ID: 1129295808

View in Genome Browser
Species Human (GRCh38)
Location 15:74599457-74599479
Sequence CTGAAGGCGCAGATGGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 360
Summary {0: 1, 1: 0, 2: 5, 3: 41, 4: 313}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129295797_1129295808 19 Left 1129295797 15:74599415-74599437 CCTCCACGGTACCAAGGACCCCT 0: 1
1: 0
2: 0
3: 8
4: 108
Right 1129295808 15:74599457-74599479 CTGAAGGCGCAGATGGAGGGAGG 0: 1
1: 0
2: 5
3: 41
4: 313
1129295803_1129295808 -4 Left 1129295803 15:74599438-74599460 CCTTTAAGAAACTGCTTCACTGA 0: 1
1: 0
2: 0
3: 19
4: 260
Right 1129295808 15:74599457-74599479 CTGAAGGCGCAGATGGAGGGAGG 0: 1
1: 0
2: 5
3: 41
4: 313
1129295800_1129295808 1 Left 1129295800 15:74599433-74599455 CCCCTCCTTTAAGAAACTGCTTC 0: 1
1: 0
2: 1
3: 21
4: 221
Right 1129295808 15:74599457-74599479 CTGAAGGCGCAGATGGAGGGAGG 0: 1
1: 0
2: 5
3: 41
4: 313
1129295796_1129295808 20 Left 1129295796 15:74599414-74599436 CCCTCCACGGTACCAAGGACCCC 0: 1
1: 0
2: 0
3: 13
4: 98
Right 1129295808 15:74599457-74599479 CTGAAGGCGCAGATGGAGGGAGG 0: 1
1: 0
2: 5
3: 41
4: 313
1129295794_1129295808 25 Left 1129295794 15:74599409-74599431 CCTGTCCCTCCACGGTACCAAGG 0: 1
1: 0
2: 0
3: 9
4: 117
Right 1129295808 15:74599457-74599479 CTGAAGGCGCAGATGGAGGGAGG 0: 1
1: 0
2: 5
3: 41
4: 313
1129295802_1129295808 -1 Left 1129295802 15:74599435-74599457 CCTCCTTTAAGAAACTGCTTCAC 0: 1
1: 0
2: 0
3: 14
4: 172
Right 1129295808 15:74599457-74599479 CTGAAGGCGCAGATGGAGGGAGG 0: 1
1: 0
2: 5
3: 41
4: 313
1129295799_1129295808 8 Left 1129295799 15:74599426-74599448 CCAAGGACCCCTCCTTTAAGAAA 0: 1
1: 0
2: 1
3: 23
4: 205
Right 1129295808 15:74599457-74599479 CTGAAGGCGCAGATGGAGGGAGG 0: 1
1: 0
2: 5
3: 41
4: 313
1129295801_1129295808 0 Left 1129295801 15:74599434-74599456 CCCTCCTTTAAGAAACTGCTTCA 0: 1
1: 0
2: 1
3: 31
4: 285
Right 1129295808 15:74599457-74599479 CTGAAGGCGCAGATGGAGGGAGG 0: 1
1: 0
2: 5
3: 41
4: 313
1129295798_1129295808 16 Left 1129295798 15:74599418-74599440 CCACGGTACCAAGGACCCCTCCT 0: 1
1: 0
2: 0
3: 9
4: 99
Right 1129295808 15:74599457-74599479 CTGAAGGCGCAGATGGAGGGAGG 0: 1
1: 0
2: 5
3: 41
4: 313

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129295808 Original CRISPR CTGAAGGCGCAGATGGAGGG AGG Intronic
900313851 1:2047647-2047669 CTGATGCCGCCGGTGGAGGGGGG - Intergenic
900383039 1:2394782-2394804 CCGAGGGAGCAGATGGGGGGTGG + Intronic
900384144 1:2401692-2401714 TTGCAGCCGCAGATGGAGTGTGG + Intronic
900975194 1:6012239-6012261 ATGAAGGCGGAGGTGGTGGGTGG + Intronic
900975239 1:6012413-6012435 ATGAAGGCGGAGGTGGTGGGTGG + Intronic
900975271 1:6012535-6012557 ATGAAGGCGGAGGTGGTGGGTGG + Intronic
900975290 1:6012608-6012630 ATGAAGGCGGAGGTGGTGGGTGG + Intronic
901137381 1:7006762-7006784 CTTAGGGCTCAGATGGAGAGAGG - Intronic
901527914 1:9835685-9835707 CTGAAGGGGCAGCAGGAGGGAGG + Intergenic
901792494 1:11661692-11661714 CTGATGGTGCAGGTGCAGGGAGG + Exonic
902077013 1:13795379-13795401 CTGAAGTCACAGATGGTAGGAGG + Intronic
903501907 1:23805123-23805145 CTGTAGGCCCAGATGTAGGCAGG - Intronic
903847484 1:26287131-26287153 CTGATGGTGCAGATGGGTGGGGG - Intronic
903907841 1:26697975-26697997 TTGAAAGCACAGATGGGGGGCGG - Intronic
904603239 1:31684813-31684835 CTGAAGGGGCAGAAGGTGAGAGG - Exonic
904703343 1:32372251-32372273 CTGAAGGCACAGAGGGATGTAGG - Intronic
905212819 1:36385979-36386001 CTGGAGACGCAGGCGGAGGGCGG - Intergenic
