ID: 1129294396

View in Genome Browser
Species Human (GRCh38)
Location 15:74591929-74591951
Sequence CCTGGAAGGCAGAACCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 536
Summary {0: 1, 1: 0, 2: 3, 3: 52, 4: 480}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129294396_1129294406 21 Left 1129294396 15:74591929-74591951 CCCTCCAGGTTCTGCCTTCCAGG 0: 1
1: 0
2: 3
3: 52
4: 480
Right 1129294406 15:74591973-74591995 GATCTTAGTTCACCAAGCTGAGG 0: 1
1: 0
2: 0
3: 9
4: 83
1129294396_1129294407 29 Left 1129294396 15:74591929-74591951 CCCTCCAGGTTCTGCCTTCCAGG 0: 1
1: 0
2: 3
3: 52
4: 480
Right 1129294407 15:74591981-74592003 TTCACCAAGCTGAGGTTGTTTGG 0: 1
1: 0
2: 0
3: 10
4: 122
1129294396_1129294401 -8 Left 1129294396 15:74591929-74591951 CCCTCCAGGTTCTGCCTTCCAGG 0: 1
1: 0
2: 3
3: 52
4: 480
Right 1129294401 15:74591944-74591966 CTTCCAGGCCCCTAGAAGAGAGG 0: 1
1: 0
2: 3
3: 14
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129294396 Original CRISPR CCTGGAAGGCAGAACCTGGA GGG (reversed) Intronic
900343806 1:2201314-2201336 GCTCGAAGGCACAGCCTGGAAGG + Intronic
901362403 1:8713656-8713678 CCCGGGAGGCAGAGCCTGTAGGG + Intronic
901368322 1:8773746-8773768 CCTGGGAGGCAGAGACTGCAGGG + Intronic
901423579 1:9166791-9166813 CTGGGAAGGCGGATCCTGGAAGG + Intergenic
901459652 1:9383996-9384018 CCTGGGAGGCAGAGGCTGAAAGG - Intergenic
901752032 1:11416260-11416282 CCTGGAAGAGGGAACCTGGGTGG - Intergenic
901780729 1:11593030-11593052 CCAGGATGGCACAGCCTGGAAGG - Intergenic
901880801 1:12192683-12192705 CCTGGAAGGCAGGACTGGGTGGG + Intronic
902289079 1:15425095-15425117 CCTAGATGGCAGAACCTTGCAGG - Intronic
902571935 1:17352574-17352596 TCTGGAAGGCAGAGCCAGCAGGG + Intronic
903972016 1:27125083-27125105 TCTAGAAGGCAGAACCAGCAGGG - Intronic
904044892 1:27603186-27603208 CCTGGCAGGCAGCGCCGGGAAGG - Intronic
904375903 1:30082386-30082408 CTTTGAAGGCAGCTCCTGGACGG + Intergenic
904942072 1:34170885-34170907 TCTAGGAGGCAGAATCTGGAGGG - Intronic
905007458 1:34721333-34721355 GCTGGAAGGCAGAGGCTAGAGGG - Intronic
905774318 1:40658778-40658800 TCAGGAAGGCGGGACCTGGAGGG - Intronic
905879446 1:41454169-41454191 CCTGGAATGCATATTCTGGAAGG - Intergenic
905979550 1:42211274-42211296 CATGGAAGCCTGAATCTGGAGGG - Intronic
906203064 1:43972150-43972172 CGTGGAAGGGAGAGCCTGAAAGG - Exonic
906613269 1:47218173-47218195 CCTCGAAGGCAGAGCCTAGAGGG + Exonic
908511272 1:64851731-64851753 CCTGCTAGTCAGAATCTGGAAGG - Intronic
909492321 1:76239142-76239164 CCTTGAAGGAAGAATCTGAAGGG + Intronic
909695490 1:78464359-78464381 CATAGAATTCAGAACCTGGATGG - Intronic
909950323 1:81712221-81712243 TTTGGAAGGAAGGACCTGGATGG + Intronic
910434203 1:87188625-87188647 CTTGAAAGGAAGAATCTGGATGG - Intergenic
910820457 1:91339315-91339337 CCTAGAATTCAGAATCTGGATGG + Intronic
911196715 1:95002242-95002264 CCTGGGGGGGGGAACCTGGAAGG + Intronic
912214712 1:107595339-107595361 CCTTGAAAGCAGAAACTGAAAGG - Intronic
912573259 1:110640393-110640415 CCTGGGAGACAGGACATGGAGGG + Intergenic
912691135 1:111805354-111805376 CCTGGATGCCACAACCTGGGTGG + Intronic
913203167 1:116512668-116512690 CTTGGAAGGCTGAACCCGGGAGG + Intergenic
914384594 1:147156037-147156059 CATGGAATGCAGGACCTGGGAGG - Exonic
914964413 1:152241353-152241375 CCTGGGAGGCAGAGCTTGCAGGG + Intergenic
915735274 1:158080683-158080705 CCCGGGAGGAAGATCCTGGATGG - Intronic
915801049 1:158794069-158794091 CATGCAAGCCTGAACCTGGAGGG + Intergenic
915982202 1:160427241-160427263 CCTGGAAAACAGGGCCTGGATGG + Exonic
916581958 1:166116881-166116903 CCTAGAAGGCTGGAGCTGGAAGG - Intronic
916868753 1:168888798-168888820 CTTGTAAGCCTGAACCTGGAGGG - Intergenic
917121177 1:171645889-171645911 CCTGCAAGGCACAATCTGAAGGG - Intronic
917863085 1:179166699-179166721 CCTGGAAGGCAGAGGTTGCAGGG + Intronic
919887101 1:201942509-201942531 CCTTGGAGGGAGACCCTGGAGGG + Intronic
920531035 1:206702752-206702774 CCTGGAAGGCAAAGTGTGGAAGG - Intronic
920989411 1:210922304-210922326 CCTGGGAGGCAGAGCTTGCATGG + Intronic
921226962 1:213030183-213030205 CCTGGAAAGCAGAGCCAGGAGGG - Intergenic
921741088 1:218686002-218686024 CCTGGAAGGCGGAGCTTGCAGGG - Intergenic
922787930 1:228292514-228292536 CCTGGCAGGCAGAGCTGGGAAGG - Exonic
922976112 1:229784894-229784916 CCTGGCACACAGACCCTGGAAGG - Intergenic
923128355 1:231053063-231053085 CCTGGGAGGCAGAAGTTGCAGGG - Intergenic
924078463 1:240366657-240366679 CTTGGAAGGCTGAACTTGGAAGG - Intronic
924404607 1:243730078-243730100 GCTGGAATCCACAACCTGGAGGG + Intronic
1063542138 10:6944610-6944632 CATGGAAGGAAGAACCTTGAAGG + Intergenic
1063617153 10:7610266-7610288 CCTGGAAGCCAGGACCTGCCTGG - Intronic
1064429979 10:15262474-15262496 CCAGGAAGGCAGAACCGGGTAGG + Intronic
1065561874 10:26971877-26971899 TATGGAAGGCAGAAACTGCACGG - Intergenic
1065795449 10:29303291-29303313 CCAGGAAGGTAGAACCAGGCAGG - Intronic
