ID: 1129292790

View in Genome Browser
Species Human (GRCh38)
Location 15:74581179-74581201
Sequence GCAGCCTTGAAGAGAACTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 224}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129292790_1129292791 -10 Left 1129292790 15:74581179-74581201 CCATCAGTTCTCTTCAAGGCTGC 0: 1
1: 0
2: 2
3: 18
4: 224
Right 1129292791 15:74581192-74581214 TCAAGGCTGCAAACTGACCTTGG 0: 1
1: 0
2: 0
3: 17
4: 153
1129292790_1129292792 3 Left 1129292790 15:74581179-74581201 CCATCAGTTCTCTTCAAGGCTGC 0: 1
1: 0
2: 2
3: 18
4: 224
Right 1129292792 15:74581205-74581227 CTGACCTTGGTTTTCCCAAATGG 0: 1
1: 0
2: 0
3: 30
4: 193
1129292790_1129292794 11 Left 1129292790 15:74581179-74581201 CCATCAGTTCTCTTCAAGGCTGC 0: 1
1: 0
2: 2
3: 18
4: 224
Right 1129292794 15:74581213-74581235 GGTTTTCCCAAATGGATTGCTGG 0: 1
1: 0
2: 0
3: 11
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129292790 Original CRISPR GCAGCCTTGAAGAGAACTGA TGG (reversed) Intronic