905460668 1:38120846-38120868 CTGAAGGGGGTGATGGAGGGAGG - Intergenic
906588540 1:47001915-47001937 CAGAAGGCAGAGGTGGAGGGAGG - Intergenic
906641386 1:47442984-47443006 CTGAAGGCAGAGAAGAAGGGAGG + Intergenic
907639400 1:56170932-56170954 CTGGAGGCACAGAAGGATGGAGG + Intergenic
908007312 1:59740074-59740096 CTGAAGGAGGACAGGGAGGGAGG - Intronic
908847824 1:68342882-68342904 ATGAAGGTGCAGATGGGGAGTGG + Intergenic
909151526 1:72011920-72011942 TTGAAGGTGGAGATGGAGAGTGG + Intronic
909877547 1:80828158-80828180 ATGGAGGCCCAGATTGAGGGTGG - Intergenic
911735718 1:101334625-101334647 CAGAAGGGGGAGAGGGAGGGAGG - Intergenic
914802526 1:150971995-150972017 CTGGAGTCGCAGAGGGAGGGTGG + Intronic
914827359 1:151145666-151145688 CTGCAGGCGCAGACGAAGAGGGG + Intronic
915350071 1:155218715-155218737 AGCAAGGCACAGATGGAGGGAGG - Intergenic
915353469 1:155240953-155240975 AGCAAGGCACAGATGGAGGGAGG - Intronic
915516022 1:156413186-156413208 CGGAGGGTGCAGATGGAGGGTGG + Intronic
915577715 1:156791642-156791664 CTGAGGGCACAGTTGGAGAGGGG - Intronic
915937055 1:160095810-160095832 CTCATGGCGCAGCTGGAGAGGGG - Intronic
920227849 1:204450934-204450956 CAGAGGGCGCAGAGGCAGGGCGG + Intronic
920251433 1:204624772-204624794 CTGAGGGTCCAGAGGGAGGGTGG + Intronic
920609612 1:207424036-207424058 CTGTAGCCGCTGATGAAGGGAGG + Intergenic
920615436 1:207487836-207487858 CTGCAGGTGCAGATGAAGGCAGG + Intronic
920955673 1:210618566-210618588 CTGGAGGAGCAGATGGCCGGAGG - Intronic
921055310 1:211538513-211538535 CAGAAGGGGCAGATGGGGGAGGG + Intergenic
921263127 1:213401291-213401313 CTGAAGGCTGAGATAGAGAGGGG + Intergenic
921484946 1:215704110-215704132 TGGAAGGCGCAGAAGCAGGGTGG - Intronic
921658997 1:217776723-217776745 ATGAAGGCTCAGACGGAGGGTGG + Intronic
921681597 1:218039488-218039510 CTGAGGGATCAGATGGAGGTTGG + Intergenic
921771917 1:219050524-219050546 CGGGAGGGGGAGATGGAGGGAGG + Intergenic
922101658 1:222482159-222482181 CCCAAGGAGCAGATGGAGAGAGG - Intergenic
922333696 1:224600902-224600924 GTGAAGGCACAGAGGGAAGGTGG + Intronic
922819556 1:228474681-228474703 GTTAAGAGGCAGATGGAGGGAGG + Intergenic
924583912 1:245345297-245345319 GTGAAGTCGCAGAAGGAGGGAGG - Intronic
924813674 1:247424707-247424729 CTGAAACAGCAGATGGAGAGTGG + Exonic
1063837331 10:10030578-10030600 CTGAAGACTCAGAAGCAGGGAGG + Intergenic
1064020086 10:11801977-11801999 CTGGAGACTCAGAAGGAGGGAGG + Intergenic
1065630608 10:27677029-27677051 CTGAAGGGAAAGATGTAGGGTGG + Intronic
1066004569 10:31134383-31134405 CTGAAGAGGCAGCTGGAGCGCGG - Intergenic
1066432410 10:35363815-35363837 CTGAAGGTGCAGAGAGAGGGAGG + Intronic
1067342941 10:45419212-45419234 GTGAAGGCGCAGAGGCAGGGAGG + Intronic
1067709548 10:48637178-48637200 CTGAAGCTGCAGATGGAGACAGG + Intronic
1069486596 10:68827678-68827700 CTGGAGGCGCAGAAGGCGGCGGG + Exonic
1069486683 10:68828014-68828036 CTGGAGGCGCAGAAGGCGGCGGG + Intronic
1069879547 10:71583268-71583290 CTGAGGCCGCAGAGGGAGGCAGG + Intronic
1070976251 10:80608281-80608303 CTGAAGGCACAGAGGGCGGGAGG + Intronic
1070976304 10:80608684-80608706 CTGAAGGCACGGAGGGCGGGAGG - Intronic
1071801651 10:89069905-89069927 CTGAAGTTGCACATGGAAGGAGG + Intergenic
1072728885 10:97831521-97831543 CATTAGGAGCAGATGGAGGGAGG + Intergenic
1073242377 10:102066876-102066898 CTGAAGGCCCAGCTGGTGGCTGG + Exonic
1073300064 10:102465747-102465769 CTGCTGGGGCAGATTGAGGGTGG + Intronic
1074776252 10:116770343-116770365 CCGAAGGGGCAGATGTGGGGAGG + Intergenic