1065918509 10:30371388-30371410 CCTGGAAGGCAGAGGCTGCAGGG + Intronic
1067679988 10:48427987-48428009 CCTGGAAGAAAAATCCTGGAAGG + Intronic
1068171884 10:53404615-53404637 CATGCAAGCCTGAACCTGGAGGG - Intergenic
1069876008 10:71563277-71563299 GCTGGAATGCAGGAGCTGGAAGG - Intronic
1070089248 10:73268767-73268789 CCTGGGAGGCAGAAGTTGCAGGG - Intronic
1070499281 10:77055326-77055348 CGAGGCAGCCAGAACCTGGAAGG + Intronic
1071462527 10:85912557-85912579 ACTGAAAGGCAGAGCCTGTAAGG + Intronic
1073287146 10:102395903-102395925 TCTGGGAAGCAGAACCTGGCCGG + Exonic
1074412593 10:113241368-113241390 TCTGGAAGACAGAGCCCGGAGGG + Intergenic
1075405003 10:122188940-122188962 CATGGAAGGCAGTACCTGGCTGG + Intronic
1075512196 10:123081524-123081546 CCTGGACAGCAGAACCTGGCTGG - Intergenic
1075915149 10:126160527-126160549 CCTGGAAGGGAGAGCTGGGAAGG - Intronic
1076112344 10:127871001-127871023 CATGCAAGCCTGAACCTGGAAGG + Intergenic
1076495378 10:130893714-130893736 CCTGCAAGGCAAAACCTCCACGG + Intergenic
1077017998 11:405441-405463 CCATGCAGGCAGATCCTGGATGG - Intergenic
1077021346 11:418453-418475 CATGGAAGGCAGAGGCTGGGTGG - Exonic
1077557029 11:3230800-3230822 CCGGGAAGGCAGACCATGGGTGG + Intronic
1078059749 11:8035552-8035574 CCTGGAAGACAGCCCATGGAGGG - Intronic
1078901963 11:15650355-15650377 CCCGGGAGGCAGCGCCTGGATGG + Intergenic
1079803934 11:24905450-24905472 CCTGGAAGGCAGAGGTTGCAGGG + Intronic
1079814455 11:25038619-25038641 ACTGGAATTCAGAATCTGGATGG - Intronic
1080008957 11:27438406-27438428 CTTGGCAGGCAGAAGCTGGGAGG + Intronic
1080822237 11:35818632-35818654 CCTGGAAAAGAGAACCAGGAGGG - Intergenic
1081657848 11:44869034-44869056 CCTAGTGGGCAGAACCTGGCTGG - Intronic
1081684757 11:45034489-45034511 CTTGGAAGGCACCACCTGGAAGG + Intergenic
1082067375 11:47911604-47911626 CCAAGAAGGCAGAGCCTGGAGGG + Intergenic
1082812864 11:57489170-57489192 CCTGGAAGGCAGGTGCTGGATGG + Intronic
1083771092 11:64867980-64868002 TCAGGAAGGCAGACCCTGTAAGG - Intronic
1084161921 11:67354837-67354859 CCTGGAAGGAAGAACCGGATGGG - Intronic
1084394147 11:68897894-68897916 CCTGGGAGACAGAAGCTAGAGGG - Intronic
1084457473 11:69276640-69276662 CTTGAGAGGCAGAAGCTGGAGGG - Intergenic
1086476296 11:87178499-87178521 CCTGGGAGGCAGAGGCTGCAGGG - Intronic
1087640772 11:100752151-100752173 CGTGCAAGCCTGAACCTGGAGGG + Intronic
1088303565 11:108384695-108384717 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
1088896112 11:114079726-114079748 CTCGGAAGGCAGATTCTGGAAGG + Intronic
1089353250 11:117833402-117833424 CCTGGATGGCAGGGACTGGAGGG - Intronic
1089776272 11:120838860-120838882 CCTGGGAGGCAGAGGTTGGAAGG - Intronic
1090142398 11:124278332-124278354 CATGGAATTCAGAATCTGGATGG + Intergenic
1090675064 11:128984297-128984319 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
1091968795 12:4768574-4768596 TCTGGAAGGCAGAACATCCAGGG + Intronic
1092615238 12:10210975-10210997 CCCGGAAGGGAGAACCCGGGAGG - Intergenic
1092743195 12:11649733-11649755 CCTGGAAGAGAGAAACTGAAAGG - Intergenic
1093107327 12:15104360-15104382 CCTGGGAGGCAGAGGCTGCAGGG - Intergenic
1093141566 12:15516064-15516086 CCTGGGAGGCAGAAGTTGCAGGG - Intronic
1093460372 12:19402454-19402476 CATGCAAGCCTGAACCTGGATGG + Intergenic
1094820576 12:34221000-34221022 CTTGGGAGGCTGAGCCTGGAGGG - Intergenic
1095777211 12:46023537-46023559 CATGGAAGCCTGAACCTGGAAGG + Intergenic
1096219501 12:49820225-49820247 CCTGGGAGGCTGCACCTGCACGG + Intronic
1096329725 12:50700276-50700298 CCTGGAAGTCAGAACAGGGGCGG + Intronic
1096897595 12:54839709-54839731 TGTGGAAGCCTGAACCTGGAGGG + Intronic
1098611445 12:72463413-72463435 ACTGGAAGGCAGAAATTGGCTGG + Intronic
1099163672 12:79275434-79275456 CTTGCAAGCCTGAACCTGGAGGG - Intronic
1101892047 12:108725909-108725931 CCTGGGAGGCAGAGGCTGCAGGG - Intronic
1101988122 12:109463164-109463186 CATCAAAGGCAGAACGTGGAAGG - Intronic
1102243122 12:111337957-111337979 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
1102959860 12:117085414-117085436 TCGGGAAGGCAGAAGGTGGAAGG + Intronic
1103388639 12:120553978-120554000 CCTGAGAGGCAGAAGCTGCAGGG - Intronic
1103970390 12:124667175-124667197 CCTGGAAAGGGGAACATGGAAGG + Intergenic
1104207446 12:126653479-126653501 CCTGGGAGGCAGAAGTTGCAGGG - Intergenic
1104312205 12:127663582-127663604 ACTGGAAGGCAGAACATCCATGG - Intergenic
1105324168 13:19355176-19355198 CATGGAAGGTAGAATCAGGAAGG + Intergenic
1105325880 13:19370416-19370438 CCTGGAAAGCAGACTCTGGATGG + Intergenic
1105392814 13:19996776-19996798 CTTGGGAGGCTGAAGCTGGAAGG + Intronic
1105745803 13:23375757-23375779 CCTGGCAGGCGGAGCCTGGTGGG - Intronic
1105867627 13:24474678-24474700 CCTAGAAAGCAGACTCTGGATGG - Intronic
1105869093 13:24488228-24488250 CATGGAAGGTAGAATCAGGAGGG - Intronic
1106164758 13:27233917-27233939 CCTGGGAGGCAGAAGTTGCAGGG + Intergenic
1106193593 13:27475030-27475052 CCTGGAACACAGACCCAGGAAGG + Intergenic
