ID: 1129296278

View in Genome Browser
Species Human (GRCh38)
Location 15:74602086-74602108
Sequence CAGGGAAAGCAGCAGCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1031
Summary {0: 1, 1: 1, 2: 8, 3: 97, 4: 924}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129296278_1129296288 12 Left 1129296278 15:74602086-74602108 CCCTCCTGCTGCTGCTTTCCCTG 0: 1
1: 1
2: 8
3: 97
4: 924
Right 1129296288 15:74602121-74602143 CAGAGAGAAGAAGGCAGACCAGG 0: 1
1: 0
2: 5
3: 61
4: 659
1129296278_1129296290 24 Left 1129296278 15:74602086-74602108 CCCTCCTGCTGCTGCTTTCCCTG 0: 1
1: 1
2: 8
3: 97
4: 924
Right 1129296290 15:74602133-74602155 GGCAGACCAGGAGATAGGTCAGG 0: 1
1: 0
2: 1
3: 19
4: 338
1129296278_1129296284 3 Left 1129296278 15:74602086-74602108 CCCTCCTGCTGCTGCTTTCCCTG 0: 1
1: 1
2: 8
3: 97
4: 924
Right 1129296284 15:74602112-74602134 TCCCCTCTTCAGAGAGAAGAAGG 0: 1
1: 0
2: 3
3: 33
4: 297
1129296278_1129296289 19 Left 1129296278 15:74602086-74602108 CCCTCCTGCTGCTGCTTTCCCTG 0: 1
1: 1
2: 8
3: 97
4: 924
Right 1129296289 15:74602128-74602150 AAGAAGGCAGACCAGGAGATAGG 0: 1
1: 0
2: 0
3: 35
4: 454

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129296278 Original CRISPR CAGGGAAAGCAGCAGCAGGA GGG (reversed) Intronic
900342592 1:2195775-2195797 CAGGGAAAGGGTCAGCAGCAGGG + Intronic
901218386 1:7567507-7567529 CAGGGAAAGCAGTGGATGGATGG + Intronic
901264919 1:7903041-7903063 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264928 1:7903068-7903090 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264937 1:7903095-7903117 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264946 1:7903122-7903144 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264951 1:7903140-7903162 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264960 1:7903167-7903189 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264965 1:7903185-7903207 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264974 1:7903212-7903234 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264983 1:7903239-7903261 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264988 1:7903257-7903279 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901264997 1:7903284-7903306 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901265006 1:7903311-7903333 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901265011 1:7903329-7903351 GAGGGGAAGCAGGAGAAGGAGGG - Intergenic
901390971 1:8945894-8945916 CAGGGACAGCAGAAGCACCAGGG - Exonic
901401038 1:9015184-9015206 CAGGGTCAGCAGCTGCAGCAGGG + Exonic
901604721 1:10450175-10450197 AAGGAAGAGCAGCAGCAGGGTGG + Exonic
901945811 1:12702640-12702662 CAGGGCAAACAGCAGGTGGAGGG - Intergenic
902123102 1:14184509-14184531 GAGCGGAAGCAGCAGCAGGAGGG + Intergenic
902161250 1:14532159-14532181 CTGGGAAAGAAAGAGCAGGATGG - Intergenic
902190193 1:14757288-14757310 AAGAGAAAGCAGGAGCAGGCAGG - Intronic
902218312 1:14948708-14948730 CAGAGAAAGCAGTAGCATGGAGG + Intronic
902620014 1:17645340-17645362 CAGGGAAGGCACCATCTGGAAGG + Intronic
902923893 1:19683138-19683160 CAGGGCTGGCAGCAGCAGGAAGG + Exonic
903323057 1:22553987-22554009 GGTGGAAAGCAGCAGCCGGAAGG - Intergenic
903779360 1:25811490-25811512 CAGTGAAAGCAGCAACATGGAGG + Exonic
903834070 1:26191351-26191373 CAGGGCCAGCAGCAGTTGGAAGG - Exonic
903907439 1:26696608-26696630 CTGGGAAAGGAGCTGCAGGACGG + Exonic
903918544 1:26782645-26782667 CAGGCAAAGCAGAAGCAGGGAGG - Intergenic
904324565 1:29719943-29719965 AAGGGAAAGCAGCACGAGGGTGG - Intergenic
904447308 1:30585579-30585601 GAGGGAAAGCTGAAGCAGGGCGG - Intergenic
905387112 1:37612792-37612814 CAGCAACAGCAGCAGCAGCAAGG - Exonic
905654052 1:39674696-39674718 CAGAGAGAGAAGCAGAAGGAGGG + Intergenic
905976608 1:42179758-42179780 CAGGGAACGCCGCATCTGGAAGG + Exonic
906052714 1:42888035-42888057 CACGAGCAGCAGCAGCAGGAAGG + Intergenic
906191973 1:43904758-43904780 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906191991 1:43904827-43904849 CAGGAATAGGAGCAGGAGGAGGG - Intronic
906192188 1:43905538-43905560 CAGGAATAGGAGCAGAAGGAGGG - Intronic
906192249 1:43905754-43905776 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906192337 1:43906081-43906103 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906192381 1:43906225-43906247 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906220053 1:44071476-44071498 CAGGGAAGGCTGGAGAAGGAAGG - Intergenic
906321859 1:44822297-44822319 GAGGGGATGCAGCAGCAGCAGGG + Exonic
906581650 1:46940135-46940157 AAGAGAAAGGAGCAGCAAGAGGG - Intronic
906602068 1:47138763-47138785 AAGAGAAAGGAGCAGCAAGAGGG + Intronic
907399957 1:54219061-54219083 GAGCGAAGGCAGCAGCAGGTGGG + Intronic
907634162 1:56116829-56116851 CAGGTGAAGAAACAGCAGGAAGG + Intergenic
907684840 1:56600508-56600530 CTGGAGTAGCAGCAGCAGGAAGG + Intronic
908107185 1:60856939-60856961 CAGCAGAAGCAGCAGCAGCAGGG + Intergenic
908286286 1:62607227-62607249 AAGGGATAGCAGTAGCAGTAAGG - Intronic
909546792 1:76857282-76857304 AAGGGGTAGCAGCTGCAGGAAGG - Intergenic
910330918 1:86071855-86071877 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
910455691 1:87395186-87395208 CAGGAAAAGCAGCAGTGGGAGGG + Intergenic
911047233 1:93638673-93638695 CATGGTAAACAGCAGGAGGAAGG + Intronic
911474302 1:98357442-98357464 GAGGGTAAGCAGCAGCAGCATGG - Intergenic
911530626 1:99039398-99039420 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
911632570 1:100199742-100199764 GAGGGCCAGCAGAAGCAGGATGG + Intronic
912235253 1:107844165-107844187 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
912664665 1:111568327-111568349 AAGGCAAAGCAGGAGCAGGCAGG + Intronic
914457972 1:147854715-147854737 GAGGGCAAGCAGAAGCAGGGAGG + Intergenic
914912573 1:151799648-151799670 CAGAGGAAGCTGCAGAAGGATGG + Intergenic
914915635 1:151817540-151817562 CAGAGAAAGCAGCTGCAGAGGGG + Intronic
915252346 1:154599650-154599672 CAGGGAAAGAGCCAGTAGGATGG - Intronic
915279178 1:154810603-154810625 TAGGGAAACCAGGAGAAGGAAGG + Intronic
915321136 1:155057098-155057120 CAGAGTAAGTAGCTGCAGGATGG + Exonic
915625876 1:157113819-157113841 CAGGGAAGACAGGAGCAGGAAGG - Intergenic
915713043 1:157919613-157919635 GTGGGGAAGCAGAAGCAGGAGGG - Intergenic
915932913 1:160070819-160070841 CAGAGAAAGCCGCTGCAGGTGGG - Intergenic
915980854 1:160419183-160419205 CAGTGGGGGCAGCAGCAGGAAGG - Exonic
916004483 1:160646895-160646917 CAGGGAGAGAAACAGCACGAAGG + Exonic
917023455 1:170614823-170614845 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
917173738 1:172207561-172207583 CAGGGAGAGCAACAGGAGAAAGG + Intronic
917478105 1:175386141-175386163 CAGGGGAGGCTGCAGCCGGAAGG + Exonic
917498450 1:175564239-175564261 CAGGGCAGGCAGCAGGAGGGAGG - Intronic
917906236 1:179589138-179589160 CCAGAAAAGCAGCAGCAGGAGGG + Intergenic
918515571 1:185359067-185359089 GGGAGTAAGCAGCAGCAGGATGG - Intergenic
918632154 1:186730806-186730828 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
919055565 1:192565733-192565755 GAGGGAGAGCGGCAGAAGGAAGG + Intergenic
919721327 1:200839695-200839717 CAGGGAAAAAAGCAGGAGGGAGG + Intronic
919757848 1:201077043-201077065 GAGGAAGAGCAGCAGCAGCAGGG + Exonic
919917594 1:202148443-202148465 CACAGGAAGCAGCAGCAGTAAGG - Exonic
920061957 1:203233070-203233092 CAGGGAGGGCAGCCCCAGGAGGG - Intronic
920115710 1:203619652-203619674 CAGCAATAGCAGCAGCAGGCTGG - Intergenic
920365172 1:205444462-205444484 AAGGGAAAGGATCAGCAGGGAGG - Intronic
920948946 1:210554913-210554935 AAGAGAAAACACCAGCAGGATGG - Intronic
921461629 1:215433449-215433471 GAGGGCAAGCTGAAGCAGGATGG - Intergenic
921764430 1:218953501-218953523 CAGCAGCAGCAGCAGCAGGAGGG + Intergenic
923126322 1:231037752-231037774 AAGGGAAAGAGGCACCAGGAAGG - Intronic
924350001 1:243105707-243105729 AAGGGGAAAGAGCAGCAGGAGGG + Intergenic
924687328 1:246307741-246307763 AAGAGAAAGCAGCACGAGGAGGG + Intronic
1063112954 10:3052749-3052771 CAGGCACAGCAGCAGCATCAAGG - Intergenic
1063386218 10:5617749-5617771 CACGCAGAACAGCAGCAGGAGGG + Intergenic
1063451283 10:6151923-6151945 CAGGAACAGGAGCTGCAGGAGGG - Intronic
1063459938 10:6208810-6208832 TATGGAAAGCAGCAGCCAGATGG - Intronic
1063538447 10:6908561-6908583 TTGAGAAAGCAGAAGCAGGAAGG + Intergenic
1064165131 10:12979342-12979364 AAGGGAAAGAACAAGCAGGAGGG - Intronic
1065108925 10:22420930-22420952 CAGGAGAACCAGCAGCAGGTTGG + Intronic
1065445213 10:25791316-25791338 GAGGGAGAGAAGCAGAAGGAGGG + Intergenic
1065786309 10:29218955-29218977 CAGGGAAGGCAGTACCAGAATGG + Intergenic
1066615468 10:37289057-37289079 CAGGGTGAGCAGAAGCAGGATGG - Intronic
1066626819 10:37415527-37415549 GAGGGAAAGGAGGAGAAGGAGGG + Intergenic
1066644845 10:37595889-37595911 CATGGGAAGATGCAGCAGGAAGG + Intergenic
1067239740 10:44480455-44480477 AAGGGCAAGCCGAAGCAGGAGGG + Intergenic
1067254880 10:44627637-44627659 TAGGAAAAGAAGCAGCAGGCAGG + Intergenic
1067448830 10:46368954-46368976 CAGTGAGGGCGGCAGCAGGAAGG - Intergenic
1067588542 10:47491811-47491833 CAGTGAGGGCGGCAGCAGGAAGG + Intergenic
1067635668 10:47999902-47999924 CAGTGAGGGCGGCAGCAGGAAGG + Intergenic
1068137487 10:52965219-52965241 CAGGACTACCAGCAGCAGGAGGG - Intergenic
1068174002 10:53433469-53433491 AAGGGAAAGAAGAAGGAGGAAGG + Intergenic
1068343261 10:55736995-55737017 CAGAGAAAGCAAGAGCAGAAGGG + Intergenic
1068495306 10:57778992-57779014 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1069080128 10:64079672-64079694 AAGGCAAAGCAGCAGCAGGTGGG + Intergenic
