG - Intronic
950464596 3:13145789-13145811 CTGGGCGCCCGGGGGCGGGGGGG + Intergenic
950534493 3:13571250-13571272 GGTGGCCACAGGGGGCTGGATGG + Exonic
950581205 3:13863245-13863267 CTGGGCCACAGGTGGAGGGAGGG - Intronic
951521215 3:23612280-23612302 CGAGGCAAAAGGGGGCGGGAGGG + Intergenic
952354247 3:32570297-32570319 CCGGGCCGCTGGGGGCCGGGCGG + Intronic
952883432 3:37999065-37999087 CGGGGCTGACGGGGGCGGGGCGG + Intronic
952952925 3:38538960-38538982 AGGTGCCACAGGGAGCGAGGAGG - Intronic
952955833 3:38556625-38556647 GGGGGTCACATGGGGAGGGGTGG + Intronic
953411637 3:42693563-42693585 CTGGGTCATAGAGGGCGGGGGGG - Intronic
954150412 3:48654511-48654533 GGGGGCCACAGGAAGCAGGGGGG + Intronic
954733533 3:52685753-52685775 CGGGGCTGCAGGCGGCGGAGCGG - Exonic
955770356 3:62378754-62378776 CGGGGGCGTAGGGGGAGGGGCGG + Intergenic
956209879 3:66791716-66791738 CGGGACCAAAGGTGGGGGGGAGG + Intergenic
956669152 3:71670413-71670435 TGGGGCCACGGGGGTTGGGGGGG - Intergenic
956882934 3:73529437-73529459 CAGAGCCATAGGGGGAGGGGTGG - Intronic
960972559 3:123150242-123150264 CGTGGGCTCTGGGGGCGGGGGGG - Exonic
961612625 3:128152995-128153017 GGGGGCGAAGGGGGGCGGGGGGG - Intronic
962804295 3:138915892-138915914 CGGGGTCACAGGAGGAGGCGAGG + Intergenic
963091399 3:141486931-141486953 CGGGGCCGCGGCGGGCGGGGCGG + Intergenic
966183100 3:177204379-177204401 CGTGGCCAGAGTGGGCGCGGAGG + Intergenic
966824855 3:183954908-183954930 TGGGGCAACATGGGGCAGGGAGG + Intronic
966849488 3:184155810-184155832 CGGGGCTCCCGGAGGCGGGGCGG - Intronic
966911224 3:184561582-184561604 CGGGGTCTCAGGGGCCGGAGTGG - Intronic
967093782 3:186159839-186159861 TGAGGTCACAAGGGGCGGGGGGG + Intronic
968452371 4:681598-681620 CGGCGCTGGAGGGGGCGGGGCGG - Intronic
968452380 4:681618-681640 CGGCGCTGGAGGGGGCGGGGCGG - Intronic
968452389 4:681638-681660 CGGCGCTGGAGGGGGCGGGGCGG - Intronic
968452398 4:681658-681680 CGGCGCTGGAGGGGGCGGGGCGG - Intronic
968452407 4:681678-681700 CGGCGCTGGAGGGGGCGGGGCGG - Intronic
968452416 4:681698-681720 CGGCGCTGGAGGGGGCGGGGCGG - Intronic
968452425 4:681718-681740 CGGCGCTGGAGGGGGCGGGGCGG - Intronic
968452434 4:681738-681760 CGGCGCTGGAGGGGGCGGGGCGG - Intronic
968583508 4:1405619-1405641 CGGGCACAGTGGGGGCGGGGAGG + Intronic
968584657 4:1410612-1410634 CGTGGCCTCCGGGGGCGAGGTGG - Intergenic
968585014 4:1412313-1412335 CGGGGGCACGGGGGCGGGGGGGG - Intergenic
968615845 4:1577411-1577433 CGTGGCCACAGGGTGCGGGGTGG + Intergenic