1106771739 13:32967995-32968017 CATGTAAGGCAGACCCTGGAAGG + Intergenic
1106902595 13:34369644-34369666 CGAGGAAGGAAGAACATGGAAGG + Intergenic
1106910792 13:34461513-34461535 TCTGCAAAGCAGAACCTGGAAGG - Intergenic
1107939554 13:45371794-45371816 CCTGGGAGGCAGAGGCTGCAGGG + Intergenic
1108140511 13:47416108-47416130 CCTGGAGGACAGAGCCAGGAGGG + Intergenic
1108935146 13:55873467-55873489 CCTGTAAGGTAAAACCTGGCAGG + Intergenic
1109976318 13:69837737-69837759 CCCAGAAGACAGAATCTGGATGG - Intronic
1112384872 13:98930363-98930385 ACTGGATGGGAGAAACTGGAGGG - Intronic
1114179514 14:20353836-20353858 TGTGGGAGGCAGAACTTGGATGG + Intronic
1114511540 14:23266064-23266086 CTTGGGAGGCTGAACCTGGGAGG - Intronic
1114938440 14:27574126-27574148 CATGGAATTCAGAATCTGGATGG + Intergenic
1114938596 14:27576530-27576552 TCTTGAAGGCAGAAGATGGATGG - Intergenic
1115403546 14:32991076-32991098 CTTGGAAGGCTGAAGCAGGAGGG - Intronic
1116050562 14:39797688-39797710 CCTGGAAGGCAGAGGTTGCATGG - Intergenic
1116611545 14:47079805-47079827 CCTGGAAGGCGGAGCTTGCAGGG - Intronic
1116693562 14:48142730-48142752 AATGGATGGCAGAAGCTGGAAGG - Intergenic
1119718844 14:76877490-76877512 CCTGGGAGGCAGAGCTTGCAGGG + Intergenic
1120292182 14:82589818-82589840 CCTGGGAGCCAGGACCTTGAGGG + Intergenic
1120723388 14:87911719-87911741 CCCTGAAGGCAGACTCTGGAAGG - Intronic
1121033229 14:90676870-90676892 CCTGGAAGTGTGAACCTAGAGGG + Intronic
1121329005 14:93038140-93038162 CTTGGGAGGCTGAACCTGGGAGG - Intronic
1121406967 14:93725082-93725104 CCTGGCAGGAGGACCCTGGAAGG + Intronic
1121484797 14:94306322-94306344 GCTGGAGGGCAGGAGCTGGAGGG - Intronic
1122521063 14:102344099-102344121 CCTCCAGGGCAGGACCTGGAAGG - Intronic
1122911841 14:104833609-104833631 CCTGGGAGGCAGAGCTTGCAGGG - Intergenic
1125380229 15:39079468-39079490 CATTGAAGGGAGATCCTGGAAGG - Intergenic
1126339465 15:47623193-47623215 CTTGGAAGGCAGGACCAGCATGG - Intronic
1126503416 15:49374617-49374639 CCTGGGAGGCGGAGCCTAGATGG - Intronic
1126851076 15:52797420-52797442 CCTGGAAGGAACAAACCGGAAGG + Intergenic
1127395722 15:58542512-58542534 CCTGGAAGACAGCAGCGGGATGG - Exonic
1128130393 15:65223504-65223526 CCTGGGAGGCAGAGCTTGCAGGG - Intergenic
1128290818 15:66477036-66477058 CCTGGGAGCCAGATCCCGGAGGG - Intronic
1128684764 15:69675648-69675670 CCTGAAAGGCAGAGCCTCGCAGG - Intergenic
1128994779 15:72288501-72288523 GCTGGACAGCAGAACCTGGTGGG - Intronic
1129294396 15:74591929-74591951 CCTGGAAGGCAGAACCTGGAGGG - Intronic
1129657164 15:77531892-77531914 GCTGGGAGGCAGATCCTGGGTGG + Intergenic
1129743929 15:78004946-78004968 CCTGAAAGGCAGCTCCTGGCTGG - Intronic
1130656296 15:85794235-85794257 CCTGGCAGGCGGAACGTGAACGG + Intronic
1131116933 15:89801645-89801667 CCTGGATGGCAGGGACTGGAGGG - Intronic
1132010115 15:98267978-98268000 CCTGGAAGGCAGCACAGAGATGG - Intergenic
1132637948 16:962474-962496 CCTGGCAGGCAGACCTTGGCCGG + Intronic
1133235683 16:4386380-4386402 CCTGGAAGGCAGGAAGTGGTGGG + Intronic
1133864222 16:9626793-9626815 CCTGCAAGGGAGACACTGGATGG + Intergenic
1134038861 16:11052618-11052640 CCTGGCAGGGAGGACATGGAAGG - Intronic
1134089388 16:11383588-11383610 CCTGGAAGGCAGATGCCAGACGG + Intronic
1134176142 16:12008017-12008039 CCTGGGAGGCAGAGCTTGCAGGG - Intronic
1134421486 16:14095110-14095132 CCTGAAAGGCAGTGCATGGAAGG + Intronic
1134863215 16:17579501-17579523 CCAGGAAGGGAGACCATGGAGGG + Intergenic
1135674881 16:24406856-24406878 CCTTGTGGGCAGAAACTGGAGGG - Intergenic
1135859144 16:26038977-26038999 CCTTGAAGGAAGAACCAGGCTGG - Intronic
1135954103 16:26941157-26941179 GCTGGAAGCCTGACCCTGGAGGG - Intergenic
1136251359 16:29007603-29007625 CCTGGGAGGCGGAGCCTAGATGG + Intergenic
1136479630 16:30533447-30533469 CAAGAAAGGCAGAACCAGGAGGG + Intronic
1136483408 16:30556406-30556428 CAAGAAAGGCAGAACCAGGAGGG + Intronic
1138637390 16:58352032-58352054 TCTGGTAGGCAGGACCTGGCTGG - Intronic
1138807472 16:60107762-60107784 CTTGCAAGGAAAAACCTGGAGGG + Intergenic
1139902088 16:70336024-70336046 TTTGGAAGGCCGAACCTGGGAGG + Intronic
1140607032 16:76551320-76551342 CCTGGGAGGCAAAAGCTGCAGGG + Intronic
1140632615 16:76872273-76872295 CATGAAAGGCAGAACATAGAGGG - Intergenic
1141127466 16:81411004-81411026 TCTGGAAGGAAGAACAGGGATGG - Intergenic
1141461279 16:84180028-84180050 CCTGGAAGGAAGAGACTGGGGGG + Exonic
1141766511 16:86063154-86063176 CCAGGAAGGCAGAACCCGAGGGG - Intergenic
1143015588 17:3889719-3889741 CCTGGGAGGAAAAACCTGGGTGG - Intronic
1143529898 17:7496658-7496680 CCTGGAGGGAGGAAACTGGAAGG + Intronic
1143544371 17:7587920-7587942 CCTGGAAGACTGAGTCTGGACGG + Exonic
1143949387 17:10620640-10620662 CCTGAGAATCAGAACCTGGAAGG + Intergenic
1144276388 17:13672444-13672466 CATGCAAGCCTGAACCTGGAGGG - Intergenic
1145111036 17:20161868-20161890 CCTGGGAGGCAGAAGTTGCAGGG - Intronic
