ID: 1129288648

View in Genome Browser
Species Human (GRCh38)
Location 15:74546197-74546219
Sequence CAAAGCAATCAGTGGGAGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 222}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129288648_1129288656 27 Left 1129288648 15:74546197-74546219 CCCGCCTCCCACTGATTGCTTTG 0: 1
1: 0
2: 2
3: 23
4: 222
Right 1129288656 15:74546247-74546269 GCTGCCCCCGCACTGCTGTGTGG 0: 1
1: 0
2: 7
3: 26
4: 244
1129288648_1129288654 5 Left 1129288648 15:74546197-74546219 CCCGCCTCCCACTGATTGCTTTG 0: 1
1: 0
2: 2
3: 23
4: 222
Right 1129288654 15:74546225-74546247 GCAAAACATCTGTGAGTTGCCGG 0: 1
1: 0
2: 3
3: 13
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129288648 Original CRISPR CAAAGCAATCAGTGGGAGGC GGG (reversed) Intronic
900589401 1:3453115-3453137 GAAAGCACTCAGTGGGAATCAGG + Intergenic
900653199 1:3741405-3741427 AAAAGCAACCAGTCAGAGGCTGG - Intergenic
901238467 1:7679900-7679922 TCAAGGAATGAGTGGGAGGCAGG + Intronic
901674744 1:10876553-10876575 AATATCCATCAGTGGGAGGCTGG - Intergenic
905281997 1:36855217-36855239 CAAAGCAAGGACTGGGAGCCAGG - Intronic
905293010 1:36935905-36935927 GAAAGCAATCTGAGGGAGTCGGG - Intronic
906130930 1:43455270-43455292 CAGAACAATCAGTGGGAGCTGGG - Intergenic
906237129 1:44218849-44218871 ATAAGGTATCAGTGGGAGGCAGG - Intronic
906291039 1:44619318-44619340 CAAAGAAGCCAGAGGGAGGCTGG + Intronic
906919119 1:50044579-50044601 CAAAGCAATCAGTAAGAGCATGG - Intergenic
910067900 1:83175330-83175352 CAAAGCAATAAGAGGGAGGCAGG + Intergenic
911154366 1:94624098-94624120 CAAAGCAATCACTCTGCGGCTGG + Intergenic
911402782 1:97397543-97397565 TAAAGAAATCAGTGATAGGCAGG - Intronic
912488835 1:110050062-110050084 CACAGCAATCAATGTGGGGCGGG - Intronic
914432129 1:147628453-147628475 CTAAGCAATCTGTGGGACCCAGG - Intergenic
915018509 1:152759045-152759067 CAAAGCATTCACTGGAAAGCGGG - Intronic
915225063 1:154405778-154405800 CACCGCAGTCTGTGGGAGGCTGG + Intronic
916500352 1:165381805-165381827 CAAAGAACTCAGTGGGAAGAGGG - Intergenic
919963466 1:202496358-202496380 CAAAGGAGTCATTGGTAGGCAGG - Intronic
921681503 1:218038107-218038129 CAAAGAAATCAGCTGGGGGCGGG - Intergenic
922349327 1:224722765-224722787 TAAAGAAATGGGTGGGAGGCAGG + Intronic
924657644 1:245988048-245988070 CAGAGGAATCACTAGGAGGCAGG + Intronic
1063189038 10:3676754-3676776 CAAAGCAGTGAGTGGGTGTCTGG + Intergenic
1066974903 10:42358667-42358689 TAAAAAAATCAGTGAGAGGCCGG - Intergenic
1067748197 10:48952348-48952370 CACTGTAATCAGAGGGAGGCTGG - Intronic
1069665799 10:70156997-70157019 CAAGTCATTCAGTGGGAGGGTGG + Intronic