968636631 4:1684337-1684359 GGCGGCCGGAGGGGGCGGGGCGG - Intergenic
968697585 4:2040702-2040724 CGGGGCCCGAGGGGCCGGGTGGG - Intronic
968977039 4:3827484-3827506 CGGGGCCAAGGGGTGGGGGGCGG + Intergenic
969346772 4:6575152-6575174 CGGGTCCGCGAGGGGCGGGGCGG - Intergenic
969611904 4:8232192-8232214 AGGGGGCAAAGGGGGCGGCGGGG + Intronic
969716827 4:8871867-8871889 CGGCCTCACTGGGGGCGGGGAGG + Intergenic
971257988 4:25031065-25031087 CGGGGCGAGAGGGGGTGGCGAGG - Intergenic
972783520 4:42306477-42306499 TGGGGTCACCGGGAGCGGGGAGG + Intergenic
973551220 4:52038083-52038105 CGGGGCCGATCGGGGCGGGGCGG - Intronic
974271511 4:59656445-59656467 TGAGGCCATAGGGGGAGGGGTGG + Intergenic
974460106 4:62176155-62176177 GGGGGCCTGAGGGGGTGGGGAGG + Intergenic
976199023 4:82561565-82561587 CGGGGCCGCAGCGGGCGGGCTGG + Intronic
976219110 4:82741838-82741860 AGGGGTCAGAGTGGGCGGGGGGG + Intronic
976431299 4:84966169-84966191 CGGGAGCGCGGGGGGCGGGGAGG + Intronic
976475265 4:85475634-85475656 GGGGGCTGCGGGGGGCGGGGAGG + Intronic
976475277 4:85475655-85475677 GGGGGCTGCGGGGGGCGGGGAGG + Intronic
976475289 4:85475676-85475698 GGGGGCTGCGGGGGGCGGGGAGG + Intronic
976475301 4:85475697-85475719 GGGGGCTGCGGGGGGCGGGGAGG + Intronic
976475313 4:85475718-85475740 GGGGGCTGCGGGGGGCGGGGAGG + Intronic
976629347 4:87220609-87220631 CGCGGCCTCTGGGGGCGGGGCGG + Intronic
977693923 4:99946761-99946783 GGGGCCCGCGGGGGGCGGGGAGG - Intergenic
977719018 4:100217149-100217171 TGGCGGCACTGGGGGCGGGGAGG - Intergenic
980660886 4:135855996-135856018 CGGTGGCAGTGGGGGCGGGGAGG - Intergenic
981033673 4:140151002-140151024 CGGGGGCATGGGGGGCGCGGCGG + Intronic
984146345 4:176065940-176065962 CAGGGCGCCCGGGGGCGGGGCGG - Intronic
985005970 4:185535568-185535590 CGGGGTGGGAGGGGGCGGGGAGG - Intronic
985627590 5:997872-997894 TGGGGCAACAGGGGCAGGGGTGG + Intergenic
985714261 5:1446583-1446605 CGGGGGAGCGGGGGGCGGGGAGG - Intergenic
985781112 5:1872342-1872364 CCAGGCCACGGGGGGCGGGGGGG - Intergenic
985788920 5:1915118-1915140 CGGGGACTCAGGGGGAGGTGAGG - Intergenic
986442295 5:7793026-7793048 CAGGGCCACAGGGGAAGTGGAGG - Intronic
986466940 5:8035041-8035063 CGGGGCCAGAGAGGGCGGGAGGG + Intergenic
988369294 5:30346030-30346052 GGAGCCCACGGGGGGCGGGGGGG - Intergenic
991967491 5:72107417-72107439 GGGGGACGCAGGGGGCGGAGCGG + Exonic
993095646 5:83474696-83474718 CGAGGCCAATGGGGGCGGGGCGG + Intronic
994748994 5:103715345-103715367 CGGGGGCTGAGGGGGTGGGGGGG + Intergenic
996405438 5:123098828-123098850 CGGGGACAGGTGGGGCGGGGTGG - Intronic