1069091470 10:64204518-64204540 TAGGGTCAGCAGCAGCAGCAGGG - Intergenic
1069304959 10:66957715-66957737 TGGGGACAGCATCAGCAGGATGG + Intronic
1070132226 10:73663909-73663931 CAGCGAGGGCGGCAGCAGGAAGG + Intergenic
1070161307 10:73868258-73868280 CAGAGGAAGCAGCAGGAAGAAGG + Intronic
1070561645 10:77571931-77571953 AAAGGAAAGCAGCAGCAACAAGG + Intronic
1070768875 10:79070852-79070874 CGGGGGAAGGAGCAGCGGGAGGG - Intronic
1070837002 10:79454364-79454386 CAGGAAAGCCAGTAGCAGGAAGG - Intergenic
1071119857 10:82264677-82264699 CAGGGAAAGAAGCCACAGGCAGG + Intronic
1071162798 10:82770657-82770679 CAGGTTAAGCAGCATCAGAATGG + Intronic
1071417627 10:85455950-85455972 CAGGTAATTCAGCTGCAGGACGG + Intergenic
1071609456 10:87020166-87020188 CAGCGAGGGCGGCAGCAGGAAGG - Intergenic
1072044795 10:91643987-91644009 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1072082732 10:92048005-92048027 TTGGAAAAGCAGCAGCAGAAAGG + Intronic
1072404324 10:95136032-95136054 GAGGGAGAGCAGAAGCAGGGTGG + Intergenic
1072626430 10:97115315-97115337 CAGGATAAGTACCAGCAGGAAGG - Intronic
1073045953 10:100638212-100638234 CTGGGAAAGGAGCAGAAGGAGGG + Intergenic
1073152744 10:101323008-101323030 CAGGGAGAGGAGCAGGAGGAGGG + Intergenic
1073199523 10:101723838-101723860 GAGGGAAAGCTGGGGCAGGATGG - Intergenic
1073219598 10:101859338-101859360 CTGAGACAGCAGCTGCAGGAAGG + Intronic
1073734891 10:106334704-106334726 CAAGGAAAACAACAGCAGGAAGG + Intergenic
1074165532 10:110871442-110871464 CAGAGAAAGCAGCGGCCAGAGGG + Intergenic
1074808138 10:117074723-117074745 CAGGAAATGCAGCAGTAGGCAGG + Intronic
1076090429 10:127680805-127680827 CAGGGAAGCCAGCTGGAGGAAGG + Intergenic
1076259745 10:129055886-129055908 CAGTGAACACAGCGGCAGGAGGG + Intergenic
1076704920 10:132296049-132296071 CAGGGCCAGCATCGGCAGGAAGG + Intronic
1076756090 10:132572488-132572510 CAGGGAAAGCAGCCCCGGGCGGG - Intronic
1076930219 10:133527439-133527461 CATGGACACCAGCAGGAGGAAGG - Exonic
1077018690 11:407902-407924 CAGGGCCAGCAGGACCAGGAGGG + Exonic
1077119395 11:899842-899864 CAGGGAAGGCAGCATCAGCCAGG - Intronic
1077150767 11:1072172-1072194 GAGGGAAAGGAGGAGGAGGAAGG - Intergenic
1077276038 11:1709041-1709063 CAGGGAAAGAACCAGCAGAGAGG + Intergenic
1077284658 11:1760262-1760284 CAGGGATAGCAGGCGCAGGTGGG + Intronic
1077316573 11:1922019-1922041 CAGGGAAAGCGGCCACAGGGAGG + Intronic
1077483272 11:2826528-2826550 TCGGGGAAGCAGCAGCAGGAGGG - Intronic
1077581278 11:3418820-3418842 GAGGGACTGCTGCAGCAGGAGGG + Intergenic
1077592188 11:3500673-3500695 CAGCGGTAGCAGCAGCTGGAGGG + Intergenic
1078257901 11:9675719-9675741 CAGGGAATGCAGGAGAAGGAAGG - Intronic
1078328371 11:10398525-10398547 CAGGGAAATCAGGGGAAGGATGG + Intronic
1078793183 11:14565788-14565810 AAGGTAAAGCAGCGGCAAGAAGG + Intronic
1079107018 11:17578291-17578313 CAGGGGCAGCAGCTGGAGGATGG - Intronic
1079495946 11:21044196-21044218 GCAAGAAAGCAGCAGCAGGAAGG + Intronic
1079541626 11:21582971-21582993 GTGAGAAAGCAGTAGCAGGATGG - Intergenic
1079796055 11:24804754-24804776 AAGAGAAAGCAGAAGCAAGAGGG - Intronic
1081252436 11:40851431-40851453 GAGGGTAAGCAGAAGCAGGGTGG - Intronic
1081659487 11:44879267-44879289 TAGGGAAAGAAGAAGGAGGAAGG - Intronic
1081801080 11:45859766-45859788 CAGCAGCAGCAGCAGCAGGAGGG - Intronic
1081962342 11:47147611-47147633 AAGGGAAAGGGGCAGCAGGAAGG + Intronic
1083236865 11:61356666-61356688 CAGGGACCCCAGCAGCAGGCAGG + Exonic
1083254048 11:61485607-61485629 CAGGAGAGGGAGCAGCAGGAAGG - Intronic
1084005843 11:66323082-66323104 CAGGCAAAGCAGGAGAAGAAAGG + Intergenic
1084014200 11:66369139-66369161 CAGGGCAAAGAGCAGCAGTATGG + Exonic
1084576201 11:69989492-69989514 GAGGGAAAGAGGGAGCAGGAGGG + Intergenic
1084824796 11:71722079-71722101 CAGCGGTAGCAGCAGCTGGAGGG - Intergenic
1085280122 11:75324724-75324746 CAGGCAAAGTCGCAGCAGAAAGG - Intronic
1085282613 11:75340918-75340940 CAGGGCCAGCAGCAGCAGTGTGG - Intronic
1085477092 11:76795627-76795649 CACGGCCAGCAGCAGCAGCAGGG - Exonic
1085783189 11:79428034-79428056 GGGAGAAAGCAGAAGCAGGAAGG + Intronic
1085986518 11:81794062-81794084 CGGTGAAAGCAGGAGCAAGAGGG - Intergenic
1087185223 11:95184263-95184285 GAGGGAAAGCAATAGCATGAGGG + Intronic
1087236406 11:95723746-95723768 CAGGGGAAGATGCAGCAAGAAGG - Intergenic
1087583989 11:100094734-100094756 CAGGGAAAGAAGAAGGAGGGAGG + Intronic
1087831057 11:102820212-102820234 GAGGGTAAGCAGGAGCAGGGTGG - Intergenic
1088598140 11:111455071-111455093 CAGAGGGAGCAGCAGCAGGTGGG + Exonic
1088626355 11:111733180-111733202 AAAGGGAGGCAGCAGCAGGAAGG - Intronic
1088687863 11:112299761-112299783 GAGGGAAAGCAGCACCCAGAGGG + Intergenic
1088702462 11:112425917-112425939 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1088737011 11:112736113-112736135 CAAGGCAGGCAGGAGCAGGAGGG + Intergenic
1089294564 11:117459866-117459888 CAGGGAAAGCAGCAGCTGCTGGG + Intronic
1089467149 11:118692704-118692726 CACGGACAGCTGCAGCAGGCTGG - Intergenic
1089615821 11:119694212-119694234 CAGGGGAAGCAGGAGCTGGCAGG + Intronic
1089766113 11:120766748-120766770 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
1089959089 11:122599835-122599857 CAGGGAAAGCAGAATGAGGAAGG - Intergenic
1090319883 11:125833065-125833087 CAGGGAAGGCAGAGGGAGGATGG + Intergenic
1090413321 11:126523711-126523733 CAAGGAAGGCAGCGGCAGCAGGG - Intronic
1090780200 11:130001472-130001494 CAGGCAAAGCAGCAGAATTAGGG + Intronic
1091213613 11:133885545-133885567 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1091275242 11:134345265-134345287 CAGGAAAAGCAGCACCCAGAGGG + Intronic
1091650476 12:2305388-2305410 CAGGGGAAGGAGCACCAGGCTGG - Intronic
1091721998 12:2820565-2820587 CAAGGGTAGCAGCAGGAGGAAGG - Intronic
1092060736 12:5548331-5548353 CAGGCAAAGCAGCAGGGGGTTGG + Intronic
1092304277 12:7283398-7283420 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1092418308 12:8308801-8308823 CAGCGGCAGCAGCAGCTGGAGGG + Intergenic
1092567777 12:9686143-9686165 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
1093255899 12:16867801-16867823 CAGAGAAAACAGCACCTGGATGG - Intergenic
1093510768 12:19924969-19924991 CAGTGAAGGAATCAGCAGGATGG + Intergenic
1093843296 12:23933216-23933238 CAGGGTTAGCTGGAGCAGGATGG - Intronic
1093910965 12:24747071-24747093 GAGGGAAGGCAGCAGCTGGGAGG + Intergenic
1093992927 12:25610310-25610332 GAGGGCAAGCTGAAGCAGGACGG - Intronic
1095262707 12:40115633-40115655 CAGTGGTAGCAGCAGCAGAAGGG + Intergenic
1096070195 12:48771088-48771110 CACTGATAGCAGCAGCTGGAAGG - Intronic
1096235765 12:49925199-49925221 CAGAGAAAGAGGGAGCAGGAGGG + Intergenic
1096443014 12:51662006-51662028 CAGGCAGAGCAGCAGCAGAAGGG - Intronic
1096548807 12:52359080-52359102 CAGAGAAAGAGGCTGCAGGATGG + Intergenic
1096715189 12:53486946-53486968 GAGCACAAGCAGCAGCAGGAAGG - Exonic
1097191499 12:57221575-57221597 CGGGGAGAGCTGCACCAGGAGGG - Intronic
1097360784 12:58656093-58656115 CAGGGCTATCAGCTGCAGGAAGG - Intronic
1097576429 12:61399146-61399168 TAGTGAAAGCAAGAGCAGGAAGG + Intergenic
1098306398 12:69107017-69107039 CATGGCAAGAAGAAGCAGGAAGG - Intergenic
1098377808 12:69836259-69836281 CAGAGACAGAAGCAGCTGGAGGG - Intronic
1098467080 12:70799856-70799878 CAGAGAGAGCAGCAGCAGGTAGG + Intronic
1098719300 12:73875317-73875339 TGGTGAAAGCAGGAGCAGGAGGG - Intergenic
1099239015 12:80116345-80116367 GAGGGCAAGCAGAAGCAGGATGG - Intergenic
1099745056 12:86690608-86690630 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
1100404826 12:94263801-94263823 CAGGGATAGAAGCTGCAGGGTGG + Intronic
1100768822 12:97898597-97898619 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1101180056 12:102206538-102206560 CAGAGAAAGCTGCAAAAGGAAGG - Intergenic
1101621606 12:106394278-106394300 CAGGGCAGGCAGCACCAGGAAGG + Intronic
1102650779 12:114440872-114440894 CACGGAAAGCAGAAGGCGGAAGG + Intergenic
1102773584 12:115499597-115499619 CAGTGGAGGCAGCAGCAAGAGGG - Intergenic
1102854795 12:116284187-116284209 CAGGGAAAGCAAATGCAGGCTGG - Intergenic
1103871235 12:124093761-124093783 CAGGGAAGGCAGCAGGAAGAGGG + Intronic
1104248290 12:127063880-127063902 CAGGGCAGGCAGGAGCAGGCTGG - Intergenic
1104749522 12:131229566-131229588 CAGGGACAGCGGCTGCAGGTGGG - Intergenic
1104984171 12:132587311-132587333 GAGGGAGGGCAGCAGCTGGAGGG + Intergenic
1105218444 13:18304189-18304211 CTGGGAGAACAGCAGCAGTAAGG - Intergenic
1105743069 13:23349101-23349123 CTGGAAAACCTGCAGCAGGAGGG + Intronic
1105943266 13:25170073-25170095 CCGGAGAAGGAGCAGCAGGAAGG - Exonic
1106042063 13:26103094-26103116 GAGGGCAAGCAGAAGCAGGATGG + Intergenic
1106124019 13:26885384-26885406 AGGGGAAAGTAGCAGGAGGAAGG + Intergenic
1106336667 13:28789462-28789484 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1106344427 13:28861851-28861873 CAGGGAAACCAGGCACAGGAGGG - Intronic
1106378893 13:29216655-29216677 CAGGGTGAGCAGAAGCAGGGTGG - Intronic
1107473538 13:40713148-40713170 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1107671390 13:42749941-42749963 GATGGTAAACAGCAGCAGGATGG - Intergenic
1107939631 13:45372394-45372416 GAGGGAGAGCAGCTGCAGGTTGG + Intergenic
1108234961 13:48394097-48394119 GAGGGCAAGCTGAAGCAGGATGG + Intronic
1108593950 13:51934677-51934699 CAGGACAGCCAGCAGCAGGATGG - Exonic
1108704108 13:52969576-52969598 TGGGGAGAGGAGCAGCAGGAAGG - Intergenic