1070204996 10:74249187-74249209 CAAAGTATTTAGTGGGAGGAAGG + Intronic
1070628412 10:78067457-78067479 CAAAGCAAGCAGGGGAAGCCTGG - Intergenic
1070762030 10:79029898-79029920 CAAAGCCAGCAGTGTCAGGCCGG - Intergenic
1071002973 10:80852128-80852150 GAAAGCAGGCAGTGAGAGGCAGG + Intergenic
1072571670 10:96663331-96663353 CAAAGAAACCAATGGCAGGCTGG + Intronic
1073598697 10:104825020-104825042 CAAAGCAAGCATTGGCATGCAGG + Intronic
1075257202 10:120934725-120934747 CAAAGCAGGCAGAGGGAGGGGGG - Intergenic
1077270284 11:1674588-1674610 CAAAGACCTCAGTGGGAGGGAGG + Intergenic
1078677335 11:13434681-13434703 CAAAGCAAACAATGGGAGAATGG + Intronic
1083607704 11:63988640-63988662 CACAGCAATCTGGAGGAGGCAGG - Exonic
1084374866 11:68769617-68769639 AAAAGCAATCAGGCGGAGGCAGG - Intronic
1084650328 11:70485843-70485865 CAAAGCTTTCAGGGGGTGGCAGG + Intronic
1084762931 11:71285321-71285343 GAAAGTGATCAGTGTGAGGCGGG - Intergenic
1085513928 11:77101594-77101616 CTAATCAATCAGTGGGATCCTGG - Intronic
1085717941 11:78889661-78889683 CAAAGCACGCAGTGTGAGCCAGG - Intronic
1086499836 11:87441074-87441096 CAAAGCTATAAGTAAGAGGCAGG - Intergenic
1086582606 11:88416294-88416316 CAATGCATTCAGTGGTGGGCTGG + Intergenic
1087366740 11:97229670-97229692 CAAAGTAATTAGTGGAGGGCTGG + Intergenic
1087805235 11:102548136-102548158 AAAAGCAAACACTGTGAGGCCGG - Intergenic
1088110873 11:106259909-106259931 CAAAGCAGCCAAAGGGAGGCAGG + Intergenic
1088590703 11:111400120-111400142 CCAGCCAGTCAGTGGGAGGCTGG - Intronic
1089190862 11:116652291-116652313 CAAAGCAGTCAGCAGAAGGCAGG - Intergenic
1093125526 12:15323170-15323192 CAAAGCATTCTGTGCGAGGGAGG - Intronic
1093746141 12:22742791-22742813 CACAGGCATCAGTGGGGGGCAGG - Intergenic
1095698230 12:45164745-45164767 CAGAGCACCCAGTGGGAGGGGGG - Intergenic
1096533414 12:52256088-52256110 GGAAGCCAACAGTGGGAGGCTGG - Intronic
1098576769 12:72051551-72051573 CAAAGCAAGCAATGGCAGGTGGG + Intronic
1101856531 12:108448161-108448183 AAGAGCAAGGAGTGGGAGGCAGG - Intergenic
1102539079 12:113605459-113605481 GAAATCAATAAGTGGGAGGCTGG - Intergenic
1103178941 12:118890844-118890866 AAAAGCATTCATTGGGATGCTGG - Intergenic
1103994583 12:124820777-124820799 CACAGAAAACAGTGGGGGGCAGG + Intronic
1104800585 12:131552899-131552921 CAGTGCAATCAGAGTGAGGCTGG + Intergenic
1108707472 13:53002668-53002690 CAAAGAAAGCAGTGGCAGGCAGG - Intergenic
1110468150 13:75826871-75826893 AAAAGCAAGCAGTGGTATGCAGG - Intronic
1110602218 13:77388034-77388056 GAAAGCAATCTGGGGGAAGCAGG + Intergenic
1117263047 14:54056528-54056550 CAACTCAATCAGTGGGATCCAGG + Intergenic
1119178297 14:72586092-72586114 CAGAGGAGTCAGTGGGAGCCAGG - Intergenic
