ID: 1129292780

View in Genome Browser
Species Human (GRCh38)
Location 15:74581151-74581173
Sequence GGAGGGCAGGTCTACAAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 182}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129292780_1129292791 18 Left 1129292780 15:74581151-74581173 CCTCACTTGTAGACCTGCCCTCC 0: 1
1: 0
2: 1
3: 12
4: 182
Right 1129292791 15:74581192-74581214 TCAAGGCTGCAAACTGACCTTGG 0: 1
1: 0
2: 0
3: 17
4: 153
1129292780_1129292786 1 Left 1129292780 15:74581151-74581173 CCTCACTTGTAGACCTGCCCTCC 0: 1
1: 0
2: 1
3: 12
4: 182
Right 1129292786 15:74581175-74581197 GCCCCCATCAGTTCTCTTCAAGG 0: 1
1: 0
2: 1
3: 9
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129292780 Original CRISPR GGAGGGCAGGTCTACAAGTG AGG (reversed) Intronic