ID: 1129292786

View in Genome Browser
Species Human (GRCh38)
Location 15:74581175-74581197
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 131}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129292780_1129292786 1 Left 1129292780 15:74581151-74581173 CCTCACTTGTAGACCTGCCCTCC 0: 1
1: 0
2: 1
3: 12
4: 182
Right 1129292786 15:74581175-74581197 GCCCCCATCAGTTCTCTTCAAGG 0: 1
1: 0
2: 1
3: 9
4: 131
1129292779_1129292786 2 Left 1129292779 15:74581150-74581172 CCCTCACTTGTAGACCTGCCCTC 0: 1
1: 0
2: 0
3: 15
4: 155
Right 1129292786 15:74581175-74581197 GCCCCCATCAGTTCTCTTCAAGG 0: 1
1: 0
2: 1
3: 9
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type