1075337146 10:121616754-121616776 ATGATGGCGCAGATGAATGGAGG - Intergenic
1075543323 10:123334457-123334479 CTGAAGGGGCCCAAGGAGGGAGG + Intergenic
1075765262 10:124887844-124887866 ATGAAGACGCAGAGGAAGGGAGG + Intergenic
1076352262 10:129825369-129825391 CTGCAGCAGCAGAGGGAGGGAGG + Intergenic
1076471533 10:130722115-130722137 CTGAAGGCAAGGATGGAGGGAGG + Intergenic
1077616116 11:3675303-3675325 TGGAAGGGGTAGATGGAGGGTGG + Exonic
1078050361 11:7960500-7960522 CTGCAGGGGCAGATGGAGAGAGG - Exonic
1078642352 11:13108532-13108554 CTGAAGGAGTGGGTGGAGGGAGG + Intergenic
1079132668 11:17756725-17756747 CTGATGGCCCAGTTGGGGGGCGG + Intronic
1079314865 11:19398913-19398935 CTTAAGTCGCAGCTGGAGGCTGG + Intronic
1079340180 11:19605253-19605275 TTGAAGGGGCAGCTGGATGGAGG - Intronic
1079920420 11:26427285-26427307 ATCAAGGTGCAGGTGGAGGGAGG - Intronic
1080036718 11:27719277-27719299 CCGGAGGCGCCGGTGGAGGGCGG - Intronic
1081789708 11:45774310-45774332 CTGATGGGGCACCTGGAGGGTGG - Intergenic
1081961250 11:47139214-47139236 CTGAAGACAGAGTTGGAGGGTGG + Intronic
1083784441 11:64935744-64935766 AAGATGGGGCAGATGGAGGGAGG - Intronic
1084582664 11:70033635-70033657 CTGCAGGAGCACATGGATGGGGG + Intergenic
1084772640 11:71353824-71353846 AGGAAGGGGAAGATGGAGGGAGG + Intergenic
1084921869 11:72477466-72477488 CTGAAGAGGCTGAAGGAGGGCGG + Intergenic
1085508607 11:77074071-77074093 CTTAGGGAGCAGATGGAGGATGG + Intronic
1085670526 11:78460081-78460103 CTGAAGACACAGAAGAAGGGTGG + Intronic
1086918339 11:92557140-92557162 CAGAAGGTGAAGATGGAGGAGGG - Intronic
1087424517 11:97970515-97970537 CTGAAGGTGCAGTTGGAGGAAGG + Intergenic
1088647248 11:111927000-111927022 CTGGAGGCGGAGCTGGAGGGGGG + Intergenic
1088743376 11:112784956-112784978 CTGGAAGCCCAGATGGAGGGTGG + Intergenic
1088971067 11:114775191-114775213 CTGAAGGCGGACCTGGAGGAAGG - Intergenic
1089079882 11:115766725-115766747 CTGAGTCAGCAGATGGAGGGTGG - Intergenic
1089615949 11:119694857-119694879 CTGAAGGAGCAGCTGGAGAGAGG - Intronic
1090075360 11:123577344-123577366 CTGCAGCGGCAGATGGAGAGAGG - Intronic
1090392005 11:126394817-126394839 CTGCAGGGGCGGATGGTGGGGGG + Intronic
1090407825 11:126487957-126487979 CAGAAGGCGGAGGTGGAGGGAGG + Intronic
1092017332 12:5170124-5170146 CGGAAGGCGGAGGGGGAGGGGGG + Intergenic
1096743709 12:53712375-53712397 CAGCAGACGGAGATGGAGGGAGG - Intronic
1098913600 12:76235181-76235203 GTGAAGGCGCTGATAGAGGTTGG - Intergenic
1100562970 12:95767727-95767749 CTGAAGGTTCACTTGGAGGGGGG - Intronic
1101761326 12:107661197-107661219 CTGAAGGTGGGGGTGGAGGGAGG - Intergenic
1103673523 12:122637931-122637953 CTGCAGTCGCAGATGGAGTCTGG + Intergenic
1104603585 12:130170743-130170765 GTGAAGGCCAAGCTGGAGGGAGG + Intergenic
1105562301 13:21505329-21505351 CAGAAGGCACTGATGCAGGGCGG + Intronic
1105913849 13:24894712-24894734 CAGAAGGCGGAGGCGGAGGGTGG + Intronic
1107557837 13:41533380-41533402 CTGAAGCCGCAGTGAGAGGGAGG + Intergenic
1107710102 13:43142939-43142961 CTGAAGGCAGAGATGTAGGAAGG + Intergenic
1108643570 13:52405902-52405924 CTGAAGGCGCAGGTGGACGGTGG - Intronic
1109391972 13:61705505-61705527 CTGATGGTGCAGATGGAGCTGGG - Intergenic
1112551260 13:100423216-100423238 CTGAAGGGGCAGATGTGGAGTGG - Intronic
1116671995 14:47854611-47854633 CTGAAGGGGCAAATGAAAGGAGG + Intergenic
1117222745 14:53621842-53621864 CTGAAAGCTCAGATGAAGTGAGG - Intergenic
1119322339 14:73739434-73739456 CAGAAGGTGCAGCTGGAGGTAGG - Exonic