996747168 5:126855010-126855032 CGCGGCCAGAGTGGGCGCGGAGG + Intergenic
997335673 5:133107428-133107450 CAGGGGCACAGGGGGCCTGGGGG + Intergenic
997419244 5:133752751-133752773 AGGGGTCATAGGGGGCAGGGGGG + Intergenic
997584094 5:135034447-135034469 CGAGGCCGCGGGGGGCGGGGAGG - Intronic
997745392 5:136295552-136295574 CTGGGCCACAGTGGACGGGGAGG - Intronic
998394872 5:141811957-141811979 CGGGGGCTAAGGGGGTGGGGGGG + Intergenic
999436683 5:151568722-151568744 CGGAGCCACAGTGGGCAGTGAGG - Exonic
999453180 5:151693855-151693877 TGGGGCCAGTGGGGGCAGGGAGG - Intergenic
1001523964 5:172415426-172415448 CGGGGCCCAAGGAGGCAGGGAGG + Intronic
1001808892 5:174611861-174611883 GGGGGCCGAAGGGGTCGGGGAGG + Intergenic
1001910555 5:175513932-175513954 CTGGGGCACAGTGGGAGGGGTGG + Intronic
1002061604 5:176629016-176629038 AGGCGCCACAAGGGGAGGGGTGG + Intronic
1002098901 5:176847820-176847842 GGGGGACACGGGGGGAGGGGAGG - Intronic
1002140241 5:177133538-177133560 CGGGCGCGCAGGGGGAGGGGAGG + Intronic
1002640629 5:180629063-180629085 CGGGGCTGCAGGGGCCGTGGGGG - Intronic
1003139272 6:3457133-3457155 CGGGGGGAGAGGGGGCGGGCCGG - Intergenic
1003197270 6:3926071-3926093 GGGGGCCACGGGAGTCGGGGAGG + Intergenic
1003445257 6:6178029-6178051 GGAGGCCACAGGGAGAGGGGGGG + Intronic
1004160810 6:13211273-13211295 TGGGGACTCAGGGGGAGGGGTGG - Intronic
1005989587 6:30894640-30894662 TGGGGACACAGGGAGCGGAGTGG - Exonic
1006183669 6:32168551-32168573 CAGGGCTGCAGGGGGCTGGGTGG + Exonic
1006470118 6:34224015-34224037 CGGGGCCACGGCGGGCAGAGGGG - Intergenic
1006637168 6:35469046-35469068 CGGGGGCACTGAGGGCTGGGTGG - Intronic
1006725541 6:36196921-36196943 CGGGGCCCCTGGGCGCGGGCGGG - Exonic
1007308191 6:40923528-40923550 CTGGCCTACAGGAGGCGGGGCGG - Intergenic
1007585105 6:42984639-42984661 CGGGGCCGCAGGAGACGGGCCGG + Exonic
1007775736 6:44223497-44223519 CGGGGCCGCGGGCGTCGGGGAGG + Intronic
1007800508 6:44388150-44388172 CGGGGCCGGGGGGGGCGGGGGGG - Intronic
1010142153 6:72623248-72623270 CCGCGCTGCAGGGGGCGGGGAGG + Intronic
1011712070 6:90065246-90065268 GGGGGCGGCAGGGGGTGGGGTGG - Intronic
1012912710 6:105136529-105136551 CGGCCCTACAGGGGGCGAGGAGG + Intronic
1013369099 6:109455048-109455070 CGGGCGCACAGGGGGCGGGGCGG - Intronic
1013793516 6:113859796-113859818 CGCGGCCGCCGGGAGCGGGGCGG + Exonic
1014045216 6:116877162-116877184 CGGGGCCGCAGGGGCGGGGAAGG - Intergenic
1015328404 6:131950638-131950660 CTGGGCTGCAGGGGGCGGGCTGG + Intronic