1145725192 17:27114304-27114326 CCTGGGAGGCAGAGCTTGCAGGG + Intergenic
1145751933 17:27361463-27361485 TCTGGAAGGCAGAACAGTGATGG - Intergenic
1146275515 17:31513427-31513449 CCTGGAGGGGAGATGCTGGAAGG - Intronic
1147652808 17:42071892-42071914 CCTGGAAGCCAGAAGGAGGAGGG + Intergenic
1148088553 17:45009028-45009050 ACTGGAAGCCAGCAGCTGGATGG + Intergenic
1148265951 17:46225718-46225740 CCTGGATGAAAGAACCTCGAGGG - Intergenic
1148965078 17:51428129-51428151 GCTGGGAGCCAGAACCTGGGGGG + Intergenic
1150666133 17:67140166-67140188 GCTGGATGGAAGCACCTGGATGG + Intronic
1150677099 17:67254108-67254130 CCTGGAAGGCAGAGGTTGCAGGG - Intergenic
1150824999 17:68466485-68466507 CCTGGGAGGCAGAAATTGCAGGG - Intergenic
1151320312 17:73348846-73348868 CCTGGAAGGCAGACCCAGGAAGG - Intronic
1151517790 17:74607583-74607605 CATGGAGGGCAGAGCATGGAGGG + Intergenic
1151517814 17:74607681-74607703 CATGGAGGGCAGAGCATGGAGGG + Intergenic
1151635710 17:75346418-75346440 CCTGGGAGGCAGAAGTTGCAGGG + Intronic
1152318424 17:79594455-79594477 TGTGGGAGGCAGAGCCTGGAGGG - Intergenic
1152538138 17:80962081-80962103 CCCGGGAGACAGAGCCTGGATGG - Intronic
1152653375 17:81507285-81507307 CCTGGATGACAGAGCCAGGATGG + Intergenic
1153693046 18:7612977-7612999 GCAGGAGGGCAGGACCTGGAGGG + Intronic
1153811456 18:8755574-8755596 CCTGGAACTCAGAAGCTGCATGG - Intronic
1155092890 18:22528418-22528440 CCTGGAAAGCAGGACATGAATGG - Intergenic
1156274163 18:35566084-35566106 CCTGGGAGGTTGAACCTGGGAGG + Intergenic
1157173963 18:45433867-45433889 CCTGGAAGGGGGAAGATGGATGG + Intronic
1158333891 18:56393854-56393876 CCAGGAAGGCAGAGCATGGCAGG + Intergenic
1158675771 18:59516740-59516762 CTTGGAAGGCAGAATGTGGCAGG + Intronic
1160755370 19:754385-754407 CCTGGGAGGCAGAGCTTGCAGGG + Intronic
1161504127 19:4635035-4635057 CCTGGGAGGTTGAACCTGGGAGG - Intergenic
1161645748 19:5452254-5452276 CCTGGGAGGCAGAGCTTGCAGGG + Intergenic
1163168540 19:15514593-15514615 CCTGGGAGGCAGAAGTTGCAGGG + Intronic
1163297709 19:16422880-16422902 CCTGGGAGGCAGAAGTTGCAGGG + Intronic
1163303593 19:16463223-16463245 CCTGGTGGGCAGAGCCTGGTGGG - Intronic
1163513611 19:17749939-17749961 CCTGGAAGCCAGATCGTGGAAGG + Intronic
1163515257 19:17759014-17759036 CCTGGGAGGGTGAACCTGGTAGG + Intronic
1163551828 19:17969726-17969748 CCTGGCAGACAGAACCCAGAGGG - Intronic
1163695523 19:18761515-18761537 CTTGGAAGGCAGCACCAGGCAGG + Intronic
1163905256 19:20146734-20146756 TCTGGGAGGCTGAACCTGGGAGG + Intergenic
1164925799 19:32129104-32129126 CCTGGAAGGCAGAACTTGGTGGG - Intergenic
1165682485 19:37789702-37789724 CCCGGGAGGCAGAACCCGGGAGG + Intronic
1165731272 19:38147135-38147157 CCTGGGAGGCAGAAGTTGCAGGG - Intronic
1165834437 19:38745550-38745572 CCAGGGAGGCTGACCCTGGAGGG + Intronic
1166082408 19:40452249-40452271 GCTGGGAGGCAGAACCTGGCTGG - Intronic
1166354420 19:42218435-42218457 CCTGGAGGGCAGAGATTGGAAGG - Intronic
1166364195 19:42270238-42270260 CCTCACAGGCAGAGCCTGGAGGG - Intronic
1166570296 19:43791632-43791654 CCTGGAAGGCAGAGCTTGCAGGG - Intergenic
1166667868 19:44692130-44692152 CCTGGTGGGCAGAACTTGGGTGG - Intergenic
1166701725 19:44886065-44886087 CCTGGCAGGGAGAAGCTGGCTGG + Intronic
1166785246 19:45363515-45363537 CCTGGCAGGCAACACCTGGCTGG - Intronic
1167957097 19:53074592-53074614 CCTGGGAGGCAGAGCTTGCAGGG + Intronic
1168516420 19:57013337-57013359 CCTGGAAGGTACCCCCTGGATGG - Intergenic
925179383 2:1807089-1807111 TCTGGAAGGCAGAAACTGACAGG + Intronic
925397517 2:3546323-3546345 CCAGGAAGGCAGAACAAGGCAGG + Intronic
926172542 2:10561409-10561431 CCTGGAAGGCAGACCTAGCAAGG + Intergenic
927636196 2:24819063-24819085 CCTGGAAGGCAAGAGCTTGAAGG - Intronic
927680000 2:25132831-25132853 GCTGAAAGGCTGAACCAGGAGGG + Intronic
929474598 2:42233379-42233401 CCTGGGAGGCAGAGCTTGCAGGG - Intronic
929819268 2:45260303-45260325 CCTGAAAGGAAGAGGCTGGAAGG - Intergenic
930400834 2:50883929-50883951 CCAGGAAGGGAGCACCAGGATGG + Intronic
931334320 2:61323437-61323459 CCTGGGAGGCAGAGCTTGCAGGG + Intronic
931649361 2:64454363-64454385 CCTGGCAGGCAGAGCCTGGGAGG - Exonic
931823297 2:65973870-65973892 CCTGGAAGGGAAAACCCTGATGG + Intergenic
932252589 2:70257899-70257921 CATCGAAGGCAGAAGCTGGCCGG - Intronic
933280781 2:80330678-80330700 CCTGGAAGGCAGCTTCTGAAGGG - Intronic
933642658 2:84780598-84780620 CATAGAATTCAGAACCTGGATGG - Intronic
934679673 2:96274396-96274418 CCTGGGAGGCAGCACCAGAAAGG - Exonic
934715683 2:96542003-96542025 CCAGGCAGGCAGGACCTGCATGG - Intronic
935142613 2:100366691-100366713 CCTGGAAGGCAGAGGTTGCAGGG + Intergenic
935753505 2:106259662-106259684 CCTGGGAGGCAGAGCTTGTAGGG + Intergenic
937344322 2:121114979-121115001 CCTGGGAGGCAGAAGTTGCAGGG - Intergenic
937638062 2:124179233-124179255 CCTGGGAGGCAGAAGTTGCAGGG - Intronic
938083452 2:128382567-128382589 ACTGCTAGACAGAACCTGGAGGG + Intergenic
938114891 2:128596256-128596278 CCTGGCAGGAAGAATCTGGAGGG + Intergenic