1119949629 14:78730889-78730911 CTGCAGGCGGAGATTGATGGTGG + Intronic
1121154413 14:91669374-91669396 CTGAAGGAGCAGCCAGAGGGTGG + Intronic
1121308410 14:92922005-92922027 CAGCAGCCGCAGATGGAGAGGGG + Intergenic
1122540615 14:102495893-102495915 CGGGAGGTGCAGGTGGAGGGAGG + Intronic
1122635317 14:103127013-103127035 CTGAAGGCGGCGCTGGAGCGCGG + Exonic
1122952254 14:105051484-105051506 GTGAAGGCGATGATGGAGAGAGG + Exonic
1123057177 14:105576023-105576045 CTGGAGGCTCAGATGGAGACGGG - Intergenic
1123081067 14:105695868-105695890 CTGGAGGCTCAGATGGAGACGGG + Intergenic
1123166593 14:106330973-106330995 AGGCAGGTGCAGATGGAGGGAGG - Intergenic
1123169277 14:106356012-106356034 AGGCAGGTGCAGATGGAGGGAGG - Intergenic
1124012419 15:25849485-25849507 GAGAAGGCGTAGAAGGAGGGAGG - Intronic
1124168387 15:27350123-27350145 CTGAAGGCCAAGATGGTGGCTGG - Intronic
1126360403 15:47839747-47839769 GTGAAGGCTAAGATGAAGGGAGG + Intergenic
1126935322 15:53700688-53700710 CTGGAGGCGGGGATGCAGGGAGG + Intronic
1128510766 15:68312774-68312796 CTGAAGATGCAGCTGAAGGGAGG + Exonic
1129236730 15:74228190-74228212 CTGAAGGCGCAGTAGAGGGGTGG + Intergenic
1129291169 15:74568995-74569017 CAGCAGAGGCAGATGGAGGGTGG - Intronic
1129295808 15:74599457-74599479 CTGAAGGCGCAGATGGAGGGAGG + Intronic
1129333979 15:74841698-74841720 GTGAAGGGGCAGAGGGAAGGAGG - Intronic
1129465333 15:75721617-75721639 CTGATGGGGCAGGTGGATGGGGG + Intergenic
1130957685 15:88639055-88639077 CTGAGGGCGCAGAGGCAGGCAGG + Exonic
1131029675 15:89176007-89176029 CTGAAGGCCCTGATGGAAGGCGG - Intronic
1131407512 15:92177292-92177314 TTGAAGGCTCAGGTGTAGGGTGG - Intergenic
1131863038 15:96674972-96674994 CTGAAGGAACAGAGGGAAGGAGG + Intergenic
1132119021 15:99160213-99160235 CAGAAGGCGGGGGTGGAGGGGGG + Intronic
1132338349 15:101063095-101063117 CGGGAGGCAGAGATGGAGGGAGG - Intronic
1132551325 16:554979-555001 CGGCAGGAGCAGATGGAGTGAGG + Intergenic
1132932186 16:2464406-2464428 CTGGAGCCTCAGAAGGAGGGAGG + Intronic
1133294145 16:4742454-4742476 GTGAAGGCGGAGGTGGAGGCAGG + Intronic
1133732674 16:8590125-8590147 CTGAAGGCGGAGGTGGAGGTCGG - Intergenic
1134685763 16:16157043-16157065 CTGTAGGTTCAGAGGGAGGGAGG + Intronic
1135806462 16:25547268-25547290 AAGAAGGGCCAGATGGAGGGAGG - Intergenic
1135842909 16:25893053-25893075 GTGAAGGCGCAGGTGGAGGGAGG + Intronic
1136450941 16:30353980-30354002 CTGCAGGAGGAGATGGAGGAAGG - Exonic
1136477303 16:30521513-30521535 CTGAAGGAGAAGATGGAGGCTGG + Exonic
1136909929 16:34136498-34136520 GTGAAGGCGCCCAAGGAGGGAGG + Intergenic
1137878509 16:52021258-52021280 ATGAAGGCAGAAATGGAGGGAGG - Intronic
1138207115 16:55133241-55133263 GTGAAGGCCGAGAGGGAGGGAGG - Intergenic
1139293563 16:65879364-65879386 CTGAATGCATGGATGGAGGGTGG + Intergenic
1141742799 16:85905211-85905233 CTGAAGGCACAGTTGCAGGTTGG + Intronic
1142856162 17:2731527-2731549 CTGAAGGCGCTGCTGGGTGGTGG - Intergenic
1143019195 17:3907858-3907880 CAGAAGGAGCTGATGCAGGGGGG + Intronic
1143247640 17:5500037-5500059 CAGCAGGCGAAGCTGGAGGGCGG - Intronic
1145056004 17:19704392-19704414 CTGATGGCGCAGGTGGTGGTGGG - Intronic
1146951926 17:36912842-36912864 GGGAAGGAGCAGATGGTGGGAGG - Intergenic
1147995822 17:44359878-44359900 GTGCAGGGGCAGGTGGAGGGGGG - Intronic
1150382216 17:64729764-64729786 CTGAAGGCGGGGTTGCAGGGAGG + Intergenic
1152212654 17:79010519-79010541 CTGAAGGTGCAGATGGGCAGGGG - Intergenic
1152396741 17:80037264-80037286 CTGAGCGCGCACAGGGAGGGCGG + Intronic
