ID: 1129292788

View in Genome Browser
Species Human (GRCh38)
Location 15:74581177-74581199
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 177}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129292788_1129292792 5 Left 1129292788 15:74581177-74581199 CCCCATCAGTTCTCTTCAAGGCT 0: 1
1: 0
2: 1
3: 13
4: 177
Right 1129292792 15:74581205-74581227 CTGACCTTGGTTTTCCCAAATGG 0: 1
1: 0
2: 0
3: 30
4: 193
1129292788_1129292794 13 Left 1129292788 15:74581177-74581199 CCCCATCAGTTCTCTTCAAGGCT 0: 1
1: 0
2: 1
3: 13
4: 177
Right 1129292794 15:74581213-74581235 GGTTTTCCCAAATGGATTGCTGG 0: 1
1: 0
2: 0
3: 11
4: 112
1129292788_1129292791 -8 Left 1129292788 15:74581177-74581199 CCCCATCAGTTCTCTTCAAGGCT 0: 1
1: 0
2: 1
3: 13
4: 177
Right 1129292791 15:74581192-74581214 TCAAGGCTGCAAACTGACCTTGG 0: 1
1: 0
2: 0
3: 17
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129292788 Original CRISPR AGCCTTGAAGAGAACTGATG GGG (reversed) Intronic