ID: 1129292784

View in Genome Browser
Species Human (GRCh38)
Location 15:74581172-74581194
Sequence TGAAGAGAACTGATGGGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 289}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129292784_1129292791 -3 Left 1129292784 15:74581172-74581194 CCCGCCCCCATCAGTTCTCTTCA 0: 1
1: 0
2: 2
3: 31
4: 289
Right 1129292791 15:74581192-74581214 TCAAGGCTGCAAACTGACCTTGG 0: 1
1: 0
2: 0
3: 17
4: 153
1129292784_1129292794 18 Left 1129292784 15:74581172-74581194 CCCGCCCCCATCAGTTCTCTTCA 0: 1
1: 0
2: 2
3: 31
4: 289
Right 1129292794 15:74581213-74581235 GGTTTTCCCAAATGGATTGCTGG 0: 1
1: 0
2: 0
3: 11
4: 112
1129292784_1129292792 10 Left 1129292784 15:74581172-74581194 CCCGCCCCCATCAGTTCTCTTCA 0: 1
1: 0
2: 2
3: 31
4: 289
Right 1129292792 15:74581205-74581227 CTGACCTTGGTTTTCCCAAATGG 0: 1
1: 0
2: 0
3: 30
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129292784 Original CRISPR TGAAGAGAACTGATGGGGGC GGG (reversed) Intronic