938452377 2:131433385-131433407 CCTGGAAGGCGGAGCTTGCAGGG + Intergenic
938770178 2:134494974-134494996 CCTGGGAGGGAGAACCTGGGAGG - Intronic
939525422 2:143287890-143287912 CCTGAAAGGCATAGCCTGCAGGG - Intronic
940545271 2:155075502-155075524 GCTGAAAGGCAGATCTTGGAGGG - Intergenic
941651962 2:168101660-168101682 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
941918001 2:170824434-170824456 CCTGGAGGGATGGACCTGGAGGG + Intronic
944438417 2:199716506-199716528 CGTGGAAGGCATATCCTGAAAGG + Intergenic
945261080 2:207843973-207843995 CCTGGGAGGCTGAGGCTGGAGGG + Intronic
945305363 2:208254690-208254712 CCTGGGAGGGAGAAACTGGGCGG - Intronic
945309511 2:208294877-208294899 GCTGGAAGCCAGAAGCCGGAGGG + Intronic
946102070 2:217334188-217334210 CCTGGGAGGCAGAATTTGCAGGG - Intronic
946984347 2:225255551-225255573 CTTGCAAGGCACAAACTGGAAGG + Intergenic
947282213 2:228468268-228468290 CCTGGAAGGCGGAGCTTGCAGGG - Intergenic
947359615 2:229334072-229334094 CTTGGGAGGCTGAACCTGGGAGG - Intergenic
947617647 2:231568715-231568737 CCTGGAAGGCTAACTCTGGAAGG - Intergenic
947666524 2:231909462-231909484 CTTGGGAGGCTGAACCTGGGAGG - Intergenic
947672990 2:231952205-231952227 CCTGGGAGGCAGAAGTTGCAGGG + Intergenic
947686826 2:232094641-232094663 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
947858922 2:233345058-233345080 CCTGGAAGCCAGCACTGGGAGGG - Intronic
948049613 2:234969656-234969678 CCTGGCAGGCTGGACTTGGAGGG + Intronic
948414598 2:237793623-237793645 CTTGGGAGGCTGAACCTGGGAGG + Intronic
948489703 2:238304581-238304603 CCTGCAAAGCACAACATGGAGGG + Intergenic
948563146 2:238867141-238867163 CCTCGAAGCCAGCAGCTGGAGGG + Intronic
1169153698 20:3311246-3311268 CTTGGAAGGCTGAGACTGGAGGG - Intronic
1169889255 20:10434759-10434781 CCTGGAACCCAGAAGCAGGATGG - Intergenic
1170575726 20:17660010-17660032 CTTCGAAGTGAGAACCTGGATGG + Exonic
1171333903 20:24365907-24365929 CCTGTAAGCTAGAACCTGGAAGG + Intergenic
1171429732 20:25074828-25074850 TCTGGGAGGCAGAACCTGTGTGG + Intronic
1172198902 20:33111631-33111653 CCTGGCAGGCTGACCATGGAAGG - Exonic
1172444553 20:34986222-34986244 GGTGGGAGTCAGAACCTGGAGGG + Intronic
1173120230 20:40282377-40282399 CCTGGAAGGAGGCAGCTGGAAGG - Intergenic
1173464088 20:43267645-43267667 CCTGTGAGGCAGCTCCTGGAAGG - Intergenic
1174187663 20:48718168-48718190 CCTGAATGTCAGAGCCTGGAGGG - Intronic
1175507124 20:59494001-59494023 CCTGAAAGCCAGAGCCTGGTTGG - Intergenic
1175531823 20:59678791-59678813 CCTGGCTGGGAGCACCTGGAGGG + Intronic
1175563522 20:59953859-59953881 CATGGCAGGCAGAAGCTGGAAGG - Intergenic
1175618074 20:60420449-60420471 CATAGAAGCCTGAACCTGGAGGG + Intergenic
1176024211 20:62977587-62977609 CCTGGAAAGCAGGGCCCGGAGGG + Intergenic
1176153348 20:63604878-63604900 CCCGGAGGGCACAACCTGCAGGG + Intronic
1176191311 20:63811407-63811429 CCTGGAAGTCAGAAGCTGGGAGG - Intronic
1176249554 20:64113930-64113952 CCTGGCAGGCAGGACATGGCAGG - Intergenic
1177361575 21:20078837-20078859 CCTGGGAGGCAGAACTTGCAGGG + Intergenic
1179126532 21:38595776-38595798 CCTGGAGGGCAGAACCTCGCTGG + Intronic
1179163866 21:38919921-38919943 CCAGGAAGGAAGAAACTGGTGGG - Intergenic
1179332849 21:40422166-40422188 CCTGGAATGCAGAACTGAGAAGG - Intronic
1179572582 21:42286709-42286731 CATGGAGGTGAGAACCTGGAGGG + Intronic
1179779514 21:43690419-43690441 CCTGGACGGCAGGGCCTGGAGGG - Exonic
1180674453 22:17577654-17577676 CCTGGGAGGCAGAACTTGCAGGG - Intronic
1182202323 22:28586201-28586223 CCTGGGAGGCAGAGCTTGCAGGG + Intronic
1182453261 22:30433595-30433617 CCTGGAAGGCACAGGTTGGAAGG - Intergenic
1183220092 22:36506763-36506785 TCTGGAAGGTCCAACCTGGAGGG - Intronic
1183290338 22:36998227-36998249 ACTGGAAGGCAGGATCTGGAAGG + Intronic
1184146921 22:42617197-42617219 CCTGGGAGGCAGAGGCTGCAGGG + Intergenic
1184974478 22:48051383-48051405 CCTGGGAGGCAGAAGTTGCAGGG + Intergenic
1185013212 22:48327992-48328014 CCAAGAAGCCAGAATCTGGAGGG - Intergenic
949211739 3:1511380-1511402 CGTGGGAGGCAGAGGCTGGATGG - Intergenic
949971148 3:9406012-9406034 CTTAGAAGGAAGAACCTGGAAGG + Intronic
950106770 3:10393523-10393545 CCAGGAAGGCAGAGCTGGGATGG + Intronic
954131340 3:48562730-48562752 CCTGGATGGGAAGACCTGGAGGG - Exonic
954504250 3:51053495-51053517 CCTGGGAGGCAGAGCTTGCAGGG - Intronic
954540315 3:51389394-51389416 ACTGGAAAGCAGAAACTGGTAGG - Exonic
954616906 3:51973828-51973850 TCTGGAAGGGAGCACCGGGAGGG + Intronic
954972869 3:54665825-54665847 CCTGGGTGGCGGAACCTGGGTGG - Intronic
954973028 3:54667378-54667400 CCTCCAAGGCAGAGGCTGGAAGG + Intronic
954988069 3:54813271-54813293 CCAGCAAGGCAGAGCCTGGTTGG + Intronic
955320329 3:57969937-57969959 CCTGGAAGGCAGGATGAGGAGGG - Intergenic
955376255 3:58399781-58399803 CCTGGAGGGCAGACCCTTCAAGG - Intronic
956212221 3:66813848-66813870 CCTGGGAGGTTGAACCTGGGAGG + Intergenic