1120037778 14:79717470-79717492 AAAAGCAATCAGTGAGAGACTGG + Intronic
1120850819 14:89167869-89167891 AAACTCACTCAGTGGGAGGCAGG + Intronic
1121534510 14:94681995-94682017 CAATGCAATCCTTGGGACGCAGG + Intergenic
1122295054 14:100700812-100700834 CATAGCAAGTAGAGGGAGGCTGG + Intergenic
1124432691 15:29620706-29620728 CAAAGAAATAAGTGGGAAGAAGG + Intergenic
1128478155 15:68014831-68014853 CATCTCAATCAGTGGTAGGCTGG + Intergenic
1129243269 15:74264345-74264367 CAAAGGGAACGGTGGGAGGCCGG + Intronic
1129288648 15:74546197-74546219 CAAAGCAATCAGTGGGAGGCGGG - Intronic
1130718731 15:86364526-86364548 CATTCCAATCAGTGGGAGGTGGG - Intronic
1131423733 15:92328606-92328628 CAAAACAATCAGTAGTAGGTAGG - Intergenic
1131986210 15:98044723-98044745 CAAAGACATGGGTGGGAGGCTGG + Intergenic
1132010413 15:98270704-98270726 CAAAATAATCACTGGGAGGGGGG + Intergenic
1133343657 16:5055542-5055564 CAAGGCCCTCAGTGGGAGGCGGG - Intronic
1133424652 16:5677504-5677526 CAAAGCAACATGAGGGAGGCAGG - Intergenic
1133544156 16:6788769-6788791 CAGAAAAATCAGTGGGGGGCCGG - Intronic
1135135037 16:19881126-19881148 GAAAGGCCTCAGTGGGAGGCAGG + Intronic
1135396346 16:22134591-22134613 CAAAGCCTTCAGAGGGAGCCTGG - Intronic
1135756422 16:25102277-25102299 AAAATAAATAAGTGGGAGGCGGG - Intergenic
1136074703 16:27808945-27808967 CCCAGCCATCAGTGGGACGCAGG - Intronic
1136250619 16:29002228-29002250 CAATGAAATGAGTGTGAGGCTGG - Intergenic
1136515551 16:30766144-30766166 CAAACTAAGGAGTGGGAGGCAGG - Exonic
1139041260 16:63001730-63001752 CAAAGCATTCAGTAGGTGACAGG + Intergenic
1139354222 16:66357745-66357767 AAAAGCAATGAATGGGAGGAAGG + Intergenic
1139558131 16:67725552-67725574 CAAGGCAGGCAGTGGGAGGTGGG + Exonic
1140036306 16:71373892-71373914 AAAAGCAATCAGAGGGATTCAGG + Intronic
1141116158 16:81311677-81311699 CAAAGCAAACTGTGGGATGTGGG - Intergenic
1142350011 16:89575580-89575602 CAAAGCTATCAGTTGGGGGGGGG + Intergenic
1142839055 17:2613190-2613212 GAATGCAAGCTGTGGGAGGCAGG + Intronic
1143548672 17:7615141-7615163 CCAACCAATCAGGGGGAGGGAGG + Intronic
1143691915 17:8575148-8575170 CAAATCAATCCCTGGGAAGCAGG - Intronic
1144207891 17:12992108-12992130 CAAATCAATCAGTGAGAGCCTGG - Intergenic
1146581523 17:34042520-34042542 AAATCCAATCAGTGGAAGGCTGG + Intronic
1147882827 17:43665161-43665183 GGAAGGAATCCGTGGGAGGCTGG + Intergenic
1148892642 17:50819287-50819309 CAAAGTAACGTGTGGGAGGCTGG + Intergenic
1149393255 17:56213521-56213543 CAAGGAAAACAGAGGGAGGCAGG + Intronic
1149450636 17:56747584-56747606 CAAAGCAATGAGTGGGAAAGGGG - Intergenic
1153001091 18:456056-456078 CAAAGCACGTGGTGGGAGGCTGG + Intronic