1152469606 17:80483354-80483376 CTGAGGGTGCAGAGGGAGGACGG + Intergenic
1152651141 17:81493688-81493710 GTCCAGGCGCTGATGGAGGGAGG - Intergenic
1152665421 17:81565899-81565921 CTGGAGGCTGGGATGGAGGGCGG + Intronic
1156305265 18:35873345-35873367 CTGATGGCACAGTTGGAGGAGGG - Intergenic
1156871959 18:41955458-41955480 CTCAAGGCCCAGATTGGGGGCGG + Intronic
1157354126 18:46917581-46917603 CTGAAGGCGCGGGCGGAAGGCGG - Intronic
1159274014 18:66192307-66192329 ATGAAGCCACAGATGGAGGAAGG - Intergenic
1160111313 18:76034450-76034472 CTGAAGTCTCAGATGGGGTGGGG - Intergenic
1160851599 19:1195456-1195478 CTGGAGGAAGAGATGGAGGGAGG + Intronic
1160852023 19:1197270-1197292 CTGGAGGAAGAGATGGAGGGAGG + Intronic
1161451730 19:4350124-4350146 CTGAAGGTGGGGAGGGAGGGAGG + Intronic
1161465731 19:4429255-4429277 CTGAAGGGACAGATGGAGGAGGG - Intronic
1161666138 19:5578254-5578276 CTGGAGGCGCAGGTGGAGGCTGG - Intergenic
1161741985 19:6026934-6026956 CTGAAGGACCTGATGGAGGTGGG + Intronic
1161795408 19:6383536-6383558 CTGCAAGCACAGATGCAGGGTGG - Intronic
1162064825 19:8119054-8119076 ATGAAGGTGCTGATGCAGGGAGG + Intronic
1162296884 19:9819482-9819504 CGGAAGGCGCGGCTGGAGCGGGG + Intronic
1162525612 19:11204428-11204450 CTGGAGGAGGTGATGGAGGGTGG - Intronic
1162776992 19:12985894-12985916 ATGGAGGGGAAGATGGAGGGAGG - Intergenic
1162813061 19:13176300-13176322 TTGAAGGGGCAGATGTGGGGCGG + Intergenic
1163383628 19:16985624-16985646 AGGGAGGCGCAGAGGGAGGGTGG + Intronic
1163640841 19:18461147-18461169 CCGGAGGCGCAGGTGGAGGGCGG + Intronic
1163718557 19:18886694-18886716 AGGAAGCCGCAGATGGAGGCTGG - Intronic
1164939890 19:32244181-32244203 GTGTAGGGGCAGATGGTGGGGGG - Intergenic
1165161864 19:33821016-33821038 CTGAACGCGCATCAGGAGGGAGG + Intergenic
1165278383 19:34774281-34774303 CTGGAGGGGCAGATGGGGAGGGG - Intergenic
1165386558 19:35513591-35513613 CTGCAGACCCAGAGGGAGGGAGG - Exonic
1166160507 19:40949231-40949253 CTGAAGGGGCTGAGGGAAGGGGG + Intergenic
1166169386 19:41016824-41016846 CTGAAGGGGCTGAGGGAAGGGGG + Exonic
1166273369 19:41732987-41733009 ATGAAGGAGCAGATGGATGAGGG - Intronic
1166731001 19:45059021-45059043 TTGAAGGGGCAGATGAACGGAGG - Intronic
1167192976 19:48004589-48004611 CTGGAGGAACAGATGGAGGAGGG - Intronic
1167374337 19:49103066-49103088 CTGCAGACGCAGCTGGTGGGAGG + Intronic
1168217878 19:54939680-54939702 CTGAAGCTGCAGATGGAGAAGGG - Exonic
1168224240 19:54982920-54982942 CTGAAGCTGCAGATGGAGAAGGG + Exonic
1168527112 19:57098097-57098119 CTGGAGCCGGAGATGCAGGGAGG - Intergenic
925084477 2:1097229-1097251 GTGCAGGTGCAGATGCAGGGAGG - Intronic
926581695 2:14636568-14636590 CTGGGGCCGCAGCTGGAGGGAGG - Exonic
929537399 2:42792389-42792411 GTGAGGGCGCAGATGGAGGAGGG + Intronic
929925236 2:46202031-46202053 CTGAAGTCGGAATTGGAGGGTGG + Intergenic
930243450 2:48959426-48959448 CTGCAAGAGCAAATGGAGGGAGG - Intergenic
931826902 2:66009970-66009992 CTGAGGGTGCAGGTGCAGGGTGG - Intergenic
932246714 2:70202607-70202629 CTGCAACCGCTGATGGAGGGAGG - Intronic
933638639 2:84735045-84735067 CTGAAAGAGCAGATGGAGGGAGG - Intronic
933771318 2:85746241-85746263 CTGAAGGCTCTGATGGATGCAGG - Intergenic
936013393 2:108940327-108940349 CTGAAGGGGAAGGTGCAGGGAGG + Intronic
936955751 2:118020691-118020713 TTGAGGGCCCAGGTGGAGGGAGG - Intergenic
939692543 2:145283009-145283031 CTGAATGGGCAGTTGGAGGATGG + Intergenic
945594695 2:211777049-211777071 GTAAAGGCAGAGATGGAGGGAGG + Intronic
946229298 2:218281910-218281932 CTGGAAGGGCAGATGGAAGGTGG - Intronic