956472285 3:69579859-69579881 CCCTGAAGACAAAACCTGGAGGG - Intergenic
957254912 3:77824813-77824835 CATGGAATTCAGAATCTGGATGG - Intergenic
959494308 3:107031278-107031300 CATGGAATTCAGAATCTGGATGG + Intergenic
960011002 3:112834675-112834697 CCTGGCAGGCAGCACTTGGCTGG + Intronic
960364322 3:116752495-116752517 CCTGGGAGGCAGAGCTTGCAGGG - Intronic
962201539 3:133404372-133404394 CCTGGGTGGCAGCAACTGGAGGG + Intronic
963442265 3:145355463-145355485 ATTGGAAGGCAGAGTCTGGATGG + Intergenic
963590692 3:147254349-147254371 CCTGGAAGTCAGAGTCAGGAGGG - Intergenic
964564216 3:158032142-158032164 CATGTAAGCCTGAACCTGGAGGG - Intergenic
966855830 3:184193343-184193365 GCTGGAAGGCAGAACCAGGAAGG - Exonic
968030057 3:195475956-195475978 CCTGGGAGGCTGAAGCGGGAGGG - Intergenic
968091258 3:195899791-195899813 CCCTGAAGGGAGAACCTGGCAGG + Intronic
968338886 3:197937841-197937863 ACTGGAAGCCAGAAGCTTGAGGG + Intronic
968357555 3:198121010-198121032 CCTGCAAGGCAGAAGCTGTCTGG + Intergenic
968605326 4:1532595-1532617 CCTGGCAGGCTGGACCTGGGTGG - Intergenic
969701092 4:8768182-8768204 CCTGGAGGTCAGCTCCTGGAGGG + Intergenic
969905757 4:10394241-10394263 CCTTGAAGACAGAAGTTGGATGG + Intergenic
970233310 4:13933145-13933167 GTTGGAAGGCAGAAGCAGGAGGG + Intergenic
971372061 4:26027759-26027781 GCTGGAAGGCAGAGTCTGGTTGG + Intergenic
971501261 4:27320263-27320285 CCTTCAAGGCAGTACCTGCATGG - Intergenic
972678151 4:41280093-41280115 CCTGGAAGGCGGAAGGTGGAAGG - Intergenic
972832507 4:42831296-42831318 TGTGGAAGGCAGGACCTGGTGGG - Intergenic
973688093 4:53395411-53395433 CCGGGAAGGAGGAACCGGGAAGG - Intronic
974856432 4:67466474-67466496 CATGCAAGCCTGAACCTGGAGGG - Intergenic
975173020 4:71254789-71254811 CATGTAAGGCTGAAACTGGAGGG + Intronic
977234308 4:94488876-94488898 CCTGTAAGGCAGATCCTTTACGG - Intronic
977645363 4:99405741-99405763 CCTGAAAGGCCCAAACTGGATGG + Intergenic
977736362 4:100421277-100421299 GCTGGAAGGCAGATCCGGGTAGG - Exonic
978523388 4:109639609-109639631 CCTGGGAGGTAGAACTTGCAGGG + Intronic
979275310 4:118809047-118809069 CCTGGGAGGCAGAGCTTGCAGGG - Intronic
979531621 4:121774453-121774475 CCAGCAAGGCAGAAGGTGGAAGG - Intergenic
981200722 4:141976199-141976221 CCTGGGAGGCAGAGCTTGCAGGG + Intergenic
981748012 4:148069367-148069389 CCTGGAAGGCAGAAGCCAGTAGG - Intronic
981923741 4:150116141-150116163 CGTGCAAGCCTGAACCTGGAGGG + Intronic
982229214 4:153193205-153193227 CCTGGGAGGCAGAGCTTGCAGGG - Intronic
983614204 4:169683817-169683839 CCTGGAAGGCAGAGGTTGCAGGG - Intronic
983820947 4:172193019-172193041 CCTGGAATGAAGCACCTGGGTGG + Intronic
984956301 4:185049421-185049443 CCTGGAAAGCAGAGCCAGGAGGG - Intergenic
985102854 4:186475420-186475442 TCTCGCAGGCAGACCCTGGAGGG + Intronic
985365889 4:189232424-189232446 CGTAGAATGCAGAACCTGAATGG - Intergenic
985684410 5:1274232-1274254 CCTGGAAGGCAGTAACAGGAAGG + Intronic
985876455 5:2602323-2602345 CCTGGAAGGACGAATCTGGTTGG - Intergenic
985988547 5:3537122-3537144 CCTGGAAGGATAATCCTGGAAGG + Intergenic
986860337 5:11920115-11920137 CCTAGAAGGAAGACCATGGAAGG - Intergenic
987137508 5:14913639-14913661 CCTGGAAGGCTGGAACTGGAAGG + Intergenic
989445533 5:41524328-41524350 ACTGGAAGGCAGGAAGTGGAAGG - Intergenic
990761968 5:59139575-59139597 CTTGGGAGGCAGAGCCTGGGAGG - Intronic
992332059 5:75727713-75727735 CCTGCAAGGTAGAAACTGAAAGG - Intergenic
992432147 5:76719511-76719533 CCTGGAAGGCAGAGGTTGCAGGG + Intronic
992444898 5:76824434-76824456 CTTGGGAGGCTGAACCTGGGAGG - Intronic
994023400 5:95053820-95053842 GCTGAAAAGCAGAACCTTGAAGG + Intronic
994508663 5:100675152-100675174 CCTGGAAGGCGGAGGCTGCAGGG - Intergenic
994899785 5:105757077-105757099 CCTGGAAGGCTGAGGCAGGATGG + Intergenic
996568707 5:124909429-124909451 CTTCAAAGGCAGAGCCTGGATGG + Intergenic
997325855 5:133020366-133020388 CCTGGGAGGCAGAGGCTGCAAGG + Intronic
998008365 5:138672719-138672741 CTTGGAAGGCTGAGCCTGGGAGG + Intronic
998605925 5:143634509-143634531 CCTGGGAAGAAGAACCAGGATGG + Intergenic
999260971 5:150238847-150238869 TCTGGAAGGCAGAGCCTGTGAGG - Intronic
999394015 5:151215077-151215099 CCTGGCAGGCAGGACCCTGAAGG + Intronic
999403299 5:151284196-151284218 TTTGAGAGGCAGAACCTGGAGGG + Exonic
1000072963 5:157758188-157758210 CCTGGGAGGCAGAAGTTGCAGGG - Exonic
1001278226 5:170366386-170366408 CCTGGAAGGGAGAAGCTGGCTGG + Intronic
1001625153 5:173126214-173126236 CCTGGGAGGCAGAGGCTGCAGGG - Intronic
1001959117 5:175869664-175869686 CCTGGAAGAAAGAACACGGAGGG - Intronic
1002294621 5:178223502-178223524 CCTGTAAGGCAGAATATGGTTGG - Intronic
1002399863 5:178985625-178985647 CCCGGAAGGCAGAGCTTGCAGGG + Intronic
1002641608 5:180633123-180633145 CCTGGGACGCAGCACCAGGACGG + Intronic
1003221366 6:4163729-4163751 GCTGGAAGACAGCAGCTGGAGGG + Intergenic
1003941230 6:11029150-11029172 CCTGGGAGGCGGAAGCTGTAGGG + Intronic
1003991441 6:11490457-11490479 ACTGGAAGGTAGGTCCTGGAGGG + Intergenic