1154194278 18:12254430-12254452 CACGGCAATCAGGGGGACGCGGG - Intronic
1154353518 18:13607130-13607152 CAAAACAATGAGTGGGTGGCCGG + Intronic
1158065267 18:53399607-53399629 CAAAGAAATCAGAGGGGGCCGGG + Intronic
1158190671 18:54824882-54824904 CAGAGCAATAAGTGTGAAGCAGG - Intronic
1158765641 18:60447237-60447259 CCCAGCAAGCAGTGGCAGGCTGG - Intergenic
1160251828 18:77210053-77210075 TAAAGCTGGCAGTGGGAGGCAGG - Intergenic
1161236911 19:3202785-3202807 AAAAGGCATCAGTGGGGGGCTGG - Intronic
1167299356 19:48670299-48670321 CAAAGGACCCAGTGGCAGGCAGG + Intronic
925800700 2:7597501-7597523 CAAAGTGAGCAGTGGCAGGCAGG + Intergenic
927856114 2:26528970-26528992 CACAGCCAACAGTGGCAGGCTGG - Intronic
929881968 2:45844725-45844747 CTGAGCAACCAATGGGAGGCTGG + Intronic
934629044 2:95895318-95895340 CGAATAAATCAGTGGGGGGCTGG - Intronic
934629458 2:95900934-95900956 CGAATAAATCAGTGGGGGGCTGG - Intronic
934629873 2:95906550-95906572 CGAATAAATCAGTGGGGGGCTGG - Intronic
934630278 2:95912163-95912185 CGAATAAATCAGTGGGGGGCTGG - Intronic
934630555 2:95915899-95915921 CGAATAAATCAGTGGGGGGCTGG - Intronic
934803636 2:97194976-97194998 CGAATAAATCAGTGGGGGGCTGG + Intronic
934832991 2:97551208-97551230 CGAATAAATCAGTGGGGGGCTGG - Intronic
935654503 2:105410197-105410219 AAAAGGAATCAGGCGGAGGCCGG + Intronic
935883902 2:107594979-107595001 CAAAGGAAGAAGTGGCAGGCAGG + Intergenic
936225689 2:110648358-110648380 CAAAACAATCAGTGGTTGCCAGG + Intronic
936909550 2:117576101-117576123 CAAAGCAAACACTTGGTGGCAGG + Intergenic
937031592 2:118745200-118745222 CAAAGCATTCAATAGGAAGCAGG - Intergenic
937549993 2:123076063-123076085 CAAAGATATCAGTTGAAGGCTGG - Intergenic
937872030 2:126792810-126792832 CCAGGGAAACAGTGGGAGGCAGG + Intergenic
938303510 2:130232056-130232078 GAAAGAAAGCTGTGGGAGGCAGG + Intergenic
938453167 2:131442200-131442222 GAAAGAAAGCTGTGGGAGGCAGG - Intergenic
939521910 2:143241958-143241980 TAAAGCAATCTGTGGGAGGAAGG + Intronic
942532704 2:176928956-176928978 TACAGCAATCAGTTGGAAGCAGG - Intergenic
944146024 2:196508608-196508630 CACAGATATTAGTGGGAGGCTGG - Intronic
944587468 2:201185344-201185366 CAAAGCAATCTGGGGGAGGCAGG - Intronic
945691920 2:213047029-213047051 CCAAGCAAGTAGTGGCAGGCAGG + Intronic
947968938 2:234305694-234305716 CAAAGCCATCACTGCTAGGCTGG + Intergenic
948125779 2:235563920-235563942 CATGGCTATCAGTGGGAAGCTGG + Intronic
948488732 2:238297764-238297786 AAAACCTTTCAGTGGGAGGCAGG + Intergenic
1169111575 20:3037434-3037456 CACAGGAAACATTGGGAGGCAGG + Intronic
1169260736 20:4136244-4136266 CGGAGCGATAAGTGGGAGGCAGG + Intronic