1015503145 6:133953490-133953512 CGGGGCGTCTGGGCGCGGGGTGG + Intronic
1016658087 6:146543784-146543806 CGCGGCCGCCGGGGGCGCGGCGG + Exonic
1018074585 6:160200643-160200665 AGGGGCAACAGGAGGTGGGGTGG - Intronic
1018091212 6:160348208-160348230 CCGGGCCACAGGTCGCGGGAGGG - Intergenic
1018156663 6:160991744-160991766 CGGGGCTACGGTGGGCGGCGAGG - Intronic
1019402940 7:866716-866738 CGGTGGGACGGGGGGCGGGGGGG - Intronic
1019409888 7:901787-901809 CGGGGCCAAATGGGACGGGGCGG - Intronic
1019562358 7:1665244-1665266 CGGGGCACTTGGGGGCGGGGAGG - Intergenic
1019711344 7:2519546-2519568 AGGGGCTACCCGGGGCGGGGGGG + Intronic
1019771527 7:2886506-2886528 CCGGGTCACATGGGGCGGGAGGG + Intergenic
1019989550 7:4682244-4682266 CGGCGGCGCGGGGGGCGGGGAGG - Intergenic
1020013078 7:4816852-4816874 CAGGGCCACAGGGGGACCGGCGG + Intronic
1020023671 7:4883732-4883754 CGGGGCCACAAAGGGTGGGGCGG + Intergenic
1020094709 7:5361862-5361884 AGGGGCCCCACGGGGCGGGCGGG + Intronic
1020495939 7:8853500-8853522 CTGGGCGACAGGGGCGGGGGGGG - Intergenic
1022396248 7:29989876-29989898 CGGGGCCCCGGGGGCCGGGGTGG - Intronic
1023810404 7:43906746-43906768 CGGGGACAGCTGGGGCGGGGTGG + Exonic
1023937206 7:44748681-44748703 CAGGGCCGCAGGTGGCTGGGCGG - Intronic
1023945164 7:44797044-44797066 CGCGGCCACATGAGGCGGGCGGG - Intronic
1024046889 7:45591182-45591204 AGGGGCCACAGGGAGGGGAGAGG - Intronic
1024300623 7:47884855-47884877 CGGGGCCCCAGGAGGAGGAGAGG + Intronic
1024665084 7:51538097-51538119 TGGGGACACAGGGGGAAGGGTGG - Intergenic
1024986933 7:55202344-55202366 CTGGGCCACAGGCTGCAGGGTGG - Intronic
1025052264 7:55741361-55741383 CAGGGCCACTGGGAGCTGGGCGG + Intergenic
1025129221 7:56367044-56367066 CAGGGCCACTGGGAGCTGGGCGG + Intergenic
1025177639 7:56810082-56810104 CAGGGCCACCGGGAGCTGGGCGG + Intergenic
1026850360 7:73719722-73719744 CGGGGTCCCGGGGGCCGGGGCGG - Intergenic
1026932633 7:74232466-74232488 TGGGGCGAGGGGGGGCGGGGTGG + Intronic
1027121885 7:75527883-75527905 TGGGGCCAGAGGGGCCGGGAGGG - Intergenic
1027218857 7:76201719-76201741 GGGGGGCGAAGGGGGCGGGGAGG + Intergenic
1027275243 7:76549548-76549570 TGGGGCCAGAGGGGCCGGGCGGG + Intergenic
1028621591 7:92834082-92834104 CCGGGCCTCAGGAGGCGGGGAGG - Intronic
1029207696 7:98879091-98879113 CCGGGCCAGAGGGGGCGCTGTGG - Intronic
1029371788 7:100155116-100155138 AGAGGCCACAGGGGGCGTGATGG + Exonic
1029422241 7:100477678-100477700 AGGGGCCTCAGGGGGCGCCGGGG - Exonic
1029514839 7:101018154-101018176 AGGGGTCCCAGGGGGAGGGGAGG - Intronic