1109304378 13:60622435-60622457 GGAGGAAAGCAGCAGCAGAAAGG - Intergenic
1110143986 13:72167336-72167358 CTGGGAGTGCAGCAGCGGGAGGG + Intergenic
1110696326 13:78495429-78495451 TAGGAAAACAAGCAGCAGGATGG + Intergenic
1110718707 13:78737532-78737554 CAGGGAAACCAGCAGGATCACGG + Intergenic
1110968689 13:81733369-81733391 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1112121762 13:96420095-96420117 AAGGAAAACCTGCAGCAGGAAGG - Intronic
1113552355 13:111202515-111202537 AATGGCAAGGAGCAGCAGGAGGG - Intronic
1113607377 13:111619993-111620015 TAGGGAAAGCAACAGGAGCAGGG - Intronic
1113782347 13:112983841-112983863 CAAGGAAAACAGCTGCAGCACGG - Intronic
1114744901 14:25136567-25136589 AAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117104184 14:52381982-52382004 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1117124463 14:52606938-52606960 CAGCAAATGCAGCAGCAAGAGGG - Intronic
1117272629 14:54160618-54160640 TAGGGAAAGGATCATCAGGAAGG - Intergenic
1117424666 14:55580965-55580987 CACGGAAAGCAGCATGAGGGGGG + Intronic
1117624134 14:57618382-57618404 GAGGGTAAGCAGAAGCAGGGTGG + Intronic
1117967638 14:61221807-61221829 CTGACAAAGCTGCAGCAGGAAGG - Intronic
1118174157 14:63421300-63421322 CAGAGAAGGCAGCACAAGGAAGG + Intronic
1118260647 14:64243790-64243812 CAGGGAAAGAACCATCAGAAAGG - Intronic
1119184772 14:72632620-72632642 GAAGGAAAGAAGCAGGAGGAAGG + Intronic
1119211645 14:72836439-72836461 CAGGGCAGGCAGGAGCAGGGAGG - Intronic
1119406336 14:74401938-74401960 CCTGGAACGCTGCAGCAGGAAGG - Intergenic
1119520264 14:75279658-75279680 ACGGGAACGCAGCGGCAGGATGG + Intronic
1119654685 14:76408747-76408769 CAGGGAAAGCTCCTGCATGAAGG + Intronic
1119719694 14:76882706-76882728 CAGGGGAAGCAGAAGCAGGCAGG - Intergenic
1119785499 14:77310650-77310672 CAGGGAAGGCAGGAGGAGGCAGG - Intronic
1120877609 14:89389102-89389124 CAGGGAGAGCTGCAGCCTGAGGG + Intronic
1121117964 14:91356883-91356905 GAGGGGGAGCACCAGCAGGAAGG + Intronic
1121495645 14:94390013-94390035 GAGGGAGGGCAGCATCAGGAGGG - Intronic
1121550518 14:94796137-94796159 CAGGGAAGGTAGCAGAGGGATGG + Intergenic
1122104446 14:99441612-99441634 CAGGGAAGCCTGCAGCAGGCAGG + Intronic
1122158359 14:99764701-99764723 CAGGCACAGAAGCAGCAGGGTGG + Intronic
1122319133 14:100843198-100843220 CGGAGAAATCAGAAGCAGGAAGG - Intergenic
1123477318 15:20598996-20599018 GAGGAAGAGGAGCAGCAGGAAGG - Intergenic
1123578369 15:21695059-21695081 GAGGGAAATCAGCAGGAGGTAGG + Intergenic
1123614994 15:22137541-22137563 GAGGGAAATCAGCAGGAGGTAGG + Intergenic
1123640698 15:22401386-22401408 GAGGAAGAGGAGCAGCAGGAAGG + Intergenic
1123811632 15:23932531-23932553 GTGAGAAAGCAGGAGCAGGAAGG + Intergenic
1124084119 15:26531195-26531217 CAGGGCAAGCAGAAACAGGGTGG + Intergenic
1124094158 15:26633318-26633340 CAGGGTCAGCTGCAGTAGGATGG - Intronic
1124244551 15:28058203-28058225 AAGGCAAAACTGCAGCAGGAGGG + Intronic
1124346384 15:28924149-28924171 GAGGGAAAGCAACAGCACCAGGG - Intronic
1124373214 15:29115159-29115181 TGGGGACAGCAGCAGCAGGCCGG + Intronic
1124577001 15:30918610-30918632 GAGGGAAGCCAGCAGCAGGACGG + Intronic
1124904636 15:33857299-33857321 CAGGGGAAGCGGCAGCGAGAGGG - Intronic
1124904910 15:33859134-33859156 CAGGGATTCCTGCAGCAGGAAGG - Intronic
1125180805 15:36879653-36879675 GAGGGAGAGGAGGAGCAGGAGGG + Intergenic
1125472768 15:40020824-40020846 AAGTGAAACCAGCATCAGGAGGG - Intronic
1125672031 15:41480694-41480716 CAGGGTCAGAAGCAGCAGGCTGG - Exonic
1126296993 15:47150804-47150826 TGGTGAAAGCAGAAGCAGGAGGG + Intergenic
1126398252 15:48242320-48242342 CAGGGAAAACAGCTCCAGGCTGG + Intronic
1126431314 15:48588004-48588026 CTGGAGAAGCAGCAGAAGGAAGG + Intronic
1126790209 15:52214109-52214131 CAGTGACAGAAGCAGAAGGAGGG + Intronic
1127137968 15:55944158-55944180 GAGGGCAAGCCGAAGCAGGATGG + Intronic
1127519911 15:59733644-59733666 CATGGAATGATGCAGCAGGAAGG + Intergenic
1129266058 15:74393734-74393756 CAGGGAAAGCGTCATCAAGAAGG - Intergenic
1129296278 15:74602086-74602108 CAGGGAAAGCAGCAGCAGGAGGG - Intronic
1129391963 15:75225174-75225196 CAGAGGGAGCAGCAGCATGAGGG + Intergenic
1129472413 15:75762988-75763010 CAGAGGGAGCAGCAGCATGAGGG - Intergenic
1129522696 15:76195939-76195961 CAGAGAGAGGAGGAGCAGGAGGG - Intronic
1129826005 15:78635457-78635479 CAGGGAGAGCTGCAGCTTGATGG + Exonic
1129850421 15:78790650-78790672 CAGGTACTGCAGCCGCAGGAGGG - Exonic
1130251843 15:82304872-82304894 CAGGTACTGCAGCTGCAGGAGGG + Intergenic
1130330523 15:82918656-82918678 CAGGGAGAACAGCAGCAGGGAGG - Intronic
1130556152 15:84923872-84923894 CACGGTAAGAGGCAGCAGGATGG - Intronic
1130879810 15:88045307-88045329 CAGGACAATCAACAGCAGGATGG - Intronic
1132032280 15:98447994-98448016 CTGAGAAAGTAGCAGCAGCAGGG - Intronic
1132050554 15:98604590-98604612 GAGAGAAGGCAGCAGAAGGAGGG + Intergenic
1132302411 15:100784204-100784226 CAGGGCAAGCTGCAGCAGAGGGG + Intergenic
1202987239 15_KI270727v1_random:429304-429326 GAGGGAAATCAGCAGGAGGTAGG + Intergenic
1132530256 16:444333-444355 TAAGGCAGGCAGCAGCAGGACGG + Intronic
1133138458 16:3728397-3728419 CAGCAACAGCAGCAGCAGCAAGG - Exonic
1134085570 16:11355213-11355235 CAGGTGAAGCAGGAGGAGGAAGG + Intergenic
1134507627 16:14821006-14821028 CAGGCAAAGCAGCAGCTGGGAGG + Intronic
1134695325 16:16219768-16219790 CAGGCAAAGCAGCAGCTGGGAGG + Intronic
1134762321 16:16725155-16725177 AAGCAACAGCAGCAGCAGGATGG + Intergenic
1134976507 16:18574918-18574940 CAGGCAAAGCAGCAGCTGGGAGG - Intergenic
1134983738 16:18634015-18634037 AAGCAACAGCAGCAGCAGGATGG - Intergenic
1135728185 16:24873192-24873214 AAGGGAAAGGAGAAGAAGGAAGG + Intronic
1135990464 16:27215864-27215886 GCTGGACAGCAGCAGCAGGAGGG + Intronic
1136353398 16:29727214-29727236 CAGGGAAAGAACCAGCTGAAAGG - Intergenic
1136358693 16:29763586-29763608 CAAGAAAAGCACCAGCAGGCTGG + Intergenic
1137290438 16:47048867-47048889 GAGGCCAGGCAGCAGCAGGAAGG + Intergenic
1137386510 16:48047531-48047553 AAGGGAAAGGAACAGGAGGAAGG + Intergenic
1137442027 16:48505962-48505984 CAGGGAAGGTAGGAGGAGGAGGG + Intergenic
1137988866 16:53131698-53131720 CAGGGAAAGAGGCTGCAGGATGG - Intronic
1138299266 16:55912630-55912652 CAGGGAAAAGACCAGGAGGAGGG + Intronic
1138520919 16:57570427-57570449 GAGGGAAAGCAGCACCAGGAGGG - Exonic
1139392822 16:66615982-66616004 CAGGAGAAGCAGCAGCAGAGAGG + Exonic
1139613256 16:68073946-68073968 CAGGGAAAGGAGCTCCAAGAAGG - Intronic
1139619464 16:68125541-68125563 CAGGGAAAGGCGCAGTAGGAAGG + Intronic
1140420839 16:74817518-74817540 CAGAGAAAGCAGCAGCAGCCAGG - Intergenic
1141344187 16:83230330-83230352 CCGGGAAAGCAGGCACAGGAAGG + Intronic
1141817819 16:86425011-86425033 CAGGATGAACAGCAGCAGGAGGG + Intergenic
1141862600 16:86728202-86728224 CAGGGAATGCGGGAGCAGGGTGG + Intergenic
1142041237 16:87895708-87895730 CAGAGACAGAAGCAGCAGGGCGG - Intronic
1142172582 16:88630642-88630664 CAGGGAGGCCAGCAGCAGCAGGG + Intronic
1142173463 16:88634550-88634572 CTGGAAAAGCGGCGGCAGGAAGG - Intergenic
1142541726 17:664920-664942 CAGGGAATGCAGGAGGAGGACGG + Intronic
1142765262 17:2060846-2060868 CAGGAAGAGGAGCAGCAGGAAGG + Exonic
1142766286 17:2066027-2066049 CAGGGTATGCAGCAGCTCGAGGG + Intronic
1143361127 17:6372186-6372208 GAGGAGAAGAAGCAGCAGGAGGG + Intergenic
1143972240 17:10804030-10804052 CAGAGAAGGCAGCAGCAGGCAGG - Intergenic
1144434202 17:15224397-15224419 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1144476552 17:15593988-15594010 CAGGGAAAGTAGCTGCAGAATGG - Intronic
1144725515 17:17499987-17500009 CTGTGCAAGCAGGAGCAGGACGG + Intergenic
1144764439 17:17725022-17725044 CAGGGTCAGCAGCCCCAGGAGGG - Intronic
1144783341 17:17818662-17818684 CAGAGAAAGCAGGAAGAGGATGG - Intronic
1144921700 17:18769413-18769435 CGGGGAAAGTAGCTGCAGAATGG + Intronic
1145779195 17:27550843-27550865 GAGGGACAGCAGCGCCAGGAGGG + Intronic
1146143535 17:30389221-30389243 AAGTGATAGCAGCAGCAGGCCGG - Intronic
1146453702 17:32993809-32993831 CAGGGGAAGGAGGAGCAGGAGGG + Intronic
1146501300 17:33367136-33367158 CACTGGAAGCACCAGCAGGAAGG - Intronic
1146746419 17:35334220-35334242 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1147319014 17:39634897-39634919 CAGGAAAAGCAGCAGGTGGCTGG + Intronic
1147522747 17:41190118-41190140 CAGGGTGTGCTGCAGCAGGAAGG - Exonic
1147526284 17:41226886-41226908 CAGGGTGTGCTGCAGCAGGAAGG - Exonic
1147527319 17:41238253-41238275 CAGGGTGTGCTGCAGCAGGAAGG - Exonic
1147528444 17:41249937-41249959 CAGGGTGTGCTGCAGCAGGAAGG - Exonic
1147529873 17:41265609-41265631 CAGGGTGTGCTGCAGCAGGAAGG - Exonic
1147530455 17:41271542-41271564 CAGGGTGTGCTGCAGCAGGAAGG - Intergenic
1147530868 17:41275914-41275936 CAGGGTGTGCTGCAGCAGGAAGG - Exonic
1147647115 17:42040509-42040531 CAGGGCATCCAGCAGCAGGTGGG + Intronic
1148038403 17:44686493-44686515 CAGGAAAAGGAGCAGCAGAGAGG + Intronic
1148229237 17:45920812-45920834 GAAGGATAGCAGCAGCATGAGGG + Intronic
1148260573 17:46179571-46179593 GACGGAAAGAAACAGCAGGAAGG + Intronic
1148673652 17:49432158-49432180 AAGGGAAGGCAGCATCAGGAAGG - Intronic
1148795669 17:50195569-50195591 CAGGGCCAGCAGCACCAGCAGGG + Exonic
1148818288 17:50346208-50346230 CAGGCCCTGCAGCAGCAGGATGG - Exonic
1148821946 17:50364945-50364967 CAGCAGCAGCAGCAGCAGGATGG - Intergenic
1149645305 17:58236581-58236603 TAGCAAAAGCAGCAGCAGCAGGG - Intronic
1150018982 17:61591187-61591209 CAGGGAACGCGGAAGCAAGATGG + Exonic
1150138578 17:62709987-62710009 CAGAGCAAAAAGCAGCAGGAGGG - Intronic