946247664 2:218396703-218396725 CTGAAGGAGGAGATGGATGGGGG + Exonic
946716784 2:222561281-222561303 CTGCAGGGGCAGATGAAGGCTGG - Intergenic
946875029 2:224120370-224120392 TTGGAGACTCAGATGGAGGGAGG + Intergenic
947556991 2:231101773-231101795 CTGAGGGCTCAGATGGTCGGTGG + Intronic
1168795823 20:609735-609757 CAGAAGGTGCAGATGGAGCGCGG + Exonic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1169244774 20:4016584-4016606 CAGGAGGGGCAGATGGAGGAGGG - Intergenic
1171519001 20:25761323-25761345 CAGAAGAAGCAGAGGGAGGGAGG - Intergenic
1172643384 20:36455221-36455243 CAGAAGGCAAAGATGGTGGGGGG - Intronic
1173032826 20:39378284-39378306 CTGGAGGCTCAGAAGCAGGGAGG - Intergenic
1173189396 20:40864641-40864663 CTGAAGGAAGGGATGGAGGGAGG + Intergenic
1173642522 20:44613954-44613976 GTGAAGGCTCTGAGGGAGGGAGG - Intronic
1174029593 20:47611820-47611842 CTGGAGGGGCAGAAGGAGTGGGG - Intronic
1174216690 20:48921585-48921607 CAGAAGGCGAGGGTGGAGGGTGG - Intergenic
1175169750 20:57071937-57071959 CTGGAGGGGGAGGTGGAGGGTGG - Intergenic
1175370143 20:58482861-58482883 CTGTAAGTGCAGATGGAAGGAGG - Intronic
1175851811 20:62097760-62097782 CTGAAGGGGCAGGTGCAGGTGGG + Intergenic
1175984129 20:62755636-62755658 ATGAAGGCAGGGATGGAGGGAGG - Intronic
1175984180 20:62755787-62755809 CTGAAGGGAGGGATGGAGGGAGG - Intronic
1179243247 21:39609941-39609963 CTGAAGGCTGGCATGGAGGGAGG + Intronic
1179551280 21:42145568-42145590 GTGAAGGCTCTGATGGAGGAGGG + Intergenic
1180211026 21:46295617-46295639 ATGAAGGCGGAGGCGGAGGGAGG - Intronic
1181043342 22:20203264-20203286 GTCAAGGCCCAGAGGGAGGGAGG + Intergenic
1181308148 22:21928519-21928541 CTGAAGGAGCAGCAGGTGGGTGG + Intronic
1181343510 22:22200854-22200876 CTGCAGGAGCATATGGAGGGTGG - Intergenic
1183330640 22:37219036-37219058 CAGCAAGAGCAGATGGAGGGTGG - Intergenic
1183666404 22:39248829-39248851 CTGAACGCGAAGATGGGCGGGGG - Intergenic
1184341918 22:43890950-43890972 CTGCAGGGGCGGAAGGAGGGAGG - Intronic
1185157525 22:49203194-49203216 CTGAGGGCGCAGAGAGATGGAGG - Intergenic
950410814 3:12835513-12835535 CTGAAGCAGCAGCTGGTGGGAGG + Exonic
950520492 3:13495113-13495135 TGGAAGGAGCAGGTGGAGGGAGG - Intronic
952318929 3:32258031-32258053 CAGAAGTCGCTGCTGGAGGGAGG + Intronic
953064355 3:39455728-39455750 CTGGAGATGGAGATGGAGGGTGG + Intergenic
954034089 3:47841173-47841195 CTCAAGGTACAGATGGAGGATGG + Exonic
954129451 3:48552701-48552723 CTGAAGGAGCAGTTGGGGGGTGG - Intronic
954658549 3:52213217-52213239 CTAAAGGCAGAGATGGAAGGGGG + Intronic
955062728 3:55507137-55507159 GTTAAGGGGCAGCTGGAGGGAGG + Intergenic
957903168 3:86523728-86523750 CTGAATTCGAAGATGGAGGATGG - Intergenic
958935187 3:100249145-100249167 ATGAGGTCACAGATGGAGGGAGG + Intergenic
961484939 3:127209920-127209942 CTCATGGCGCTGCTGGAGGGAGG - Intergenic
961725154 3:128923269-128923291 CTGAATGCGAAGATGGAATGAGG + Intronic
962414493 3:135169631-135169653 CTGAAGGCTCTGATGGAGGGAGG + Intronic
966632835 3:182097478-182097500 CTGAAGAAGCAGAGAGAGGGAGG + Intergenic
967549634 3:190775595-190775617 ATGAAGGAGCAGACGGAGGTGGG - Intergenic
967864246 3:194177331-194177353 TGGAAGGCACAGATGGAGGAAGG + Intergenic
968720249 4:2197231-2197253 CTGAAGGGGCAGGTGGAAGCAGG + Intronic
968809816 4:2794732-2794754 CTGAAGAGGCAGACAGAGGGAGG + Intronic
969608205 4:8212678-8212700 CTGGAGGGGCAGACGGAGGTTGG - Intronic
969869363 4:10095089-10095111 CAGAAGGCGCAGATGAAGACAGG + Intronic