1171893789 20:30742220-30742242 CAAAGCAGTCAGAGGAAGGTGGG - Intergenic
1173656056 20:44701043-44701065 CAAAGAAAGGAGTGAGAGGCTGG - Intergenic
1174563996 20:51451607-51451629 CACAGCAGTAAGTGGGTGGCGGG + Intronic
1175609728 20:60340495-60340517 CAAACCAAACAGTGGGAGACTGG - Intergenic
1176774306 21:13116993-13117015 TAAAAAAATCAGTGAGAGGCCGG - Intergenic
1179343201 21:40531847-40531869 CAGAGCATTGAGTGGGATGCTGG - Intronic
1180439071 22:15346277-15346299 AAAAAAAATCAGTGAGAGGCCGG - Intergenic
1180521929 22:16216709-16216731 AAAAAAAATCAGTGAGAGGCCGG - Intergenic
1180667895 22:17529258-17529280 CAAAGCAAGCACAGGAAGGCTGG + Intronic
1182256775 22:29044776-29044798 CAAAGTATTCAGTGGGTTGCTGG - Exonic
1184058690 22:42068750-42068772 CAAAGCAGTAAGTGGGAGGATGG + Intronic
949263730 3:2133077-2133099 CAGAGCAATCAGTAGTAGGTTGG + Intronic
951316634 3:21195207-21195229 GAAAGCAATCACTAGGAGGCTGG + Intergenic
952509561 3:34039391-34039413 CAAAGCATCCTGTGGTAGGCAGG - Intergenic
952822447 3:37496791-37496813 CAATGCCACCAGTGGGAGTCCGG - Intronic
953907858 3:46877304-46877326 CAGAGAAATCAGAGGGGGGCTGG - Intronic
953920508 3:46948333-46948355 CAAAGCGCTGAGCGGGAGGCTGG + Intronic
955411012 3:58655413-58655435 GAAAGCAATCCAGGGGAGGCTGG - Intronic
959138486 3:102454937-102454959 TAAAGCAAGTAGTGGGAGGAGGG + Intronic
959406208 3:105964612-105964634 CAAAGAAAGCAGTGTGAAGCTGG - Intergenic
959664426 3:108905202-108905224 CAAAACAGACAGTGGGAGGCAGG + Intergenic
960608357 3:119531523-119531545 CAAACCATTGAGTCGGAGGCAGG + Intronic
961001557 3:123377506-123377528 CACAGCACTCAGAGGGAGGGAGG - Intronic
964439335 3:156689808-156689830 CCAGGCAAACAATGGGAGGCAGG - Intronic
965666782 3:171102661-171102683 CAGAGCATTCAGTGAGAGACAGG + Intronic
968002007 3:195212539-195212561 CACAGCAGGCGGTGGGAGGCGGG + Intronic
968669731 4:1842654-1842676 CACAGGCAGCAGTGGGAGGCTGG + Intronic
970019791 4:11555191-11555213 GAAAGAGTTCAGTGGGAGGCAGG + Intergenic
970640078 4:18054271-18054293 CAAGGCAGCCAGTGGGAGGAAGG - Intergenic
970946369 4:21697784-21697806 CAGACCATTCAGAGGGAGGCGGG + Intronic
971258297 4:25032890-25032912 CACAGCAGTAAGTGGCAGGCTGG - Intergenic
971866597 4:32180106-32180128 CAATTCAAACAGAGGGAGGCAGG + Intergenic
972036907 4:34535168-34535190 CAAAGCAATGAGGGCAAGGCAGG - Intergenic
974369074 4:60990414-60990436 CAAAGCACAGAGTGTGAGGCTGG - Intergenic
977916670 4:102601840-102601862 AAAAGCAATCAGGGGCAGGAAGG - Intronic
978052684 4:104222037-104222059 CAAAGCACACAGTGGGAAGGTGG + Intergenic
980373236 4:131907050-131907072 GAAATCAATAAGTGGGAGGTTGG + Intergenic