1150238268 17:63610860-63610882 CAGGTGAAGCAGCAGCTGGACGG - Intergenic
1150827095 17:68486584-68486606 GAAGGAAAGCAGAAGAAGGAAGG - Intergenic
1151562532 17:74878259-74878281 CTGGACCAGCAGCAGCAGGAGGG + Exonic
1151924104 17:77181189-77181211 CAGGGAGAGCATCAGCAAGAGGG - Intronic
1152008254 17:77695680-77695702 CAGGTGAAGCAGCAGCAGATTGG - Intergenic
1152694043 17:81734919-81734941 CAGGGGAAGCAGCTGCAGGCAGG + Intergenic
1152718833 17:81912623-81912645 AAGGGAAAGCGGCATCAGGCGGG + Intronic
1152727089 17:81952798-81952820 CAGGGAAAGCCGGGGCAGGAGGG + Exonic
1152772555 17:82179241-82179263 CAGGAAAAGCAGAGGCACGATGG + Intronic
1153118415 18:1689801-1689823 CAGGGAAAGCAGAGGAAGAAGGG + Intergenic
1153717933 18:7869491-7869513 GAGGGAGAGCAGAAGCAGGGTGG - Intronic
1153732223 18:8025934-8025956 CAGGGAGAGCAGAAGGAGAAAGG + Intronic
1153798378 18:8646574-8646596 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1154280340 18:12996667-12996689 AAGGGAAAGCAGCAGCTTGGTGG + Intronic
1155160235 18:23189628-23189650 CAGGGCAGGCGGCAGCAGGGAGG + Intronic
1155161647 18:23201041-23201063 CAGGGAGAGCAGAAGCAGGAAGG + Intronic
1155652468 18:28158512-28158534 CATGGAATGAAGCATCAGGAAGG - Intronic
1155724775 18:29067078-29067100 CTGGTAAAGCAGCATGAGGATGG - Intergenic
1155828899 18:30486640-30486662 CAGGCAAAGAAGTAGCAGAAAGG + Intergenic
1155857432 18:30850569-30850591 GAGGGCAAGCAGAAGCAGGATGG - Intergenic
1155898837 18:31362716-31362738 GAAGGAAAGCAGCAGGAGGTAGG + Intergenic
1156072650 18:33231629-33231651 CAGGCAGAGCTGCAGCAGCAAGG + Intronic
1156425020 18:37000882-37000904 CAGCAAAAGCAGCACCAAGAGGG + Intronic
1156760484 18:40583388-40583410 AGGGGTAAGCAGCAGCAGCAGGG - Intergenic
1156812946 18:41274238-41274260 CAGGGGAAAGAGTAGCAGGAGGG + Intergenic
1157005406 18:43577443-43577465 GAGGGAAAGAAGGAGAAGGAGGG - Intergenic
1157080318 18:44517777-44517799 AAGAGAAAGCAATAGCAGGAAGG + Intergenic
1157190706 18:45579079-45579101 CAGAGAAAGCAGAAGCTGCAAGG + Intronic
1157301934 18:46485399-46485421 CTGGGAATGCAGCAGGAGGTGGG + Intronic
1157513084 18:48292490-48292512 CAGGGACAGGCGCAGGAGGAGGG - Intronic
1158468909 18:57717163-57717185 CAGTGAAAGCAGTACTAGGAGGG + Intronic
1158644536 18:59232803-59232825 CAGGGAAAGCAGGAGCCTGGTGG + Intergenic
1159045692 18:63367065-63367087 CATGTACAGCAGCAGCACGAAGG + Exonic
1159339352 18:67115392-67115414 CAGTGAAAGCAGTACTAGGAGGG - Intergenic
1160239792 18:77114920-77114942 CAGGGAGAGCAGGAATAGGAAGG - Intronic
1160829834 19:1098589-1098611 GAGGGGAGGCAGCAGCAGGAGGG + Intergenic
1160851361 19:1194514-1194536 CAGGGCAAGAGGCAGGAGGAGGG - Intronic
1161009973 19:1955294-1955316 CAGCAGCAGCAGCAGCAGGAGGG - Intronic
1161166242 19:2789356-2789378 CAGCGAGAGCAGCTGCGGGAAGG - Intronic
1161650280 19:5480116-5480138 CAGAGAGAGCAGCCCCAGGAAGG + Intergenic
1161740917 19:6020713-6020735 CAGGAAAGGCAGCAGCTGGACGG + Intronic
1162099556 19:8331628-8331650 CAGGGCAAGCAGCTGGAGGTGGG + Intronic
1162496328 19:11025174-11025196 CAGGGACAGGGCCAGCAGGACGG - Intronic
1162529757 19:11229105-11229127 CAGGGGAAGATGCAGCTGGAGGG + Intronic
1162794254 19:13078462-13078484 CTGGGCAAGGAGCAGCAGGAGGG + Intronic
1162944191 19:14032260-14032282 TAGGGAAATGAGCAGCAGGAAGG - Intronic
1162967618 19:14163548-14163570 CCGTGACTGCAGCAGCAGGAGGG - Intronic
1163580343 19:18135059-18135081 CAGGGAGAGAAGCAGGAAGAGGG + Intronic
1163609320 19:18292830-18292852 GAGGGGAAGCTGAAGCAGGAAGG - Intergenic
1163690897 19:18737726-18737748 GAGGAGGAGCAGCAGCAGGAGGG - Intronic
1163728025 19:18933363-18933385 CAGGGAAGGGAACAGCAGGGAGG - Intronic
1164486699 19:28662994-28663016 CAGTAAAAGTAGCAGTAGGAAGG - Intergenic
1164493342 19:28735257-28735279 CAGGGCAAGAGCCAGCAGGAGGG + Intergenic
1164574853 19:29399925-29399947 AAGGGGAAAGAGCAGCAGGAGGG + Intergenic
1164821665 19:31255696-31255718 CAGGCAGAGCAGCAGCAGAGGGG + Intergenic
1164951423 19:32340270-32340292 CAGGAAACGCACCAGCAGGCTGG - Intergenic
1165254669 19:34568511-34568533 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1166065503 19:40356128-40356150 CAGGGAAAGCAGCTGTGGGAGGG + Intronic
1166099039 19:40560156-40560178 CAGGTACGGCAGCTGCAGGAGGG + Exonic
1166105737 19:40597266-40597288 CAGCAACAGCACCAGCAGGAGGG - Exonic
1166349581 19:42189448-42189470 CAGGGATTGAAGTAGCAGGAAGG - Intronic
1166934311 19:46321800-46321822 CAGGGAAGGCGGGTGCAGGAAGG - Exonic
1167406798 19:49315332-49315354 CAGAGAATGCAACAGCAGGTGGG + Intronic
1167428622 19:49442188-49442210 CAGGGAGAGAAGCAACAGGGAGG - Intronic
1167443681 19:49525045-49525067 CAGCAGCAGCAGCAGCAGGATGG - Intronic
1167581311 19:50344708-50344730 CAGAGGCAGCAGCAGCAGCAAGG + Intronic
1167584424 19:50365574-50365596 CAGAGGCAGCAGCAGCAGCAGGG + Exonic
1168000566 19:53442623-53442645 CAGAGGAAGGAGCAGCAGCAGGG - Intronic
1168005061 19:53480107-53480129 CAGAGGAAGGAGCAGCAGCAGGG - Intronic
1168110054 19:54187164-54187186 CAGCGTCAGCAGCAGCTGGACGG + Exonic
1168149978 19:54440806-54440828 CAGGGAAAGAACCACCTGGAGGG + Intergenic
924996803 2:368786-368808 CCCGAAAAGCAGCAGCAGTAAGG - Intergenic
925132452 2:1503469-1503491 CAGGGGGAGCAGGAGCAGGAGGG + Intronic
925246075 2:2384311-2384333 CAGGGAAAGGAGCATCAGCAGGG - Intergenic
925322872 2:2990393-2990415 CAGGGAAGGCAGTAACAGAATGG + Intergenic
925584071 2:5445227-5445249 TATGGAAAGAGGCAGCAGGAAGG + Intergenic
925627946 2:5860864-5860886 GAGGGCAAGCAGGAGCAGGGTGG - Intergenic
925668646 2:6289027-6289049 CAGAGAAAGGAGATGCAGGAAGG - Intergenic
925691683 2:6530727-6530749 CAGGGAAGGCAGAAGGAAGAAGG - Intergenic
925798315 2:7570510-7570532 CAGGGCAGGCAGCAGCAAGAAGG + Intergenic
926170243 2:10548658-10548680 CAAGGAAAGCCACAGCAGCAAGG - Intergenic
926314057 2:11696793-11696815 CAGAGCATGAAGCAGCAGGAAGG - Intronic
926725850 2:15997305-15997327 CAGGGCCACCAGCATCAGGAAGG - Intergenic
926757549 2:16248554-16248576 CAGGGAACCCAAAAGCAGGAAGG + Intergenic
926970680 2:18464164-18464186 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
927129447 2:20045915-20045937 CAGAGAAAGCACCCACAGGAGGG + Intronic
927208354 2:20624034-20624056 GTGGGAAGGCAGCAGCAGGGGGG + Intronic
927292923 2:21422282-21422304 CAGGGAGAGGAGAAGAAGGAGGG + Intergenic
927293955 2:21431990-21432012 CAGGGAGAACAGAAGCAGTAAGG + Intergenic
928181658 2:29072503-29072525 CACGGTAAGTGGCAGCAGGAGGG - Exonic
928704334 2:33931410-33931432 CAGGAAAAAGAGCAGCAAGATGG - Intergenic
928704497 2:33933378-33933400 CAGGCAAAAGAGCAGCAAGATGG - Intergenic
929219142 2:39445318-39445340 GAGGAAAAGTAGCAGTAGGAGGG - Intergenic
929256220 2:39813973-39813995 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
929333625 2:40713249-40713271 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
929389362 2:41451401-41451423 CAGGCAAAGCAAAAGCAGGCTGG + Intergenic
929631161 2:43463825-43463847 CAGGGAAGGAAAGAGCAGGATGG + Intronic
929666572 2:43838502-43838524 CTGGGGGAGCAGCAGCAGCAAGG + Intronic
929837934 2:45425661-45425683 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
930096428 2:47570252-47570274 CAGCAGCAGCAGCAGCAGGAGGG + Exonic
930108019 2:47655274-47655296 CAAGCAAAGCAGCAGCTGGAAGG - Intergenic
930126086 2:47797993-47798015 CAGGGAAAGCAGCATTATGAAGG - Intronic
930663786 2:54082064-54082086 CAGGGAGAGCAGCTCCAGGCTGG - Intronic
930864007 2:56105274-56105296 CAAGGAAAGGAGCAGCTGCAAGG - Intergenic
931049168 2:58390691-58390713 CAGGGAAAGCAGAGTTAGGAAGG - Intergenic
931212171 2:60207609-60207631 GAGGGAGAGCAGAAGCAGGGTGG - Intergenic
931231158 2:60375989-60376011 AAGGGAAAGCAGGAGGAGGCAGG + Intergenic
931287859 2:60847657-60847679 CAGGGAAAGCAGCACTGAGAAGG - Intergenic
931441884 2:62295880-62295902 CAGTGAGAGAACCAGCAGGATGG - Intergenic
931632747 2:64316028-64316050 CTGAGAAAACAGCATCAGGATGG - Intergenic
931634476 2:64329192-64329214 CGGGAAACGCAGAAGCAGGAAGG - Intergenic
932085826 2:68759095-68759117 CAGAGAAAGCAGGAGTAAGAGGG + Intronic
932125921 2:69145523-69145545 CATGGAAAGAAACATCAGGAGGG + Intronic
932646868 2:73511463-73511485 GAGGGTGAGCAGCAGCAGGGTGG - Intronic
933244269 2:79957595-79957617 CAGAGATTGCAACAGCAGGAAGG - Intronic
933354898 2:81198076-81198098 CAAGGAGGGCGGCAGCAGGAAGG - Intergenic
933718179 2:85377386-85377408 CAGGTAGAGCAGATGCAGGAGGG - Exonic
933758380 2:85658357-85658379 AGGGGAGAGCAGCAGCTGGAGGG + Exonic
933983048 2:87569208-87569230 AAGGGAAAGGAGCAACAAGAGGG - Intergenic
934908958 2:98233003-98233025 CAGAGATAGCAGGAGCAAGAGGG - Intronic
935187226 2:100745179-100745201 CAGGGACAGCAGACACAGGATGG - Intergenic
935259760 2:101344096-101344118 CAGGGCAGGCAGGAGGAGGAAGG + Intergenic
935403475 2:102684255-102684277 GAGGAAACACAGCAGCAGGAAGG - Exonic
935818437 2:106869570-106869592 GAGCAAAAGCAGCAGCAGGAGGG - Intronic
936159895 2:110076995-110077017 CATTGAGAGCAGCAGTAGGAAGG - Intergenic
936310796 2:111381586-111381608 AAGGGAAAGGAGCAACAAGAGGG + Intergenic
936398373 2:112147605-112147627 CAGGGAGGGCAGCAGCAAGGCGG - Intronic
937022525 2:118671364-118671386 CAGCAACAGCAGCAGCAGCAGGG - Intergenic
937038679 2:118803824-118803846 CTGGGGAAGGAGCAGCGGGAGGG - Intergenic
937203610 2:120222377-120222399 CAGGGACCGCAGGAACAGGAGGG + Exonic
937299986 2:120833145-120833167 CAGGGAAAGGAAATGCAGGAGGG - Intronic
937436379 2:121885121-121885143 CAGGGACAGCATCAGAATGATGG + Intergenic
937807205 2:126160627-126160649 GAGGGCAAGCTGAAGCAGGATGG + Intergenic