1029720952 7:102364098-102364120 TGGGGCCAGAGGGGCCGGGCGGG + Exonic
1029736527 7:102468570-102468592 CGTGGCCACGTGCGGCGGGGAGG + Exonic
1031586355 7:123535172-123535194 CGGGGCCAGAGGCGAAGGGGCGG + Intergenic
1032091075 7:128911835-128911857 CTTTGCCACAGGGGGCAGGGAGG + Intergenic
1032427703 7:131834683-131834705 AGGAGCCCCAGGGGGAGGGGAGG + Intergenic
1034129983 7:148706678-148706700 GGGGGCGGCGGGGGGCGGGGTGG + Intronic
1034401413 7:150864041-150864063 CGGGGCCTCAGGGGAGGAGGGGG - Intergenic
1034440499 7:151083386-151083408 CGGGGCCCTGGGCGGCGGGGTGG + Intronic
1034556370 7:151852822-151852844 CGGGGCCCCAGGGAGGGAGGAGG - Intronic
1035074530 7:156169195-156169217 TGGGGGGACAGTGGGCGGGGTGG + Intergenic
1035726962 8:1830788-1830810 CGGGGCTACAAGGTGCGGAGAGG + Intronic
1036242574 8:7092345-7092367 CGGGGCTGCCGGGGGCGCGGAGG + Intergenic
1036768289 8:11562850-11562872 CGGGGCCTCACAGGGCGGGGCGG - Intronic
1036769041 8:11566188-11566210 AGGGGCTGCAGGGGCCGGGGAGG - Intergenic
1037807542 8:22066915-22066937 CGGGGCCGCCGAGGGCGGGTGGG + Intronic
1037817546 8:22120053-22120075 CGGGGCCTGCGGTGGCGGGGAGG + Intronic
1037820739 8:22133529-22133551 CGTTGCCACAGGGTGGGGGGTGG - Intergenic
1037988359 8:23303496-23303518 GGGGACCAGAGGGGGCCGGGTGG + Intronic
1039502775 8:38030491-38030513 CGGGGCGGCACGGGGCGAGGCGG + Exonic
1040471429 8:47738246-47738268 CGGGGCCGCGGGGGAAGGGGCGG + Exonic
1040850690 8:51898637-51898659 CGGGGTCCCTGGGGCCGGGGAGG - Intronic
1041106897 8:54453550-54453572 CGGGGCCACAGTTGGAGGTGGGG + Intergenic
1041906447 8:63038623-63038645 CGGGGCCGCAGCAGACGGGGAGG - Intronic
1043841245 8:85107188-85107210 GGCGGCCCGAGGGGGCGGGGCGG - Exonic
1045098846 8:98825721-98825743 CGGGGCGGCCGGGGGCGGGGCGG - Intronic
1045098858 8:98825741-98825763 CGGGGCGGCCGGGGGCGGGGCGG - Intronic
1045098870 8:98825761-98825783 CGGGGCGGCCGGGGGCGGGGCGG - Intronic
1045098882 8:98825781-98825803 CGGGGCGGCCGGGGGCGGGGCGG - Intronic
1045098894 8:98825801-98825823 CGGGGCGGCCGGGGGCGGGGCGG - Intronic
1045098906 8:98825821-98825843 CGGGGCGGCCGGGGGCGGGGCGG - Intronic
1045098918 8:98825841-98825863 CGGGGCGGCCGGGGGCGGGGCGG - Intronic
1045098930 8:98825861-98825883 CGGCGCGGCCGGGGGCGGGGCGG - Intronic
1045543317 8:103106268-103106290 GGGAGCCAGAGGTGGCGGGGAGG + Intergenic
1047615420 8:126558538-126558560 CGAGGCCCGAGTGGGCGGGGCGG - Intergenic
1048492768 8:134909915-134909937 TGGGGTCAGAGGGGGTGGGGTGG - Intergenic