980962701 4:139492139-139492161 CAAAACAAGCAGGGTGAGGCTGG - Intergenic
981189866 4:141849935-141849957 CACAACAAAAAGTGGGAGGCAGG + Intergenic
984147255 4:176077956-176077978 GAAAGCAATCAGTGGTTGCCTGG - Intronic
987035822 5:14017342-14017364 CAAAGCAGAGAGTGGGATGCTGG - Intergenic
989454635 5:41628925-41628947 CAAAGCAAACACTAGGATGCAGG - Intergenic
992880708 5:81106526-81106548 CAGAGAAATCAGTTGGAGGCAGG - Intronic
994167649 5:96624601-96624623 CAAAGCAAAGAATGGGTGGCTGG + Intronic
994175507 5:96706663-96706685 CAAGCCAATGACTGGGAGGCTGG - Intronic
994965948 5:106670661-106670683 GAAAGCAAATAGGGGGAGGCTGG + Intergenic
996931611 5:128896070-128896092 CAATGAAATCAGTGGTAGCCTGG - Intronic
1001424509 5:171614672-171614694 CAGAGGCAGCAGTGGGAGGCTGG + Intergenic
1001716554 5:173821120-173821142 GAAAGCACTCAGTGAAAGGCAGG + Intergenic
1003902259 6:10665511-10665533 CAAAGAAATCAGAGAGGGGCTGG - Intergenic
1004713103 6:18191249-18191271 CAAAGCCCTCTGTGTGAGGCCGG + Intronic
1007710045 6:43817098-43817120 CACAGAAATCAGTGTGTGGCAGG + Intergenic
1008275650 6:49540869-49540891 CAAAGCAAAGAGTGGGTGGGTGG - Intergenic
1009766199 6:68079089-68079111 AAAAGCAATCACTGAGAGGGAGG - Intergenic
1010631874 6:78207973-78207995 CAAAGCATTCAAGAGGAGGCAGG - Intergenic
1011349898 6:86411167-86411189 CTAAGCAAGCAGTGGCAGCCAGG - Intergenic
1011864562 6:91808047-91808069 GAAATCAATCAGAGGCAGGCAGG - Intergenic
1012531085 6:100237271-100237293 CAATGCAGGCGGTGGGAGGCAGG - Intergenic
1013912195 6:115289498-115289520 AAAAGCATTCAGTGTGTGGCAGG - Intergenic
1014563338 6:122917546-122917568 CAATGCAAGCAGTTAGAGGCTGG + Intergenic
1017173583 6:151480709-151480731 TAAAGCAATCATTGGGAAGCGGG - Intergenic
1018901338 6:168053332-168053354 CAGAGCTGGCAGTGGGAGGCTGG - Intergenic
1019521952 7:1464845-1464867 CACAGCAATCAGAGGCAGGCTGG - Intergenic
1020926464 7:14333160-14333182 ACAATCAATCAGTGAGAGGCCGG + Intronic
1021486398 7:21173032-21173054 TACAGCAATCAGTGCAAGGCGGG - Intergenic
1021676779 7:23088086-23088108 GAAAGCAATCAGTGGTTGCCTGG - Intergenic
1021734178 7:23627046-23627068 CAGAGCAGTCAGTGTGAAGCTGG - Intronic
1025106841 7:56178045-56178067 CAAAGAGATGAGTCGGAGGCTGG - Intergenic
1027276194 7:76559432-76559454 AAAAGCAATAAGAGGGAGGCAGG - Intergenic
1028787407 7:94811346-94811368 CAAAGCAATCCTGGGGAGGCAGG + Intergenic
1032445206 7:131976420-131976442 CAAAGCCAACTGGGGGAGGCTGG + Intergenic
1034998600 7:155594008-155594030 CACAGCAGTCAGTGAGATGCAGG - Intergenic
1036601837 8:10267999-10268021 CAAAGCCATCATTGTGACGCAGG - Intronic
1037480493 8:19300857-19300879 CAAAGCAAACTGTGGGTGACAGG + Intergenic