938099708 2:128490439-128490461 CAGGCAAAGGAGAAGGAGGAAGG + Intergenic
938127673 2:128686255-128686277 CAGGGGAAGGAGCCCCAGGATGG - Intergenic
938458830 2:131484585-131484607 CAGCGGCAGCAGCAGCAGCAGGG + Intronic
938941992 2:136177527-136177549 TTGGGAAAACATCAGCAGGAGGG + Intergenic
938970219 2:136424707-136424729 CAGGGGAGGCAGCAGGACGAAGG + Intergenic
939002717 2:136755001-136755023 CAGGGGAAGCAGTGACAGGATGG - Intergenic
939121924 2:138127429-138127451 CAGTGAAAGCAGTAGCCGGCTGG + Intergenic
939640930 2:144638977-144638999 TAGGGCAAGCAGAAGCAGGGTGG - Intergenic
939937848 2:148313935-148313957 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
940054624 2:149500507-149500529 GAGGGAGAGCAGAAGCAGGGTGG - Intergenic
940396634 2:153197892-153197914 CAGGGATAGCAGCCCCAGGCAGG + Intergenic
940565240 2:155351827-155351849 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
940677193 2:156738827-156738849 CAGGGAAATGAGCAGCTGGGTGG + Intergenic
940848013 2:158661902-158661924 CACAGGCAGCAGCAGCAGGAGGG - Intronic
940972767 2:159911714-159911736 AAGAGGAAGCAGCAGCAGTAGGG - Intergenic
941072062 2:160966678-160966700 CAGGGAGAGGAGCAGGGGGAAGG + Intergenic
941239471 2:163017909-163017931 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
941477963 2:165971643-165971665 GAGGGAGAGCAGAAGCAGGGTGG + Intergenic
941624768 2:167819518-167819540 CAGGGAAAGAAGCACCATGCTGG + Intergenic
942057588 2:172199016-172199038 CAGGCACAACAGCAGCAGCAAGG - Intergenic
942062589 2:172241351-172241373 CAGGGAAAGCAGGAACATAAAGG - Intergenic
942178787 2:173359955-173359977 GAGCAAAAGTAGCAGCAGGAAGG - Intronic
942343212 2:174972151-174972173 CAAGGAAACCAGTAGCAGCAAGG - Intronic
942898673 2:181089066-181089088 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
943004324 2:182371081-182371103 CATCCAAAGCAGCAGCTGGATGG + Intronic
943129887 2:183841720-183841742 CTGGGGAAGCAGAAGCAGGGTGG + Intergenic
943147767 2:184066433-184066455 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
944764265 2:202848983-202849005 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
945266127 2:207893098-207893120 CAGAGAAAGCAGCAGCCAGTTGG + Intronic
945927326 2:215819167-215819189 GAGGGCAAGCTGAAGCAGGATGG + Intergenic
945991683 2:216400838-216400860 CAGGGAATACAGAATCAGGAAGG - Intergenic
946385846 2:219384075-219384097 CAGGAAAAGCAGCAGGAGCAAGG + Intronic
946434144 2:219640886-219640908 CACCGTGAGCAGCAGCAGGAAGG - Exonic
947169565 2:227297941-227297963 CAGGGAAAGAAGAAGCAACAAGG - Intronic
947364595 2:229381118-229381140 GAGGGCGAGCAGAAGCAGGATGG + Intronic
947445095 2:230157167-230157189 AAGAGAAAGCAGCAGGGGGAAGG - Intergenic
947447913 2:230178868-230178890 CAGGGGAAGCAGTTGCAAGAGGG + Intronic
947745701 2:232506338-232506360 CAGGGAGAGAAGAAGCAGAAAGG + Intergenic
947871359 2:233440654-233440676 CAGGCCAGGCAGCAGCAGAAAGG + Intronic
947874891 2:233461480-233461502 CAGAGAATGCAGCGCCAGGAAGG - Intronic
947948220 2:234124765-234124787 CAGGGACAGCAGCAAGAGGCTGG - Intergenic
947975844 2:234365084-234365106 CAGGCAGAGTAGCAGCATGAGGG - Intergenic
948368604 2:237474030-237474052 CAGGTAAGGCAGCAGCACCAGGG + Intergenic
948540984 2:238691345-238691367 CAGGGACAGCAGCCACAGGTAGG - Intergenic
948595345 2:239076122-239076144 CCGGGATAGCAGTAGCAGGCGGG + Intronic
1168938711 20:1690759-1690781 GAGGGTAAGCAGAAGCAGGGTGG + Intergenic
1169111771 20:3038740-3038762 CAGAGAGAACAGCAACAGGAGGG - Intronic
1169187208 20:3628826-3628848 CAGGCTAAGAAGCAGCAGTAGGG - Intronic
1169214103 20:3783910-3783932 CTGGGAAAGGAGCAGCTGGACGG + Exonic
1169984189 20:11423418-11423440 GAGGGTAAGCAGAAGCAGGATGG - Intergenic
1170271407 20:14531095-14531117 CAGGGAAGGTAGGAGGAGGAGGG + Intronic
1170505841 20:17024959-17024981 CAGAGAAAGCAGAAGAAGGTGGG + Intergenic
1170601889 20:17847611-17847633 CAGGGAAGGAGGGAGCAGGACGG - Intergenic
1170790239 20:19502357-19502379 CAGGGAAAACAACAGCTGAAAGG + Intronic
1170918749 20:20655544-20655566 CAGGAACCACAGCAGCAGGAGGG + Intronic
1171030023 20:21668935-21668957 TAGGGAGATCTGCAGCAGGACGG + Intergenic
1171048468 20:21833388-21833410 CAGTTAATGCAGCAGTAGGAAGG - Intergenic
1171179832 20:23084396-23084418 CAGGGCCAGCAGGAGTAGGATGG + Exonic
1171225690 20:23440293-23440315 CAGGGCAATCAGCAGCAGCAGGG - Exonic
1171304269 20:24091899-24091921 CAGGGAAAGGAGAGGGAGGAGGG - Intergenic
1171435370 20:25118043-25118065 CAGGGAAAGCAGGATGAGGCTGG + Intergenic
1172031551 20:31985433-31985455 CAGGGAGAGGAGGAGCAGGCAGG + Intronic
1172771701 20:37386009-37386031 CAGGGAAGGCATGGGCAGGATGG - Intronic
1173203927 20:40976621-40976643 CAGTGAAAGCAGTACCAAGAGGG - Intergenic
1173264785 20:41469259-41469281 CAGGGACCTTAGCAGCAGGAAGG + Intronic
1173556984 20:43973288-43973310 CAGGAGAAGCAGCCGGAGGAGGG - Intronic
1173720616 20:45254499-45254521 CAGGGCAAGCAGCACCAGGAAGG + Exonic
1173900384 20:46583447-46583469 CAGTGAAAGGAGAAGCAGGAAGG + Intronic
1174096065 20:48090556-48090578 CATTGAAAGCTGCAGCAGTAGGG - Intergenic
1174556043 20:51396466-51396488 CTGAGAAAGCAGCAACAGGAAGG + Intronic
1174805699 20:53602691-53602713 CACACAAAGCAGTAGCAGGATGG - Intronic
1175203001 20:57290848-57290870 CAGGTGGAGCAGCAGCAGGCTGG - Intergenic
1175423354 20:58849852-58849874 TAGGAAAAGCAGAAGCAGCATGG - Intronic
1175437645 20:58965580-58965602 CAGGGAAGGCAGGAGCTGGGTGG - Intergenic
1175520534 20:59599884-59599906 CAAGGGAGGAAGCAGCAGGATGG - Intronic
1175737502 20:61397304-61397326 CAGGAAGGGCAGCTGCAGGAGGG + Intronic
1175874596 20:62223404-62223426 CAGAGGCAGCAGCAGCAGGTGGG - Intergenic
1176047643 20:63101064-63101086 CCGTGCAGGCAGCAGCAGGAAGG - Intergenic
1176148064 20:63574183-63574205 CAGGGCAGGCAGCTCCAGGAGGG - Intronic
1176733112 21:10520051-10520073 CACACAAAGCAGTAGCAGGATGG + Intergenic
1178255459 21:31048200-31048222 CAGTGAAAGCAGGAGAAGGCTGG + Intergenic
1178398140 21:32260612-32260634 CCGGCAAAGCAGCAGCAAGGAGG + Intergenic
1178436171 21:32560297-32560319 CAGGGAAAGCAGAGGAAGAAGGG + Intergenic
1178691672 21:34755064-34755086 CAGGAAAAGGAGAAGAAGGAAGG + Intergenic
1179150598 21:38805720-38805742 GAGGGAAGGGGGCAGCAGGAGGG - Intronic
1179356465 21:40664982-40665004 CGGGGAAAGCAGGAACAAGAGGG - Intronic
1179534311 21:42041360-42041382 CAGGGAGTGCAGCAGAAAGAAGG + Intergenic
1179644742 21:42768590-42768612 CAAGGACTGCAGAAGCAGGAGGG + Intronic
1180237105 21:46469337-46469359 CAGTGAACCCATCAGCAGGATGG + Intronic
1180252085 21:46596587-46596609 CAGGGACAGAGACAGCAGGAAGG - Intergenic
1180929368 22:19578544-19578566 CTGGGAATGCTGAAGCAGGAGGG + Intergenic
1181343618 22:22201448-22201470 CAGAGAAAGCAGCAGCTGCTGGG - Intergenic
1181441709 22:22939378-22939400 CAGGGAGAACACCACCAGGATGG + Intergenic
1181671925 22:24429608-24429630 CAGAGAGCACAGCAGCAGGAAGG - Intronic
1182033165 22:27176067-27176089 AAGGGAAAAAAGCAGAAGGAAGG + Intergenic
1182204262 22:28607881-28607903 GAGTGAAAGCAGAAGCAGGGAGG - Intronic
1182237224 22:28884590-28884612 CTGGACAAGCAGCAGCAGGCAGG + Intronic
1182451228 22:30423136-30423158 CAGGGATCGCAGCTGCAGGGAGG + Exonic
1183222960 22:36528956-36528978 GAGGGACGGCAACAGCAGGAAGG + Intronic
1183334215 22:37237382-37237404 CAGGGAGAGGTGGAGCAGGAGGG + Intronic
1183520833 22:38295251-38295273 CAGGCAAAGCTGGAGCAGAAGGG + Intronic
1183730895 22:39617811-39617833 CAAGGGAAGGAGCAGGAGGAGGG - Intronic
1184080815 22:42218780-42218802 CAGGGAAAACAGATACAGGAAGG + Intronic
1184677194 22:46050177-46050199 ATGGGGCAGCAGCAGCAGGAGGG + Exonic
1184747255 22:46463594-46463616 CGGGGAAAACAGCTGGAGGATGG - Intronic
1184978206 22:48078129-48078151 CTGGAAAAGCAGAAGCAGGAAGG - Intergenic
1185092800 22:48785373-48785395 CATGGACAGCAGGAGCATGAAGG + Intronic
1185155702 22:49192236-49192258 CAGGCAAGGCAGCTGCAGGCAGG - Intergenic
949954967 3:9259995-9260017 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
950157513 3:10734127-10734149 CATGGAATGCTGCAGCATGAAGG + Intergenic
950365122 3:12477697-12477719 CAGGGACAGCAGTTGCAGGGTGG + Intergenic
951201171 3:19876445-19876467 GATGGGAATCAGCAGCAGGATGG + Intergenic
951450573 3:22833222-22833244 CAGGGAAATCAGAAACAGCATGG + Intergenic
951629196 3:24699764-24699786 GAGGGAGAGCAGAAGCAGGGTGG - Intergenic
952050257 3:29376422-29376444 TATGTAAAGCAGCAGCAGGGTGG + Intronic
952506091 3:34007951-34007973 GAGGGGAAGCAACAGCAGAATGG - Intergenic
952655073 3:35776420-35776442 CAGGGAAAGCAGAGGAAGGGTGG + Intronic
952751284 3:36827015-36827037 CAGCAAAAGCAGCAGCAACATGG + Exonic
952752594 3:36837327-36837349 CAGGGTAGGCAGCATCTGGAGGG + Intronic
952852581 3:37741202-37741224 CAGAGAAAGCCTCAGCAGGGTGG - Intronic
952942517 3:38454919-38454941 CAGGGAAAGAGGGAGCAGGTGGG - Intronic
953240332 3:41142988-41143010 CTGGGAAAGCTCCACCAGGAAGG + Intergenic
953286561 3:41616488-41616510 GAGGGATAGCAGAAGCAGGGTGG + Intronic
953450476 3:43001275-43001297 CAAGAAAAGCAGCAGCTGGAAGG - Intronic
953475362 3:43201450-43201472 CTAGGAAATCAGCAGCAGAATGG - Intergenic
953576982 3:44120758-44120780 CTGTGTGAGCAGCAGCAGGAAGG - Intergenic
953577907 3:44128053-44128075 CAGGGAAGGAAGCACCAGGCAGG + Intergenic
953707950 3:45245397-45245419 TGGGGAAAGCAGGACCAGGAAGG + Intergenic
953822753 3:46222405-46222427 GAGGCAAGGCAGCAGCAAGAGGG - Intronic
953913364 3:46903862-46903884 CAGGGAAAGCTGTGGCGGGAGGG + Intergenic
954293856 3:49663487-49663509 CAGACACAGCAGCAGCAGCAAGG + Exonic
954330128 3:49885412-49885434 CAGAGCGAGCAGCAGCTGGATGG + Intergenic