1048980916 8:139703150-139703172 CGGGGAGGCGGGGGGCGGGGAGG + Intergenic
1048988872 8:139749883-139749905 CGGGGCCACAGGCAGCCTGGAGG + Intronic
1049411487 8:142475722-142475744 AGGGGCCCGTGGGGGCGGGGCGG + Intronic
1049537596 8:143189537-143189559 GGGGTCCACAGGGGTGGGGGTGG - Intergenic
1049657395 8:143804866-143804888 AGGGGACAGAGGGCGCGGGGCGG + Intronic
1049777428 8:144413182-144413204 CGGGGCCGCACGGGGCTGGGAGG - Intronic
1049850110 8:144826455-144826477 CGGGGCAGCAGGGGCGGGGGTGG + Intergenic
1050513045 9:6413975-6413997 GGGGCCCCCAGAGGGCGGGGAGG + Intronic
1051520063 9:17976726-17976748 CGGGGAGGCAGGGGGCAGGGAGG - Intergenic
1051687730 9:19675804-19675826 CGAAGCCACAGCAGGCGGGGAGG - Intronic
1052051046 9:23850237-23850259 CGGGGGTGCTGGGGGCGGGGGGG - Intergenic
1052851632 9:33381708-33381730 GGGGGCGCCAGGGGGAGGGGAGG - Intergenic
1052888821 9:33676945-33676967 CCGGGCCACGGGGGGTGCGGCGG + Intergenic
1053262779 9:36684754-36684776 TGGGGACTCAGGGGGCAGGGTGG - Intergenic
1053283183 9:36834834-36834856 CAGGGTCACAGGGTGGGGGGCGG + Exonic
1056488839 9:87085345-87085367 CGGGGCGCCAGGGGAGGGGGAGG - Intergenic
1057025876 9:91733531-91733553 CGGGGCATCAGGGGGCTGAGTGG - Intronic
1057075765 9:92137428-92137450 TGGGGCCACAGGGCATGGGGTGG + Intergenic
1057316807 9:93974457-93974479 TGGGGCCACGGGGGGGGGGGGGG + Intergenic
1057546984 9:96026291-96026313 GGGGGCCCCAGAGGGCGGCGTGG - Intergenic
1058687254 9:107489651-107489673 GGGGGCCAGAGGGGCGGGGGAGG + Intronic
1059499050 9:114735068-114735090 GGAGGCCAAGGGGGGCGGGGTGG + Intergenic
1060016914 9:120094667-120094689 AGGGGACACACAGGGCGGGGGGG + Intergenic
1060094756 9:120778347-120778369 CGGGGGCACACGGGGGCGGGTGG - Exonic
1060205530 9:121680590-121680612 TGGGGCCACAGCAGGCAGGGTGG + Intronic
1060468768 9:123930240-123930262 CGTGGCCGGTGGGGGCGGGGCGG + Intergenic
1060544076 9:124450331-124450353 GGGGGCCCAAGAGGGCGGGGTGG + Intergenic
1061003849 9:127917214-127917236 CGGGGCCTCAGGGCCGGGGGCGG + Intergenic
1061181720 9:129028355-129028377 CGGAGCCAGAGGGGCGGGGGCGG + Intergenic
1061191388 9:129084795-129084817 TGGGGGCACTGGGGGTGGGGTGG - Intronic
1061194654 9:129101071-129101093 TGGGGGCACAGGGGGTGTGGAGG + Intronic
1061246823 9:129404875-129404897 CGGGCCCACACGGGGCGAGGAGG - Intergenic
1061495495 9:130971550-130971572 CGGGGGCAGAGGGGCCTGGGAGG - Intergenic
1061544095 9:131293872-131293894 CGGGGCCAGAGCGGGTGGGCAGG - Intronic
1061573292 9:131490893-131490915 TGGGTGCACACGGGGCGGGGTGG - Intronic