972884739 4:43471624-43471646 CTGAATGCGAAGATGGAATGAGG + Intergenic
976221053 4:82757125-82757147 CTGAAAGCGAGGATGGAGAGAGG - Intronic
982265658 4:153536209-153536231 CTGATGGGGCAGAGGGAGTGAGG + Intronic
984316434 4:178137565-178137587 CTGCAATCGCCGATGGAGGGAGG - Intergenic
985337389 4:188911432-188911454 ATGCAGGTGCAGATGGAGGTTGG - Intergenic
986131686 5:4937873-4937895 CTGAAGGAGCAGGTGGAGCATGG - Intergenic
986770461 5:10968215-10968237 GTGAAGGAGAAGATGGAGGAAGG - Intergenic
988335812 5:29908077-29908099 CTGAAGGAGCAGAGGGGGAGGGG - Intergenic
988882534 5:35518802-35518824 CTGAAGTTCCAGATGGAGGGAGG - Intergenic
989202065 5:38773549-38773571 CAGAAGGAACAGATGGAGGAAGG + Intergenic
990743116 5:58932603-58932625 CAGAAGAAGCAGATGAAGGGTGG - Intergenic
991117198 5:62968435-62968457 CTGATGATGCAGGTGGAGGGAGG - Intergenic
992085316 5:73273138-73273160 CTGAATCCACAGATGGAGGAGGG - Intergenic
993001912 5:82389028-82389050 CTGAAGGAGCACATGGAGGGCGG - Intergenic
994245601 5:97472001-97472023 CTGATGGCGGTGATGGAGGCAGG + Intergenic
996391556 5:122967912-122967934 CTGAAGGGTCAGATTAAGGGAGG - Intronic
998989085 5:147795252-147795274 CTGAAGGTGTGGATGGAGGAGGG - Intergenic
999758556 5:154682958-154682980 CTGGCGGCGGAGCTGGAGGGAGG - Intergenic
1000834317 5:166135422-166135444 CTGGAGGCCCAGATGCTGGGAGG + Intergenic
1001475682 5:172048990-172049012 CTGAAGGACCTGAGGGAGGGAGG - Intronic
1001563725 5:172686424-172686446 CTGTATGCTCAGCTGGAGGGAGG + Intronic
1002170048 5:177369868-177369890 CTGCAGGAGCAGGTGGAGTGTGG - Intronic
1002340514 5:178513772-178513794 CTGACCGTGAAGATGGAGGGAGG - Intronic
1003122158 6:3327223-3327245 CTGAAGGGGCAGTTGGATTGGGG - Intronic
1005978809 6:30820293-30820315 CTGAAGGAGCTGATGGCTGGAGG - Intergenic
1006168762 6:32081269-32081291 GAGAAGGCGAAGATGGAGGGAGG + Intronic
1007397641 6:41586713-41586735 CTGAAGCAGCGGAAGGAGGGAGG + Intronic
1007416597 6:41694722-41694744 CTGAAGGGCCAGATGGTGGGAGG - Intronic
1010141499 6:72620175-72620197 CTGAAGGCGGAGGGGGCGGGAGG - Intergenic
1011428966 6:87264707-87264729 CTGAAGAAGCAGATGGGTGGTGG + Intergenic
1012887387 6:104860919-104860941 ATGAAGGGGCAGATGGTGGTTGG + Intergenic
1012980975 6:105830806-105830828 CAGAAGGGGCAGCTGGAGGAGGG + Intergenic
1013911655 6:115282680-115282702 CTGAGGCCCCAGAGGGAGGGTGG - Intergenic
1015243704 6:131054073-131054095 CTGAATGCGAAGATGGAATGAGG - Intronic
1015675315 6:135739694-135739716 GTGAAAGCGCAGATGGGGAGGGG + Intergenic
1016087751 6:139935791-139935813 CTGAAGGCACTGAAGGAAGGAGG - Intergenic
1016562971 6:145417894-145417916 CTGAAGGAGCTGAAGGAGTGTGG - Intergenic
1021841640 7:24726032-24726054 CGGCAGGCAGAGATGGAGGGAGG + Intronic
1022046276 7:26624907-26624929 CTGAACGCACAGACGCAGGGAGG + Intergenic
1022076271 7:26974051-26974073 CTGAAGGCCCTGGTGGAGTGTGG + Intronic
1023165463 7:37338974-37338996 CTCCAGGCACTGATGGAGGGTGG + Intronic
1024974318 7:55099503-55099525 ATGCAGTCCCAGATGGAGGGGGG + Intronic
1026530068 7:71189526-71189548 GAGAAGGGGCAGTTGGAGGGAGG + Intronic
1028947644 7:96599039-96599061 CTAGAGGGGCAGAGGGAGGGAGG + Intronic
1029673098 7:102047481-102047503 ATGAAGGGAGAGATGGAGGGAGG + Intronic
1031900111 7:127399568-127399590 CTGATGGTGCATATGGAGAGAGG - Intronic
1032506212 7:132436486-132436508 GTGAAGGTGCAGGTGGAGGAAGG - Intronic
1032516376 7:132509150-132509172 CTGGAGGAGAAGAGGGAGGGAGG + Intronic
1034997409 7:155586941-155586963 ATGAAGGCGCAGGTGGTGGGTGG - Intergenic