1004547921 6:16616462-16616484 CCTGGGAGGCAGAGGCTGCAGGG + Intronic
1005354959 6:24973519-24973541 CCTGGAAGGCAGAGATTGCAGGG + Intronic
1005622074 6:27629312-27629334 CCTGGAAGGCAGAGGTTGCAGGG + Intergenic
1007119750 6:39370002-39370024 ACTGGAAGGCTGCCCCTGGAGGG - Intronic
1007309441 6:40933815-40933837 CCTGGAAAGTAGCACCTGAAAGG - Intergenic
1007646314 6:43384322-43384344 CCTGGGAGGCAGAGCTTGCAGGG - Intergenic
1007703157 6:43775953-43775975 TCTGGAAAGCAGACCTTGGAGGG + Intronic
1009614861 6:65991033-65991055 TCTGCAAGCCTGAACCTGGAGGG - Intergenic
1010213655 6:73382942-73382964 CTTGGAAGGCTGAGCCTGGGAGG - Intronic
1011316931 6:86044370-86044392 CCTGGGAGGCAGATCTTGCAGGG - Intergenic
1011693164 6:89888034-89888056 CCTGGAAGGCGGGGCCTGTAGGG + Intergenic
1011860218 6:91746035-91746057 CCTGGGATGAAGAACTTGGATGG - Intergenic
1012373786 6:98537170-98537192 CCTGGGAGGCAGAAGTTGCAGGG + Intergenic
1012797441 6:103780535-103780557 CCTGGAAGGCTTTACATGGAAGG - Intergenic
1013824764 6:114197965-114197987 CATGGAATTCAGAATCTGGATGG + Intronic
1014021299 6:116593507-116593529 CCTGGAGGCTAGAATCTGGATGG - Exonic
1015688778 6:135896822-135896844 GCTGGAAGGAAGGAGCTGGAAGG - Intronic
1016498225 6:144689151-144689173 CATGTAAGCCTGAACCTGGAAGG + Intronic
1017334798 6:153243497-153243519 GATGGAAGGTAGAGCCTGGAAGG - Intergenic
1017375268 6:153761110-153761132 CATGCAAGCCTGAACCTGGAGGG - Intergenic
1017670651 6:156766596-156766618 CAAGGAAGGAAGAAACTGGAAGG - Intergenic
1018145072 6:160878047-160878069 CATGGAATTCAGAATCTGGACGG + Intergenic
1019506183 7:1392686-1392708 CCTGGGAGCCAGGGCCTGGAGGG + Intergenic
1019558884 7:1646103-1646125 CCTGGGAGGCAGAGGCTGCAGGG - Intergenic
1020166973 7:5814922-5814944 CCTGGGAGGCAGAGGCTGCAGGG + Intergenic
1020450351 7:8314875-8314897 CATGCAAGCCTGAACCTGGAGGG + Intergenic
1020718985 7:11717456-11717478 CATGGAAAGCAGAAAATGGAGGG - Intronic
1021568478 7:22038717-22038739 CCTGAAAAGCAGAAGCTGCAGGG - Intergenic
1022021468 7:26403448-26403470 CCTGGGAGGCAGAAGTTGCAGGG - Intergenic
1023009701 7:35915638-35915660 ACAGGAAGCCAGGACCTGGAAGG - Intergenic
1023413580 7:39911046-39911068 CATGCAAGGCTAAACCTGGAGGG - Intergenic
1023510276 7:40945397-40945419 CATGCAAGCCTGAACCTGGAGGG + Intergenic
1024081131 7:45855943-45855965 ACAGGAAGCCAGGACCTGGAAGG + Intergenic
1024318931 7:48046097-48046119 CCTGGGACGCAGGGCCTGGAGGG + Intronic
1024452627 7:49564732-49564754 CATAGAATGCAGAATCTGGATGG + Intergenic
1024962649 7:54993955-54993977 CCTGGGAGGCAGAGCTTGCAGGG - Intergenic
1025123365 7:56325827-56325849 ACAGGAAGCCAGGACCTGGAAGG - Intergenic
1026894747 7:74003490-74003512 CCTGGAAAGAAGATTCTGGAAGG - Intergenic
1027201897 7:76069251-76069273 CCTGGAAGGCAGGAGCTAGAGGG - Intergenic
1027780997 7:82520318-82520340 TCTGGAAGACAGAAAGTGGATGG + Intergenic
1027994944 7:85413931-85413953 CAGGGCAGGCAGAATCTGGAGGG - Intergenic
1028550557 7:92057721-92057743 CCTTCAAAGCAGAACCTGGCAGG - Intronic
1029650180 7:101886166-101886188 TATGGAAGGCAGACCCTGTAGGG - Intronic
1029973191 7:104809435-104809457 CCTCAAAGGCAGAACGTGGATGG - Intronic
1030512858 7:110506103-110506125 CCTGGAAGACTGAAACTGGGTGG - Intergenic
1030808565 7:113946375-113946397 CATGCAAGCCTGAACCTGGAGGG - Intronic
1032263768 7:130356333-130356355 CCTGGAAGCCATAACCTGACAGG - Intronic
1033058688 7:138084336-138084358 CCTGGGAGGCAGAATTTGCAGGG - Intronic
1034227365 7:149494404-149494426 CCTAGAAGGTCGAACCGGGATGG - Exonic
1034655423 7:152725656-152725678 CCTGGAAGGTAGAGGCTGCAGGG - Intergenic
1035215357 7:157362299-157362321 CCTGGGAATCAGAACATGGAAGG + Intronic
1035388660 7:158490608-158490630 CCTGGACACCAGAACCGGGAGGG + Intronic
1035470497 7:159106126-159106148 CCTGGAAGCCAGGACCTCGGTGG + Intronic
1035579495 8:731219-731241 CCAGGAGGGCGGAACCCGGAAGG - Exonic
1035646064 8:1222051-1222073 CATGGAATTCAGAATCTGGATGG - Intergenic
1037475849 8:19256939-19256961 CCTGGAAGGCAGAGGTTGCAGGG + Intergenic
1037616148 8:20520498-20520520 CCTGGAAGGCAATACCAGGAAGG - Intergenic
1037858007 8:22385345-22385367 CCAGGAGGGCAGAGACTGGAGGG - Intronic
1038367744 8:26953708-26953730 ACTGGCAGGGAGAACTTGGAAGG + Intergenic
1038473242 8:27843282-27843304 CCTGGAAGGCAGAAATGAGATGG + Intergenic
1039440153 8:37589435-37589457 AGTGGAAGGCAGCAGCTGGAGGG - Intergenic
1040388842 8:46932869-46932891 GCTGGAAGGCAGATCCTGGTGGG - Intergenic
1040598930 8:48865497-48865519 CCTGGAAGGCAGAGGCCTGAGGG + Intergenic
1040645249 8:49389520-49389542 TCAGGAAGGCAGGACTTGGATGG - Intergenic
1042107246 8:65341341-65341363 CCTGGGAGGTAGAACCCGGGAGG - Intergenic
1042557048 8:70042541-70042563 CCAGGCAGCCAGAGCCTGGAGGG + Intergenic
1043655547 8:82661124-82661146 TCTCGAAGGCAGAAGATGGATGG + Intergenic
1043968226 8:86503274-86503296 CCTGGAAGGCAGAGGTTGCAGGG + Intronic
1044776298 8:95692576-95692598 ACTAGATGCCAGAACCTGGATGG + Intergenic