1061610082 9:131740150-131740172 CGGGCCCACAGGGGGCGCTGTGG - Intergenic
1061882272 9:133574330-133574352 CTGGCACACAGGGGGCAGGGAGG + Intronic
1061913653 9:133738072-133738094 AGGAGCGGCAGGGGGCGGGGAGG + Intronic
1061960075 9:133983407-133983429 CAGAGGCACAGGGGGTGGGGCGG + Intronic
1061975247 9:134064998-134065020 CGGAGCCACAGGGGTCGGGAAGG + Intronic
1062057292 9:134475233-134475255 CTGGGCCTCAGGGGGCTGGGTGG + Intergenic
1062243566 9:135552279-135552301 TGGGGTCACAGTGGGTGGGGAGG - Intergenic
1062276857 9:135735470-135735492 CCGTGCCACAGGGGCCTGGGTGG - Intronic
1062322524 9:135997357-135997379 AGGAGCCTGAGGGGGCGGGGAGG - Intergenic
1062452356 9:136620996-136621018 GGGGGCCCCAGGTGGCGGTGGGG - Intergenic
1062595527 9:137297412-137297434 CCTGGCCACAAGGGGAGGGGGGG - Intergenic
1062599766 9:137314594-137314616 CGGGGGGACAGGGGGCAAGGGGG - Intronic
1203564459 Un_KI270744v1:79941-79963 CGGGGCCAGAGAGGCCAGGGAGG + Intergenic
1186466216 X:9786315-9786337 GGGGCCGACGGGGGGCGGGGCGG - Intergenic
1186467848 X:9797797-9797819 CGGAGGCACAGTGGGTGGGGTGG + Intronic
1187173148 X:16870580-16870602 GAGGGCCCGAGGGGGCGGGGCGG + Intergenic
1187272412 X:17791251-17791273 TGAGGCCACAGGGTGCGGGGAGG + Intergenic
1187876398 X:23807482-23807504 GGCCTCCACAGGGGGCGGGGAGG + Intergenic
1190598100 X:52066319-52066341 CGGGGCCATCGGGGGCCGAGGGG + Exonic
1190610724 X:52187754-52187776 CGGGGCCATCGGGGGCCGAGGGG - Exonic
1191025376 X:55908222-55908244 CCAGGACAAAGGGGGCGGGGAGG + Intergenic
1192033991 X:67544453-67544475 CTGGGCCGACGGGGGCGGGGGGG - Intronic
1192363354 X:70452721-70452743 CCGGGCCGCAGGGAGCGGAGCGG - Intronic
1192782038 X:74304214-74304236 CGGGGCCTCCGGGGCCGAGGTGG + Exonic
1195379047 X:104254282-104254304 AGGGGCCACAGCCGGCGGAGGGG - Exonic
1197726035 X:129777179-129777201 CCGGTCCCCAGGTGGCGGGGAGG + Intergenic
1199832977 X:151562857-151562879 CGGGGGGGCGGGGGGCGGGGGGG + Intergenic
1199881213 X:151975114-151975136 GGGTGCAACAGGTGGCGGGGAGG - Intergenic
1200084885 X:153599187-153599209 CGGGGCGGCGAGGGGCGGGGCGG - Intronic
1200084895 X:153599207-153599229 CGGGGCGGCGAGGGGCGGGGCGG - Intronic
1200084905 X:153599227-153599249 CGGGGCGGCGAGGGGCGGGGCGG - Intronic
1200114741 X:153765133-153765155 CAGGGCCAGAGGGGGAGGGCTGG + Intronic
1200256606 X:154585876-154585898 TGATGCCACAGGGGGCAGGGTGG + Intronic
1200261163 X:154618527-154618549 TGATGCCACAGGGGGCAGGGTGG - Intronic
1201158977 Y:11154554-11154576 CGGGGCCAGAGAGGCCAGGGAGG - Intergenic