954426669 3:50447040-50447062 CAGGGAAAGGTGTAGCTGGATGG + Intronic
954439822 3:50515795-50515817 CAGGGACAGGGGCAGCAGCAGGG - Intergenic
954930089 3:54273633-54273655 CACGGACAGCAGGAGCAGGCTGG + Intronic
956371775 3:68571020-68571042 CAGGTAAAGCAGCATGAGGGAGG - Intergenic
956406399 3:68932618-68932640 CAGGGACAGGAGCAGCCGGGCGG - Intergenic
956471060 3:69567245-69567267 CAGAGGAAGCAGCATAAGGAAGG - Intergenic
957210346 3:77250717-77250739 CAGGGAATGCTGCAGCAAGAAGG - Intronic
957776415 3:84760854-84760876 CAGGGCAAGCAGAAGCAGGGTGG + Intergenic
958154344 3:89734521-89734543 CAGGGAAAGAAGCAAAAAGAGGG + Intergenic
959040286 3:101414520-101414542 CAGGTGAAGCAGCAGCTGGACGG + Intronic
959345664 3:105191471-105191493 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
959578213 3:107957703-107957725 CAAGGAAAGGAGGAGGAGGAGGG + Intergenic
959882482 3:111460662-111460684 CAGGTAAATAAGCAGCAAGAGGG + Intronic
959883744 3:111475164-111475186 CTGGGAAAGCAGGCTCAGGATGG - Intronic
960732490 3:120742504-120742526 CAGGGAAGGCAGTGGCAAGATGG - Exonic
961219396 3:125187763-125187785 CAGGGGAATCAGCATGAGGAGGG - Intronic
961455066 3:127019956-127019978 CAGAGAAAGCATCAGCACCAGGG - Intronic
961488243 3:127232510-127232532 CAGGGAGGTCAGCAGGAGGATGG - Intergenic
961768301 3:129229210-129229232 CTGGGAGATCAGCAACAGGAAGG - Intergenic
961895992 3:130168015-130168037 CAGCGGCAGCAGCAGCTGGAGGG + Intergenic
962453817 3:135546961-135546983 CAGGGAAAGGTGCAAGAGGAGGG - Intergenic
963048531 3:141122914-141122936 GAGGGCAAGCGGAAGCAGGACGG - Intronic
963333193 3:143939326-143939348 CAGCAAAAGCAGCACCAAGAAGG + Intergenic
963629376 3:147713457-147713479 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
963680398 3:148367859-148367881 TAGGGAAAGCAGCATTTGGAAGG - Intergenic
963724092 3:148899828-148899850 CATACAAAGCAGCAGCAGCAAGG + Intergenic
963804896 3:149713739-149713761 CAGTGATAGCAGCAGCAGAGGGG + Intronic
965080205 3:164023704-164023726 CAGGCCAAGGAGCTGCAGGAGGG + Intergenic
965419137 3:168435513-168435535 CAGTAACAGCAGCAGCAGCAGGG + Intergenic
965439382 3:168694006-168694028 GAGGAGAAGTAGCAGCAGGAGGG + Intergenic
965511024 3:169568065-169568087 GAGGGTGAGCAGAAGCAGGATGG + Intronic
965885276 3:173437858-173437880 TAGGGAAGGCAGGATCAGGAAGG - Intronic
966309322 3:178576191-178576213 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
966446988 3:180011760-180011782 AAGGGAAGGGAGCAGGAGGAAGG - Intronic
966937843 3:184725577-184725599 CAGGGGAAGCTGCATCAGGACGG - Intergenic
966974083 3:185069891-185069913 CTGGGAAAGCAGCTGCAAGAGGG - Intergenic
967109008 3:186276720-186276742 CAGGGATAGCACATGCAGGAGGG - Intronic
967135657 3:186510643-186510665 CAGTGGAAGCAGCCACAGGATGG - Intergenic
967419653 3:189259293-189259315 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
967715503 3:192757902-192757924 GAGGGAGAGCAGAAGCAGGGTGG + Intronic
968137244 3:196228227-196228249 CAGGGGCAGCAGCAGCAGCAGGG - Exonic
968223972 3:196961025-196961047 CAGTCAAAGCAGCAGGAAGATGG - Intronic
968607007 4:1540303-1540325 CACGGAAGGCAGGAACAGGAAGG - Intergenic
968831201 4:2933789-2933811 CAGGGGCAGCAGCAGCGTGAAGG + Exonic
969042207 4:4307904-4307926 CAGAGAAAGCATGAGAAGGATGG - Intronic
969164902 4:5299092-5299114 AAGGGCAAGCAGAAGCAGGGTGG - Intronic
969307831 4:6335827-6335849 CAGAGCAGGCAGCAGGAGGAAGG + Intronic
969515342 4:7644711-7644733 GAGGGAAAGGAGCAGCTTGAGGG - Intronic
969591246 4:8123029-8123051 CAGGAAGAGCAGCAGCAGATAGG - Intronic
969670262 4:8586236-8586258 GGGGGAAAGCAGCAGGGGGATGG - Intronic
969689109 4:8694554-8694576 CAGGGAGAGCAGGTGGAGGAAGG + Intergenic
970004700 4:11399568-11399590 CAGGATGAGCAGCAGCCGGATGG + Exonic
970229212 4:13891560-13891582 TAGGGAAAGCAGCGGCGGGGTGG + Intergenic
970450989 4:16166263-16166285 CAGAGAAAACAAAAGCAGGACGG - Intronic
970679290 4:18489024-18489046 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
971125190 4:23746336-23746358 CAGGGAAATCAGCAGCTAAAGGG + Intergenic
971261742 4:25063482-25063504 CAGGGAATGGAGCAGAAGAATGG + Intergenic
971321866 4:25612181-25612203 CAGTGGAAGCAGCAGAAGGGTGG + Intergenic
971491338 4:27215336-27215358 CAGGAAAAGCAGCAAAAAGAAGG + Intergenic
971699781 4:29956164-29956186 CAAGGAAAACAGCTGAAGGAGGG - Intergenic
971813005 4:31452184-31452206 CAGGGAAAGCATCTGCATCAGGG + Intergenic
972156784 4:36172892-36172914 CACAGAAAGGAGCAGCAGGATGG - Intronic
972260945 4:37407878-37407900 GAGGGCGAGCAGAAGCAGGATGG + Intronic
972279496 4:37588444-37588466 CACTGCACGCAGCAGCAGGAGGG - Intronic
972372531 4:38438493-38438515 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
972962661 4:44473557-44473579 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
973629023 4:52801797-52801819 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
974264060 4:59560900-59560922 GAGGGCAAGCAGAAGCAGGTGGG - Intergenic
974385869 4:61201582-61201604 CAGAGAAAGCAGCAGGAGGGTGG - Intronic
974469946 4:62305754-62305776 CAGGGAAAGCAGTACTAAGAGGG + Intergenic
975096473 4:70462859-70462881 CAGGAACTGCAGCAGGAGGATGG + Intronic
975382106 4:73712548-73712570 CAGAGAAACCAGCAACAGGGTGG + Intergenic
975466418 4:74714252-74714274 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
975714788 4:77195249-77195271 CAGGGAAGGCTCCTGCAGGATGG + Intronic
976362981 4:84202471-84202493 GAGGGCCAGCAGAAGCAGGATGG + Intergenic
977792852 4:101128592-101128614 GAGGGCAAGCAGAAGCAGGGCGG + Intronic
978752812 4:112271497-112271519 CAGCAAAAGCAGTATCAGGATGG - Intergenic
979251941 4:118574840-118574862 AAGGGGAAAGAGCAGCAGGAGGG - Intergenic
979421310 4:120508953-120508975 GAGGGAAAGCAGAAGCAGGGTGG + Intergenic
979518460 4:121638745-121638767 CTGGGCAAGCAGCAGGAGGCTGG - Intergenic
979577622 4:122313670-122313692 CAGGACAAGCAGCAGCTGGTAGG + Exonic
979969054 4:127112167-127112189 CAGGCAAAGTAGCAGAAGCAGGG + Intergenic
980176649 4:129354174-129354196 CAGGCAGATAAGCAGCAGGAAGG + Intergenic
980494243 4:133570584-133570606 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
980769254 4:137350722-137350744 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
980888224 4:138786034-138786056 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
981085114 4:140675732-140675754 CATTGTAAGCAGCAGCATGATGG + Intronic
982794622 4:159630013-159630035 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
983047563 4:163005016-163005038 GAGGGCAAGCCGAAGCAGGATGG - Intergenic
983596390 4:169472430-169472452 GAGGGAGAGCAGAAGCAGGGTGG - Intronic
984526142 4:180861031-180861053 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
984858669 4:184217778-184217800 CAGGGCAAGGGCCAGCAGGAGGG + Exonic
984944878 4:184963025-184963047 CAGGGAAAACTGAAGGAGGATGG - Intergenic
985164623 4:187079341-187079363 CAGGCACAGCAGCAGCAGGCAGG + Intergenic
985184694 4:187303347-187303369 TAAGGGAAGAAGCAGCAGGATGG - Intergenic
985294827 4:188425512-188425534 AAGAGAAAGCAAGAGCAGGATGG - Intergenic
985341467 4:188959219-188959241 CAGCCAAAGCAGCAGCAGGAAGG - Intergenic
985884197 5:2663776-2663798 CAGGGAGAGAGGCAGCAGAAAGG - Intergenic
985986399 5:3520314-3520336 CAGGGAAAGCATCCCCAGCATGG - Intergenic
986047839 5:4057791-4057813 CTTGGAAAACACCAGCAGGATGG - Intergenic
986104211 5:4644290-4644312 CTGCGGAAGCGGCAGCAGGAAGG - Intergenic
986284649 5:6350504-6350526 CAAGGACAGCAGCAGCAGCAAGG - Intergenic
986323359 5:6652118-6652140 CAGAGAAAGCAGCAGCACCCCGG + Intronic
986358458 5:6951964-6951986 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
986512017 5:8517428-8517450 CAGAGCAAGCAGAAGCAGGGTGG - Intergenic
986675110 5:10177546-10177568 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
987793077 5:22593408-22593430 CAGGGAAAACAGGAGAAAGAAGG - Intronic
987901248 5:24014648-24014670 CAGGAAAAGCAGAAGCAGTTCGG - Intronic
988294074 5:29331951-29331973 CAGGAAAAGCTGGAGGAGGATGG + Intergenic
988481080 5:31631119-31631141 CAGGGCAGGCAGCCGCAGCATGG + Intergenic
988674830 5:33421635-33421657 CAGGGAAAGCAGAACAAAGATGG + Intergenic
988719121 5:33858855-33858877 GAAGGCAAGCAGAAGCAGGATGG + Intronic
989799710 5:45522759-45522781 TAGGAAAACAAGCAGCAGGATGG - Intronic
990803426 5:59631592-59631614 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
990872555 5:60448672-60448694 CAGGGAAGCCAGCATCAGAATGG + Intronic
990970644 5:61502197-61502219 CAGGGATGCCAGGAGCAGGAAGG + Intronic
991100879 5:62791234-62791256 CATGGAATGCTGCAGCAAGAAGG + Intergenic
991258997 5:64646490-64646512 CATGCAAAGCAGCAGGAGGAGGG + Intergenic
991398108 5:66225592-66225614 CAGGGAAAGAAGCAGGAGTTTGG + Intergenic
991631222 5:68657995-68658017 CTGGGAAAGGGGGAGCAGGAAGG + Intergenic
991708480 5:69383332-69383354 CAGTAAAAGCCCCAGCAGGATGG - Intronic
992383936 5:76265769-76265791 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
994412820 5:99431039-99431061 AAGGGAAATCAGCAGGAGAACGG - Intergenic
994481021 5:100334681-100334703 AAGGGAAATCAGCAGGAGAACGG + Intergenic
994744266 5:103659232-103659254 CAGGGAGAGCAGCAACAGGAAGG + Intergenic
994947727 5:106417289-106417311 CAGGTAGCTCAGCAGCAGGAAGG + Intergenic
994976780 5:106818379-106818401 CAGGTAAAGAAGGAGGAGGAAGG - Intergenic
995350824 5:111173459-111173481 AAGGAACAGCAGCAGAAGGAAGG + Intergenic
995378952 5:111511577-111511599 AAGGGAAAATAGCAACAGGAAGG + Intronic
995885328 5:116888152-116888174 AAGGGAGAGCAGCAGGAGGGTGG + Intergenic