1035050016 7:155993356-155993378 CAGAAGGGGCTGATGGAGGCAGG - Intergenic
1035050049 7:155993536-155993558 CAGAAGGGGCTGATGGAGGCAGG - Intergenic
1035070166 7:156138615-156138637 CTGAATGTGCTGATGGAGGAGGG + Intergenic
1035352047 7:158253908-158253930 CTGAACGTAGAGATGGAGGGCGG - Intronic
1035352060 7:158253982-158254004 CTGAACGTGGAGATGGAGGGCGG - Intronic
1035352074 7:158254056-158254078 CTGAACGTGGAGATGGAGGGCGG - Intronic
1035352088 7:158254130-158254152 CTGAACGTGGAGATGGAGGGCGG - Intronic
1035352103 7:158254207-158254229 CTGAACGTGGAGATGGGGGGCGG - Intronic
1035352120 7:158254281-158254303 CTGAACGTGGAGATGGAGGGCGG - Intronic
1035352135 7:158254355-158254377 CTGAACGTGGAGATGGAGGGCGG - Intronic
1035352150 7:158254429-158254451 CTGAACGTGGAGATGGGGGGCGG - Intronic
1035352167 7:158254503-158254525 CTGAACGTGGAGATGGAGGGCGG - Intronic
1035352196 7:158254651-158254673 CTGAACGTGGAGATGGAGGGCGG - Intronic
1035705086 8:1669253-1669275 CTGGGGGCCCAGATGGACGGCGG - Intronic
1037769605 8:21790624-21790646 CTGGGGGAGAAGATGGAGGGAGG - Intronic
1039897772 8:41728404-41728426 CTGAAGACTCAGAGGGTGGGAGG + Intronic
1039948923 8:42152962-42152984 CTTCAGGCGCAGATCGTGGGCGG + Exonic
1041284948 8:56251046-56251068 CTGAGGTGGCAGATGCAGGGGGG - Intergenic
1041369416 8:57143328-57143350 CGCAAGCCGCAGAAGGAGGGAGG - Intergenic
1042847319 8:73181399-73181421 CTGCAGGAGCAGATGGTGGTTGG + Intergenic
1045522417 8:102914803-102914825 AAGAAGGTGCAGATTGAGGGGGG - Intronic
1046860181 8:119082589-119082611 TTGAAGACGGAGATGGAGGCAGG + Intronic
1047006891 8:120630121-120630143 CTGAAGGGGCAAAGGGAGGCTGG - Intronic
1048718123 8:137291194-137291216 CTGAAGGAGCAGATTGAAGTAGG - Intergenic
1049256567 8:141617257-141617279 ACAAAGGCGCAGATGGAGGCAGG - Intergenic
1049411500 8:142475754-142475776 CAGAAGGGGCCGGTGGAGGGAGG + Intronic
1051175169 9:14353177-14353199 CTGTAGGGGCAGACAGAGGGTGG + Intronic
1052538326 9:29776308-29776330 CTGAATGCTAAGATGGAAGGAGG - Intergenic
1053288461 9:36864736-36864758 CTGATGGCGCTGACGGAGGGAGG + Intronic
1056684527 9:88748639-88748661 CTGAAGGCAAAGAGGGAGGCTGG + Intergenic
1057489108 9:95508250-95508272 CGGGAGGCGCAGACGGACGGGGG - Exonic
1058776489 9:108289318-108289340 CTGGAGAAGCAGATGGAAGGGGG - Intergenic
1059140413 9:111847652-111847674 CTAAAGGGGCAGTTGGAGGACGG + Intergenic
1059740216 9:117142854-117142876 CTGGAGACACAGATGGAGGGAGG - Intronic
1062076693 9:134593580-134593602 CTCCAGGCGCAGGTGGAGGATGG - Intergenic
1062449428 9:136609321-136609343 CTGGAGGGGCAGCTGCAGGGAGG - Intergenic
1062583994 9:137240851-137240873 CTGGGGGCGCCGAGGGAGGGCGG - Intergenic
1186214432 X:7283747-7283769 CTGAAGTGGCAGATGGTGGTGGG + Intronic
1187200839 X:17132349-17132371 CTGAAGGCAGAGAGGGAGAGGGG + Intronic
1187485757 X:19701576-19701598 CTGAAGATGCAGATGGTGAGTGG - Intronic
1189195334 X:39147777-39147799 CTGAAGTAGCAGATGGTTGGAGG - Intergenic
1192230711 X:69263121-69263143 CTGAAGGGTAAGATGGGGGGAGG - Intergenic
1196181605 X:112698169-112698191 CTGAAGGGCCAGAAGGAAGGCGG - Intergenic
1196251056 X:113460465-113460487 GTGAGGGCTCAGATGGAAGGGGG - Intergenic
1197835154 X:130686385-130686407 CAGAAGGCAAAGATGGAGCGAGG - Intronic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1200154993 X:153970523-153970545 GTGAGGGAGGAGATGGAGGGAGG + Intronic
1200155003 X:153970553-153970575 GGGAGGGAGCAGATGGAGGGAGG + Intronic
1200242197 X:154502810-154502832 CTGAAGGAACAAATGGAGGAAGG + Intergenic