ID: 1129292782

View in Genome Browser
Species Human (GRCh38)
Location 15:74581168-74581190
Sequence GAGAACTGATGGGGGCGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 4, 3: 18, 4: 301}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129292782_1129292792 14 Left 1129292782 15:74581168-74581190 CCCTCCCGCCCCCATCAGTTCTC 0: 1
1: 0
2: 4
3: 18
4: 301
Right 1129292792 15:74581205-74581227 CTGACCTTGGTTTTCCCAAATGG 0: 1
1: 0
2: 0
3: 30
4: 193
1129292782_1129292791 1 Left 1129292782 15:74581168-74581190 CCCTCCCGCCCCCATCAGTTCTC 0: 1
1: 0
2: 4
3: 18
4: 301
Right 1129292791 15:74581192-74581214 TCAAGGCTGCAAACTGACCTTGG 0: 1
1: 0
2: 0
3: 17
4: 153
1129292782_1129292794 22 Left 1129292782 15:74581168-74581190 CCCTCCCGCCCCCATCAGTTCTC 0: 1
1: 0
2: 4
3: 18
4: 301
Right 1129292794 15:74581213-74581235 GGTTTTCCCAAATGGATTGCTGG 0: 1
1: 0
2: 0
3: 11
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129292782 Original CRISPR GAGAACTGATGGGGGCGGGA GGG (reversed) Intronic