996699435 5:126435471-126435493 CAGGGAGAGCAGAAGGGGGAAGG + Intronic
996910963 5:128656268-128656290 GAGGGGGAGCAGAAGCAGGATGG - Intronic
997334843 5:133099951-133099973 CAGGGAATGCAGCTGGAGCAGGG + Intronic
997367006 5:133332230-133332252 GAGCGAAAGCAGCAGCCTGATGG + Intronic
997520518 5:134521207-134521229 GAGGCAAAGCTGAAGCAGGAAGG - Intergenic
998199428 5:140107864-140107886 CAGGGGAAGGAGGAGGAGGAGGG + Intronic
999232186 5:150068239-150068261 CAGGAGCAGCAGCAGCAGCAAGG + Exonic
999244591 5:150147237-150147259 TGGGGAGGGCAGCAGCAGGATGG - Intronic
999496534 5:152104432-152104454 CTGGGAAGGCACCAGAAGGAAGG - Intergenic
999695397 5:154184489-154184511 CAAGGAAAGAAGAAGCAAGAAGG + Intronic
999741985 5:154562672-154562694 CTGGGAAAACAACAGCTGGAAGG - Intergenic
1000009443 5:157217747-157217769 CAGGGAAAACAACAGAAGAAAGG - Intronic
1000052024 5:157571682-157571704 GAGTGAGAGCAGAAGCAGGAAGG + Intronic
1000194858 5:158947487-158947509 GAGGGCGAGCAGAAGCAGGACGG - Intronic
1001094108 5:168762842-168762864 CAGGGAAGGCACCAGCAAGGTGG - Intronic
1001446329 5:171786758-171786780 TAGGAAAAGCCGCAGCATGATGG - Intronic
1001486487 5:172123204-172123226 CAGGGCAGGCATCTGCAGGAAGG + Intronic
1002056711 5:176602065-176602087 GAGGGAGAGCAGCAGCAGAAAGG - Intronic
1002209050 5:177585099-177585121 CAGAGAAAGAAGGAGGAGGAAGG + Intergenic
1002209884 5:177592285-177592307 CAGCCACAGCACCAGCAGGAGGG - Exonic
1002636827 5:180612778-180612800 CAGGGAAAGCATCACCAGGAGGG - Intronic
1002698330 5:181104875-181104897 GCGGAAAAGCAGCATCAGGATGG + Intergenic
1002708567 5:181180033-181180055 GCGGAAAAGCAGCATCAGGATGG - Intergenic
1003083907 6:3045687-3045709 CAGGTGAAGCAGCAGCTGGACGG + Intergenic
1003241962 6:4352890-4352912 GAGGGAAAGCTTCAGCACGAGGG - Intergenic
1003325000 6:5084793-5084815 TGGGGAAAGCAGGAGCAGAAGGG + Exonic
1003727164 6:8777957-8777979 CAGGGACAGCAGCAGCCAAAAGG - Intergenic
1003870388 6:10398307-10398329 CAGCAGTAGCAGCAGCAGGAAGG + Exonic
1003938745 6:11003120-11003142 AAGTGACAGCAGCAGCAGAAGGG - Intronic
1004620219 6:17324987-17325009 CAGGCCAAGGAGCTGCAGGAAGG + Intergenic
1005481422 6:26258844-26258866 CAGGGAAAGCAGCTACAGTAGGG + Intergenic
1006169595 6:32085438-32085460 CAAGGAAAGCTGCAGGTGGAGGG + Intronic
1006460399 6:34154662-34154684 GACAAAAAGCAGCAGCAGGAGGG + Intronic
1006905329 6:37529462-37529484 CTGAGACAGCGGCAGCAGGAAGG - Intergenic
1006948046 6:37798541-37798563 CAGGGAGGGCTGCGGCAGGAGGG + Intergenic
1007342578 6:41200976-41200998 CAGCAGCAGCAGCAGCAGGAAGG + Exonic
1007661645 6:43490393-43490415 CATGAGAAGCAGCAGCAGCATGG - Intronic
1007772648 6:44203474-44203496 AAGGGGAAAGAGCAGCAGGAGGG + Intergenic
1007833209 6:44654640-44654662 CAGGCAGAGCAGCGGCAGGGAGG - Intergenic
1008891510 6:56497869-56497891 CAAAGGAAGCAGCAGCTGGATGG - Exonic
1009242053 6:61195815-61195837 CAGCTAAACCAGCAGCAAGAGGG - Intergenic
1009264031 6:61531638-61531660 GAGGGCAAGCTGAAGCAGGATGG + Intergenic
1009352876 6:62704630-62704652 CAGTGAAGGCAGTAGCAAGATGG - Intergenic
1009404896 6:63300139-63300161 CAGGCAAAGCTGGAGGAGGAAGG - Intronic
1009455181 6:63848530-63848552 GAGGGCAAGCAGAAGCAGGGTGG + Intronic
1009893958 6:69723661-69723683 CAGCGAAAGTAGCAGTAAGAGGG + Intronic
1011000453 6:82582696-82582718 CATGTAAAGAAGCAGCAGGAAGG + Intergenic
1011290799 6:85774851-85774873 CAGCAAAAGCAGCACCAAGAGGG - Intergenic
1011839064 6:91473692-91473714 CTGGAAAAGCTGCAACAGGATGG - Intergenic
1011863892 6:91796170-91796192 CAGTGAAACGAGCCGCAGGATGG - Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012382636 6:98638662-98638684 CAGGAAAAGAAGAACCAGGAGGG - Intergenic
1012870376 6:104666150-104666172 CAGGCAAAGCAGCATTAAGAGGG + Intergenic
1013478328 6:110530021-110530043 GAGAGAGGGCAGCAGCAGGATGG + Intergenic
1013680375 6:112518884-112518906 CAGGGAAAGCAGAGGAAGAAAGG + Intergenic
1014507326 6:122275675-122275697 CAGGTAAAGCATCAACAGAAAGG + Intergenic
1014523981 6:122479044-122479066 AAGGGCAAGCAGAAGCAGGGTGG - Intronic
1014907078 6:127043393-127043415 CAGGGCAAGCCGAAGCAGGGTGG + Intergenic
1015210663 6:130694865-130694887 ATGGAGAAGCAGCAGCAGGAAGG + Intergenic
1015382876 6:132589459-132589481 CAGGGAGAGCAGCAGGAAGTTGG + Exonic
1016095882 6:140036581-140036603 CAGGAGAAGCAGCAGAAGAAAGG - Intergenic
1016120685 6:140338567-140338589 CAGGAAAAGCAGCACCAGAAGGG + Intergenic
1016166061 6:140945122-140945144 CTGTGAAAGCAGCAGGAGGAAGG + Intergenic
1017348896 6:153416492-153416514 CAGGGAAAGCAGAGGAAGAAGGG + Intergenic
1017598677 6:156058219-156058241 AGGTGAAAGCAACAGCAGGAGGG - Intergenic
1017769834 6:157636508-157636530 CAGGGAGCGAATCAGCAGGAGGG - Intronic
1018051260 6:160010573-160010595 TAAAGAAAGCAGCAGCAAGAAGG - Intronic
1018051818 6:160015895-160015917 CAGCAAAAGCAGGAGCAAGACGG - Intronic
1018377122 6:163223511-163223533 ATGGGAAAGCAGAAGAAGGATGG + Intronic
1018452121 6:163919099-163919121 GAGGGGATCCAGCAGCAGGAAGG + Intergenic
1018963454 6:168465241-168465263 CACAGAAAGCAGCGGCAGGATGG - Intronic
1019073938 6:169371608-169371630 CAGAGCGAGCAGCACCAGGAAGG + Intergenic
1019289272 7:242438-242460 CTGAGAAAGCAGAAGGAGGAGGG + Intronic
1019549245 7:1594006-1594028 GAGGGAAAGAAGAAGGAGGAGGG - Intergenic
1019622005 7:1997251-1997273 CAGGTAAAGGAGCTGCAGGCTGG + Intronic
1019648563 7:2143970-2143992 CAGGCAAAACAGCACCAGGCAGG + Intronic
1019667385 7:2258663-2258685 GAGAGACAGCAGCTGCAGGAAGG + Intronic
1019826028 7:3285114-3285136 GAGGGAAGGCAGCAGGAAGAGGG - Intergenic
1020210016 7:6152129-6152151 CTCGCAAAGCAGCAGCAGGACGG + Intronic
1020339071 7:7089572-7089594 GAGGGTAAGCAGAAGCAGGGTGG - Intergenic
1020430599 7:8113020-8113042 CAGATAAGGCAGCAGCAGGAAGG - Intergenic
1020446293 7:8272164-8272186 CAGGGAAAGAACCATCAGAAAGG - Intergenic
1020715974 7:11675113-11675135 GAGGGCAAGCAGAAGCAGGTGGG + Intronic
1021159572 7:17255374-17255396 CAGCTAAAGCAGCATTAGGAGGG + Intergenic
1021442248 7:20689684-20689706 CTGGGAAAGCTCCTGCAGGATGG - Intronic
1021574426 7:22094273-22094295 GAGGGAAGGCAGTGGCAGGAGGG + Intergenic
1021918608 7:25460584-25460606 CAGGGACAGAAGCACAAGGAAGG + Intergenic
1023046550 7:36215197-36215219 CAGGGAGGGCAGCAGCGGGTGGG - Intronic
1023609197 7:41956985-41957007 AAGGGAAACCAGGAGCAAGAGGG + Intergenic
1023728039 7:43164227-43164249 CAGAGAAGGCAGGAGGAGGAAGG + Intronic
1023953287 7:44865103-44865125 CAGGCAAAGTAGGACCAGGAAGG + Intergenic
1024017643 7:45332692-45332714 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1024171357 7:46791147-46791169 AAGGGAAAGCAAGAGAAGGAAGG + Intergenic
1024664993 7:51537073-51537095 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1024674576 7:51626723-51626745 GAAGGGAAGCAGCAGCAGGAGGG - Intergenic
1024835257 7:53510839-53510861 CAGGAAGAGCAGGACCAGGAAGG + Intergenic
1024860775 7:53837296-53837318 CAGTGAAAACAGCAGTAAGAGGG + Intergenic
1026074239 7:67151785-67151807 CAAAAAAAGCAGCAGCAGCATGG - Intronic
1026206297 7:68260709-68260731 AAGGGAAAGAAGAAGGAGGATGG - Intergenic
1026463927 7:70637668-70637690 CAAGAAAAGCAGCCCCAGGAAGG + Intronic
1026502387 7:70953725-70953747 AAGGCAAAGGAGAAGCAGGATGG + Intergenic
1026979680 7:74519087-74519109 CAGGCAATGCAGAGGCAGGAAGG + Intronic
1027853481 7:83479207-83479229 CAGAGAAAGCAGGGGTAGGAAGG - Intronic
1029002905 7:97174346-97174368 CAGGGGAAGTAGCTGCAGAAAGG - Intronic
1029543927 7:101200566-101200588 AAGGGAAGGGAGCAGCTGGAGGG - Intronic
1029610236 7:101622768-101622790 CAGGGACAGGAGTAGCAGCATGG - Intronic
1029677085 7:102077230-102077252 CAGAGAAAGCAGCAGCAGGGAGG + Intronic
1029693920 7:102201059-102201081 CGGGGAAAGGAGCCCCAGGAGGG + Intronic
1030109399 7:106013633-106013655 CTGGGAAAGCAGCAGCCTCAGGG + Intronic
1030153529 7:106429050-106429072 CAGGGCAAGAAGCAGGAGTATGG - Intergenic
1030209379 7:106981246-106981268 CAGCAAAAGCAGGAGCAAGAGGG - Intergenic
1030737131 7:113062563-113062585 CAGGCAAAGCAAAAGCAGGCTGG + Intergenic
1031613852 7:123857477-123857499 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
1032162676 7:129522793-129522815 CAAGGACAGCAGCAGCAGCGTGG + Intergenic
1032957201 7:136984741-136984763 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
1033600327 7:142884437-142884459 CAGGGAAAGCCCCAACAGGCAGG + Intronic
1034446608 7:151117007-151117029 AAAGCAAAGAAGCAGCAGGAGGG - Intronic
1034849565 7:154481065-154481087 CAAGCCCAGCAGCAGCAGGAAGG + Intronic
1034931701 7:155168337-155168359 CAGAACATGCAGCAGCAGGAGGG - Intergenic
1035100069 7:156389244-156389266 CAGGGACACCAGCTGGAGGAAGG - Intergenic
1035194677 7:157206823-157206845 CTGTGAAAGCAGGAGCAGGATGG + Intronic
1035408718 7:158619834-158619856 CAGGGAAAGAATCACCAGGCTGG + Intergenic
1036052084 8:5210075-5210097 CAGGTAGAGCAGGAGCAGAAGGG - Intergenic
1036544828 8:9757564-9757586 CTGGGAAGGAAGGAGCAGGAAGG - Intronic
1036626818 8:10479298-10479320 CAGGGCGACCCGCAGCAGGAGGG + Intergenic
1037835640 8:22213410-22213432 CAGAGGAAGCAGCAGCAGGGAGG - Intergenic
1038044026 8:23750819-23750841 CAGGGAAAGGAGAACAAGGAAGG - Intergenic
1038416135 8:27397367-27397389 CTGGGAAAGATGCAGCAGAAAGG - Intronic
1039007842 8:33060490-33060512 CAGGGAACTCTGAAGCAGGACGG - Intergenic
1039503349 8:38033682-38033704 GAGGGAAAGAAGCAGCAGTTGGG + Intronic
1040444360 8:47478422-47478444 CAGAGACAGAAGAAGCAGGAAGG + Intronic
1040561634 8:48527951-48527973 CAGGGAAGGAAGGAACAGGATGG - Intergenic