1037579984 8:20239377-20239399 CAAAGCAAGCTGGGGGTGGCGGG - Intergenic
1037809725 8:22080377-22080399 CAAAGGAATCAGAGGCAGTCGGG - Intronic
1038508071 8:28103246-28103268 TAAAACAATCAGTGGAAGTCAGG - Intronic
1039164863 8:34666920-34666942 CAAAGAAAAAAGTGGGAGGGGGG - Intergenic
1044712226 8:95069001-95069023 GAAAGCAATCAGAGGGATGGAGG - Intronic
1045225828 8:100244800-100244822 AAAAGGAATCAGTGAGAGGTGGG - Intronic
1045870733 8:106924084-106924106 GAAAACAATCAGTGGTTGGCAGG + Intergenic
1048933843 8:139339108-139339130 CCAAGCAGTCAGAGGGATGCCGG + Intergenic
1052068892 9:24057181-24057203 CAAAGAAATGCATGGGAGGCTGG + Intergenic
1053701071 9:40691200-40691222 TAAAAAAATCAGTGAGAGGCCGG + Intergenic
1054312364 9:63490598-63490620 TAAAAAAATCAGTGAGAGGCCGG + Intergenic
1054411135 9:64814654-64814676 AAAAAAAATCAGTGAGAGGCCGG + Intergenic
1054749224 9:68887306-68887328 TACAGCAATGAGTGGTAGGCAGG + Intronic
1054949121 9:70830083-70830105 CAAAGCAGTCTGTGAGAGGCAGG + Intronic
1055729812 9:79268878-79268900 CAATGCAATCAGTGGGCAGAGGG - Intergenic
1056231344 9:84547713-84547735 CAAAGGAGTCAATGAGAGGCTGG - Intergenic
1057228247 9:93303794-93303816 CAAAGCATGCATTGGGAAGCAGG - Intronic
1058729001 9:107832078-107832100 TAAAGAGATCAGTGAGAGGCTGG + Intergenic
1061188775 9:129070102-129070124 CAGAGGAAGCAGTGGGAGGGAGG + Intronic
1061832060 9:133302530-133302552 CAAAGGAAGCAGTGGGAGTGGGG - Intergenic
1061955653 9:133960004-133960026 CAAAGCACACAGTGAGAGCCGGG + Intronic
1062009776 9:134260825-134260847 GCAAGCAGGCAGTGGGAGGCGGG - Intergenic
1062395619 9:136351460-136351482 CCAAGGAAGGAGTGGGAGGCTGG + Intronic
1185787776 X:2905213-2905235 TAAGGACATCAGTGGGAGGCAGG - Exonic
1187713352 X:22076398-22076420 GAAATCAATCAGTAGAAGGCGGG + Exonic
1188446635 X:30259608-30259630 CACAGCAATCTCTGGGAGGCGGG - Intergenic
1188870090 X:35361823-35361845 CAGAGCACTCAGTGAGAGGCTGG - Intergenic
1189085008 X:38013772-38013794 GAAACCAATCAGTGAGATGCTGG - Intronic
1189425752 X:40898180-40898202 CAAAACAATCAGTGAGTGGCTGG + Intergenic
1189837362 X:45039477-45039499 CAAATGAATCAATGGGAGGAGGG - Intronic
1189889141 X:45580901-45580923 AAGAGCCTTCAGTGGGAGGCAGG - Intergenic
1190106496 X:47564760-47564782 GAAAGGAATGAGTGGGAGGTTGG - Intronic
1194793892 X:98185907-98185929 CAAAGCAATCAGTATGAGGGTGG - Intergenic
1195092587 X:101475452-101475474 CAAAGCTGGCAGTGGGCGGCGGG + Intronic
1195754364 X:108186739-108186761 CAAAGCAATGAGTGGGAGATTGG - Intronic
1202299108 Y:23392231-23392253 CAAAGGAGTCATTGGTAGGCAGG - Intergenic
1202571701 Y:26278367-26278389 CAAAGGAGTCATTGGTAGGCAGG + Intergenic