1045064241 8:98431472-98431494 CCTGGAAGGCATAACATTTACGG + Exonic
1046180898 8:110646105-110646127 CATAGAATTCAGAACCTGGATGG + Intergenic
1047022218 8:120786569-120786591 CATGCAAGCCTGAACCTGGAGGG - Intronic
1047375637 8:124293557-124293579 CCTATAAGGCATAACCTGGAAGG + Intergenic
1047634243 8:126743457-126743479 CATGCAAGCCTGAACCTGGAGGG + Intergenic
1047681071 8:127254580-127254602 CCTGGAAGGCAGAGGCTGCAGGG + Intergenic
1047936034 8:129779447-129779469 ACTGGAAGGTAGAGCATGGAGGG + Intronic
1048321315 8:133402558-133402580 CCTGGAAGCCAAGACATGGAGGG + Intergenic
1048553428 8:135454804-135454826 CTGGGAAGGCAGAACCAGGAAGG + Intergenic
1048849268 8:138629230-138629252 CCTGGGAGGCAGAGACTGCAGGG - Intronic
1048937219 8:139367291-139367313 TCTGGGACGCACAACCTGGAAGG - Intergenic
1049067637 8:140330001-140330023 CCTGGGAGGCAGAAGTTGCAGGG + Intronic
1049477559 8:142803821-142803843 CCTGTAAGGCAGGTCCTGTAGGG + Intergenic
1049540906 8:143208344-143208366 CCTGGAAGGCAGGAACTTGATGG - Intergenic
1049614175 8:143569064-143569086 CCTGGGAGGGAGAAACTGGAGGG + Intronic
1049614262 8:143569289-143569311 CCTGGGAGGGAGAGACTGGAAGG + Intronic
1049614294 8:143569364-143569386 CCTGGGAGGGAGAGACTGGAAGG + Intronic
1050476300 9:6044976-6044998 CATGCAAGTCTGAACCTGGAGGG + Intergenic
1050827983 9:9973362-9973384 CTTGGAAGGCTGAAGCCGGAGGG + Intronic
1051145097 9:14018806-14018828 CCTGGAACATAGAACCTGTATGG + Intergenic
1051777326 9:20650208-20650230 CCTGGAGGGCAGAAAGTGGGAGG + Intergenic
1052926641 9:34022509-34022531 CCTGGAAGGCAGAAGTTGCTGGG - Intronic
1053426952 9:38016428-38016450 CATGGAGGCGAGAACCTGGAGGG + Intronic
1055196104 9:73596158-73596180 CCTGGACGGCAGAATCCAGATGG - Intergenic
1055815126 9:80195862-80195884 GTTGGAAGGCAGAACAAGGAAGG - Intergenic
1055852089 9:80644247-80644269 CCTGGGAGGCTGAATCTGGGAGG - Intergenic
1056266534 9:84902118-84902140 CCTGGGAGTCAGAAGCTGCAGGG + Intronic
1057842856 9:98500410-98500432 CCTGGAAGGGAGCCCCAGGAGGG + Intronic
1059685669 9:116633386-116633408 CCTGGAAGGGGAAACCTGGCTGG + Intronic
1061762327 9:132859342-132859364 CCTGGGAGGCTGAGCCTGGGAGG - Intronic
1062059310 9:134486419-134486441 CATGGAAGGCAGAGCCGGGCTGG + Intergenic
1062322394 9:135996802-135996824 GCTGGAAGCCAGAACATGGAGGG - Intergenic
1062470601 9:136701934-136701956 CCTGGAAGCCCTAACCTGCAAGG - Intergenic
1062741403 9:138177500-138177522 CCTGCAAGGCAGAAGCTGTCTGG + Intergenic
1185972707 X:4682297-4682319 CCTGGGAGGCAGAGGCTGCACGG + Intergenic
1187158601 X:16744172-16744194 ACTGGAGGGCAGAGCCTGAATGG - Intronic
1187393340 X:18900264-18900286 CCTGGAAGGAAAAACATGTAAGG - Intronic
1188094358 X:26003401-26003423 CCTGCAAGCCTGAACCTGGAGGG - Intergenic
1188870550 X:35365685-35365707 TGTGGAAGCCTGAACCTGGAGGG - Intergenic
1191717170 X:64201735-64201757 CCTGGCAGGTAGAACCAAGAGGG - Intronic
1192886169 X:75337045-75337067 CATGTAAGCCTGAACCTGGAGGG + Intergenic
1192905464 X:75546243-75546265 CATGCAAGCCTGAACCTGGAGGG + Intergenic
1193460865 X:81789830-81789852 CATGCAAGCCTGAACCTGGAGGG + Intergenic
1193979791 X:88168359-88168381 CCTAGAATTCAGAATCTGGATGG - Intergenic
1194090056 X:89574810-89574832 CATGCAAGGCTGAACCTGGAGGG + Intergenic
1194556752 X:95369107-95369129 CGTGAAAGCCTGAACCTGGAGGG - Intergenic
1194758173 X:97762538-97762560 GCTGGAAGGAAGAACCTGTTGGG - Intergenic
1195088060 X:101431617-101431639 CCCGGAAGGCAGAGCTTGCAGGG - Intronic
1196375640 X:115029640-115029662 TTTGGAATGCAGAACATGGAGGG + Intergenic
1196496585 X:116330469-116330491 CATAGAAGTCAGAATCTGGATGG + Intergenic
1197258658 X:124292295-124292317 ATTGGAAGGGAGAACATGGAAGG - Intronic
1199978068 X:152905877-152905899 CCTGGAGGGGAGTCCCTGGAGGG - Intergenic
1199983006 X:152931362-152931384 CTTGGGAGGTTGAACCTGGAAGG - Intronic
1200084309 X:153595883-153595905 CTTGGAAGGAAGTACCTGGATGG - Intronic
1200161578 X:154012514-154012536 CCTGGGCGGCAGCACCTGGGAGG + Exonic
1200216173 X:154369152-154369174 CCCAGCAGGCAGCACCTGGAGGG + Intronic
1200442704 Y:3230864-3230886 CATGCACGGCTGAACCTGGAGGG + Intergenic
1200824899 Y:7627364-7627386 TCTGGAAGGCAGGATATGGACGG - Intergenic
1201784875 Y:17764286-17764308 CCTGGAAGGCAGAGGCTGCAGGG - Intergenic
1201816677 Y:18141701-18141723 CCTGGAAGGCAGAGGCTGCAGGG + Intergenic
1201853441 Y:18514867-18514889 CCTGGAAGGCAGAGGCTGCTGGG + Intergenic
1201879880 Y:18805517-18805539 CCTGGAAGGCAGAGGCTGCTGGG - Intronic
1202194472 Y:22284505-22284527 CCTGAAATCCAGAACATGGAGGG - Intergenic
1202235156 Y:22703723-22703745 TCTGGAAGGCAGGATATGGACGG + Intergenic
1202308003 Y:23492445-23492467 TCTGGAAGGCAGGATATGGACGG - Intergenic
1202344692 Y:23909107-23909129 CCTGGAAGGCAGAGGCTGCAGGG - Intergenic
1202526076 Y:25760976-25760998 CCTGGAAGGCAGAGGCTGCAGGG + Intergenic
1202562798 Y:26178141-26178163 TCTGGAAGGCAGGATATGGACGG + Intergenic