1040977929 8:53214846-53214868 CAGGCAAAGCAGCACAGGGAAGG + Intergenic
1041630658 8:60083230-60083252 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1041746160 8:61211358-61211380 AAGGGAAAGAAGGAGAAGGAGGG - Intronic
1041900718 8:62979009-62979031 GAGGGCAAGCAGAAGCAGGGTGG - Exonic
1042040807 8:64586620-64586642 CATGGAAAGCAGGAGTGGGAGGG + Intergenic
1042880244 8:73479928-73479950 CAGGGAAACCAGTAGGAAGACGG - Intronic
1042947307 8:74168121-74168143 GAGGGAAAGAAGCAGCACCAAGG - Intergenic
1042969386 8:74391475-74391497 GAGGGCAAGCAGAAGCAGGGTGG - Intronic
1043750603 8:83929263-83929285 AAGGGAAAGGAAGAGCAGGAAGG - Intergenic
1044422929 8:92019400-92019422 CAGAGAAAGGAAGAGCAGGAGGG + Intronic
1044595354 8:93953565-93953587 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1046153560 8:110258200-110258222 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1046447908 8:114347316-114347338 AAAGAAAAGCAGCAGCAAGAGGG - Intergenic
1046598545 8:116289949-116289971 GAAGGAGAGAAGCAGCAGGATGG + Intergenic
1046695639 8:117336249-117336271 CAGGGAAGGCAGCAAGAAGAAGG - Intergenic
1046776010 8:118164114-118164136 GAGGGAGAGCAGCAGGAGGAAGG + Intergenic
1047079358 8:121442882-121442904 CAGGGACAGAAGCTGCTGGACGG - Intergenic
1048306832 8:133290277-133290299 CAGGAAGAGCAGCCACAGGAAGG + Intronic
1048331078 8:133471151-133471173 CAGGGAAACCAACAGCAGCTGGG - Intronic
1048496745 8:134942011-134942033 CTGGGAAAGCAGGAGCTGGAGGG - Intergenic
1048553428 8:135454804-135454826 CTGGGAAGGCAGAACCAGGAAGG + Intergenic
1049352413 8:142171311-142171333 CAGGGGCTGCAGCTGCAGGAGGG - Intergenic
1049428298 8:142547401-142547423 GAGGGAAAGCAGCAGAAGTTTGG - Intergenic
1049747392 8:144268816-144268838 CAGGGACAGAGGCAGCAGCAGGG + Intronic
1049777272 8:144412562-144412584 CAGGGACAGCAGCAGCAGGACGG + Exonic
1049804136 8:144531301-144531323 CAGGGCAGGGAGCAGCAGGTGGG + Intronic
1049804161 8:144531419-144531441 CAGGGCAGGGAGCAGCAGGTGGG + Intronic
1049804187 8:144531537-144531559 CAGGGCAGGGAGCAGCAGGTGGG + Intronic
1049804201 8:144531596-144531618 CAGGGCAGGGAGCAGCAGGTGGG + Intronic
1049804215 8:144531655-144531677 CAGGGCAGGGAGCAGCAGGTGGG + Intronic
1049804228 8:144531714-144531736 CAGGGCAGGGAGCAGCAGGTGGG + Intronic
1049804242 8:144531773-144531795 CAGGGCAGGGAGCAGCAGGTGGG + Intronic
1049804268 8:144531891-144531913 CAGGGCAGGGAGCAGCAGGTGGG + Intronic
1049804282 8:144531950-144531972 CAGGGCAGGGAGCAGCAGGTGGG + Intronic
1049804295 8:144532009-144532031 CAGGGCAGGGAGCAGCAGGTGGG + Intronic
1049804308 8:144532068-144532090 CAGGGCAGGGAGCAGCAGGTGGG + Intronic
1049818695 8:144621110-144621132 CAGGGCAGGCAGCTGCAGGCTGG - Intergenic
1050105746 9:2164624-2164646 CATGGAAATCAGCATCAGCAAGG - Intronic
1051160285 9:14199966-14199988 CAGGGAGAACAGGAGCAGAAGGG + Intronic
1051222870 9:14868924-14868946 CAGGAGGAGCAGCAGCAGCACGG + Exonic
1051695895 9:19767597-19767619 GAGGGTAAGCAGAAGCAGGGTGG - Intronic
1051808032 9:21018006-21018028 CACAGAAAGCAGCAACAGGATGG + Intronic
1052217288 9:25982668-25982690 CAGGGCAAGCTGAAGCAGGGCGG + Intergenic
1052343581 9:27386054-27386076 AAGGAAAAGCAGCAGCAGGATGG - Intronic
1052882564 9:33612694-33612716 CAGGAAGAAAAGCAGCAGGAAGG - Intergenic
1053329498 9:37190210-37190232 CAGTGACAGCAGCAGCAGTGGGG - Intronic
1053364970 9:37516312-37516334 CAGGGAGAGCTGTTGCAGGAAGG + Intronic
1055624948 9:78166836-78166858 CAGGGAAAAAAGCAGGAAGAAGG - Intergenic
1055823970 9:80301562-80301584 GAGGGCGAGCAGAAGCAGGATGG - Intergenic
1056180198 9:84075622-84075644 CAGCAACAGCAGCAGCAGCAGGG - Intergenic
1056294239 9:85175645-85175667 GAGGAATAGCAGCAGCAGGTGGG - Intergenic
1056562332 9:87742355-87742377 CAAGAAAAGCAGCTGCAGCAAGG + Intergenic
1056661137 9:88544238-88544260 GAGGGAGAGCAGGAGCAGGCTGG + Intronic
1056790021 9:89619213-89619235 CAGGGACTGCACCAGCAGGGAGG + Intergenic
1057167624 9:92941139-92941161 GAGGGAAAACAGCAGGGGGAAGG + Intergenic
1057470999 9:95356144-95356166 CAGAGAAAGCAACAGCAGAGAGG - Intergenic
1057653960 9:96937999-96938021 CAGGTAGAGCAGCAGAGGGAGGG + Exonic
1057834143 9:98430575-98430597 CAGGGAAAGAACCAGCAGAAAGG - Intronic
1058620629 9:106879200-106879222 CTGGGCAAGCAGCAGCATGGGGG + Intronic
1059373330 9:113861649-113861671 CAGAGAACTCAGCAGGAGGATGG - Intergenic
1059529451 9:115022477-115022499 CATGGAAAGGAGCCACAGGAGGG - Intronic
1060755084 9:126206679-126206701 CAGGGAGAGCAAGAGAAGGAAGG - Intergenic
1061312165 9:129770908-129770930 CTGGGAAAATAGCCGCAGGATGG + Intergenic
1061563035 9:131418672-131418694 CAGGGACAGCTGCAGCTGGCTGG + Intronic
1061950081 9:133931284-133931306 CAGAGAGCCCAGCAGCAGGAGGG + Intronic
1062288442 9:135784130-135784152 GCGGGGAAGCGGCAGCAGGAGGG + Intronic
1062376357 9:136263617-136263639 CAGGCCAAGCTGCAGCAGGTGGG - Intergenic
1062482856 9:136760439-136760461 CAGGAAACGCAACAGCAGCACGG + Intronic
1062509149 9:136895273-136895295 CAGGCAGAACCGCAGCAGGAAGG - Intronic
1062520690 9:136956642-136956664 CAGAGAAAGCTGCTGAAGGATGG + Intronic
1062612996 9:137383346-137383368 CAGGGCCTGCAGGAGCAGGAGGG + Exonic
1062729815 9:138102643-138102665 CAGGAGGAGCGGCAGCAGGAGGG - Intronic
1186188934 X:7050341-7050363 CAGGGAATTCAGCACCAGGGTGG + Exonic
1186200536 X:7151536-7151558 GGAGGAAAGCAGCAGCGGGAAGG - Intergenic
1186685652 X:11922374-11922396 CAAGGACAGCACCAACAGGATGG + Intergenic
1186832432 X:13404141-13404163 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1187056230 X:15743748-15743770 CAGGGGATGCAGCAGGAGGTGGG - Intronic
1187155141 X:16714680-16714702 CAGGGGAGGCTGAAGCAGGAAGG + Intergenic
1187289564 X:17940068-17940090 CAGTGAGAGCAGAAGCAGGAGGG - Intergenic
1188326723 X:28813198-28813220 CAGTGAAAGCAGCACCTAGAGGG - Intronic
1188915654 X:35906815-35906837 CAGGGAAAGCAGTACTAAGAGGG - Intergenic
1189173837 X:38934437-38934459 CTGGGAGAGCAGCAATAGGAAGG - Intergenic
1189175533 X:38953616-38953638 AGGGGGAAGCAGCAGCAGGAAGG - Intergenic
1189953844 X:46258715-46258737 TAGAGAGAGCAGCAGCAGCATGG - Intergenic
1189999348 X:46670534-46670556 CAGTGATAGCAGCAGCTGCAGGG + Intronic
1190144154 X:47875147-47875169 CAGAGCAAGGAGGAGCAGGAGGG + Intronic
1190301974 X:49062341-49062363 CAGGGGAGGAGGCAGCAGGAGGG - Intronic
1190708528 X:53049292-53049314 CAGGGAAAGCAGGCACCGGAGGG - Exonic
1191094428 X:56659427-56659449 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1191119660 X:56890468-56890490 GAGTGTAAGCAGAAGCAGGATGG + Intergenic
1191606165 X:63065475-63065497 GAGGGGAAGCAGAAGCAGGGTGG + Intergenic
1191657374 X:63613313-63613335 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1191802632 X:65098592-65098614 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1191809865 X:65175174-65175196 GAGGGTAAGCAGAAGCAGGGTGG - Intergenic
1192204688 X:69088222-69088244 CAGGGAAATCAGAACCAGGCTGG - Intergenic
1192958257 X:76096140-76096162 GAGGGTAAGCAGAAGCAGGATGG - Intergenic
1193040540 X:76999266-76999288 CAGGGTAAGCAGAAGTAGGGTGG - Intergenic
1193043882 X:77032069-77032091 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1193228498 X:79013712-79013734 GAGGGCAAGCAGAAGCAGGATGG - Intergenic
1193254102 X:79325977-79325999 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1193341384 X:80352970-80352992 GAGGGTAAGCAGAAGCAGGGTGG - Intronic
1193394396 X:80967449-80967471 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1193404398 X:81083781-81083803 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1193871121 X:86799533-86799555 GAGGGAGAGCTGAAGCAGGATGG + Intronic
1193897181 X:87128461-87128483 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1193933579 X:87586618-87586640 CAGGAAAACCAGCACTAGGAGGG + Intronic
1194360676 X:92946483-92946505 CAGGAAAAGCAGTACTAGGAGGG - Intergenic
1194431751 X:93816262-93816284 CAGGGAAAGCAGTACTAAGAGGG + Intergenic
1194798481 X:98241138-98241160 CAGGGCAAGCCGAAGCAGGGTGG - Intergenic
1194892294 X:99394957-99394979 CAGTGAAAGCAGCAGTAAGAGGG - Intergenic
1195140021 X:101950016-101950038 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1195421766 X:104683455-104683477 CAGAGAAAGAAGCAGAATGACGG + Intronic
1195435996 X:104843688-104843710 GAGAGCAAGCAGAAGCAGGATGG - Intronic
1195810708 X:108825504-108825526 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1195820952 X:108944660-108944682 GAGGGCAAGCAGAAGCAGGGTGG - Intergenic
1196577275 X:117334133-117334155 CAGGGAAAGTAGGAGCTGAAGGG - Intergenic
1196792631 X:119478063-119478085 TAGGGAAAGAAGCTGCAGGGAGG + Intergenic
1196946678 X:120833355-120833377 CAGGGCAAGCTGAAGCAGGGTGG - Intergenic
1197063820 X:122215050-122215072 GAGGGAAAGAAGAAACAGGAAGG - Intergenic
1197184665 X:123573356-123573378 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1197360833 X:125501473-125501495 CAGCAAAAGCAGTAGCAAGAGGG - Intergenic
1197391665 X:125874649-125874671 CAGCCAAAGCAGCAGTAAGAAGG - Intergenic
1198645577 X:138802388-138802410 AAGGGTGAGCAGAAGCAGGATGG - Intronic
1198801552 X:140452791-140452813 CAGGGGTAGCAGAGGCAGGAAGG + Intergenic
1199600237 X:149537324-149537346 AGGGGAAGGCAGGAGCAGGACGG + Intergenic
1199650347 X:149942616-149942638 AGGGGAAGGCAGGAGCAGGACGG - Intergenic
1200668874 Y:6062298-6062320 CAGGAAAAGCAGTACTAGGAGGG - Intergenic
1201543145 Y:15131532-15131554 GAGGGCAAGCAGAAGCAGGGTGG + Intergenic
1201590552 Y:15610496-15610518 GAGGGTGAGCAGAAGCAGGATGG + Intergenic