ID: 1129292791

View in Genome Browser
Species Human (GRCh38)
Location 15:74581192-74581214
Sequence TCAAGGCTGCAAACTGACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 153}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129292782_1129292791 1 Left 1129292782 15:74581168-74581190 CCCTCCCGCCCCCATCAGTTCTC 0: 1
1: 0
2: 4
3: 18
4: 301
Right 1129292791 15:74581192-74581214 TCAAGGCTGCAAACTGACCTTGG 0: 1
1: 0
2: 0
3: 17
4: 153
1129292785_1129292791 -4 Left 1129292785 15:74581173-74581195 CCGCCCCCATCAGTTCTCTTCAA 0: 1
1: 0
2: 2
3: 39
4: 409
Right 1129292791 15:74581192-74581214 TCAAGGCTGCAAACTGACCTTGG 0: 1
1: 0
2: 0
3: 17
4: 153
1129292784_1129292791 -3 Left 1129292784 15:74581172-74581194 CCCGCCCCCATCAGTTCTCTTCA 0: 1
1: 0
2: 2
3: 31
4: 289
Right 1129292791 15:74581192-74581214 TCAAGGCTGCAAACTGACCTTGG 0: 1
1: 0
2: 0
3: 17
4: 153
1129292780_1129292791 18 Left 1129292780 15:74581151-74581173 CCTCACTTGTAGACCTGCCCTCC 0: 1
1: 0
2: 1
3: 12
4: 182
Right 1129292791 15:74581192-74581214 TCAAGGCTGCAAACTGACCTTGG 0: 1
1: 0
2: 0
3: 17
4: 153
1129292789_1129292791 -9 Left 1129292789 15:74581178-74581200 CCCATCAGTTCTCTTCAAGGCTG 0: 1
1: 0
2: 1
3: 14
4: 160
Right 1129292791 15:74581192-74581214 TCAAGGCTGCAAACTGACCTTGG 0: 1
1: 0
2: 0
3: 17
4: 153
1129292788_1129292791 -8 Left 1129292788 15:74581177-74581199 CCCCATCAGTTCTCTTCAAGGCT 0: 1
1: 0
2: 1
3: 13
4: 177
Right 1129292791 15:74581192-74581214 TCAAGGCTGCAAACTGACCTTGG 0: 1
1: 0
2: 0
3: 17
4: 153
1129292779_1129292791 19 Left 1129292779 15:74581150-74581172 CCCTCACTTGTAGACCTGCCCTC 0: 1
1: 0
2: 0
3: 15
4: 155
Right 1129292791 15:74581192-74581214 TCAAGGCTGCAAACTGACCTTGG 0: 1
1: 0
2: 0
3: 17
4: 153
1129292783_1129292791 0 Left 1129292783 15:74581169-74581191 CCTCCCGCCCCCATCAGTTCTCT 0: 1
1: 0
2: 2
3: 26
4: 355
Right 1129292791 15:74581192-74581214 TCAAGGCTGCAAACTGACCTTGG 0: 1
1: 0
2: 0
3: 17
4: 153
1129292790_1129292791 -10 Left 1129292790 15:74581179-74581201 CCATCAGTTCTCTTCAAGGCTGC 0: 1
1: 0
2: 2
3: 18
4: 224
Right 1129292791 15:74581192-74581214 TCAAGGCTGCAAACTGACCTTGG 0: 1
1: 0
2: 0
3: 17
4: 153
1129292781_1129292791 5 Left 1129292781 15:74581164-74581186 CCTGCCCTCCCGCCCCCATCAGT 0: 1
1: 0
2: 1
3: 63
4: 539
Right 1129292791 15:74581192-74581214 TCAAGGCTGCAAACTGACCTTGG 0: 1
1: 0
2: 0
3: 17
4: 153
1129292787_1129292791 -7 Left 1129292787 15:74581176-74581198 CCCCCATCAGTTCTCTTCAAGGC 0: 1
1: 0
2: 1
3: 11
4: 146
Right 1129292791 15:74581192-74581214 TCAAGGCTGCAAACTGACCTTGG 0: 1
1: 0
2: 0
3: 17
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129292791 Original CRISPR TCAAGGCTGCAAACTGACCT TGG Intronic