ID: 1129297620

View in Genome Browser
Species Human (GRCh38)
Location 15:74608618-74608640
Sequence CTGGCCCAGGGGCAGGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 952
Summary {0: 1, 1: 0, 2: 6, 3: 106, 4: 839}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129297620_1129297633 2 Left 1129297620 15:74608618-74608640 CCTCCCACCTGCCCCTGGGCCAG 0: 1
1: 0
2: 6
3: 106
4: 839
Right 1129297633 15:74608643-74608665 GGAGGGGCTTGGCCATATGTAGG 0: 1
1: 0
2: 0
3: 11
4: 138
1129297620_1129297631 -9 Left 1129297620 15:74608618-74608640 CCTCCCACCTGCCCCTGGGCCAG 0: 1
1: 0
2: 6
3: 106
4: 839
Right 1129297631 15:74608632-74608654 CTGGGCCAGCAGGAGGGGCTTGG 0: 1
1: 0
2: 17
3: 83
4: 787
1129297620_1129297634 11 Left 1129297620 15:74608618-74608640 CCTCCCACCTGCCCCTGGGCCAG 0: 1
1: 0
2: 6
3: 106
4: 839
Right 1129297634 15:74608652-74608674 TGGCCATATGTAGGCGAGACAGG 0: 1
1: 0
2: 0
3: 3
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129297620 Original CRISPR CTGGCCCAGGGGCAGGTGGG AGG (reversed) Intronic
900093023 1:928737-928759 CAGGCCCAGTGGCCGGTGAGGGG + Intronic
900110932 1:1005307-1005329 CTGGGCCAAGGTCAGCTGGGTGG + Intergenic
900151463 1:1180936-1180958 CGGGCGCAGGGGCAGGGGTGGGG - Intronic
900192740 1:1358363-1358385 CTGGCCCAAGCTCAGATGGGCGG + Intronic
900208318 1:1440954-1440976 CTGGGCCCAGGGCAGGTGGCTGG + Exonic
900245548 1:1634489-1634511 CTCGCCCAGGGCCAGGTAGCCGG - Exonic
900256777 1:1701646-1701668 CTCGCCCAGGGCCAGGTAGCCGG - Intronic
900409247 1:2505346-2505368 CGGGAGCAGGGGCAGGAGGGAGG - Exonic
900505352 1:3027610-3027632 CTCCACCAGGGGCAGGCGGGGGG + Intergenic
900515806 1:3081734-3081756 CTGGCCACAGGGCACGTGGGAGG + Intronic
900528087 1:3138947-3138969 CTGGCCGAGGGGGAGGTGAGAGG - Intronic
900539153 1:3194116-3194138 CCGGGCAAGGGACAGGTGGGAGG + Intronic
900617164 1:3570701-3570723 CTGGCACAGGGGCAGGGCAGGGG - Intronic
900732528 1:4271702-4271724 CTGGACCAGAGGCAGTCGGGAGG - Intergenic
900770945 1:4543616-4543638 CAGGCACAGGTGCAGGTAGGTGG - Intergenic
900780572 1:4614990-4615012 TGGGCCCATGGGCAGGTGGCTGG + Intergenic
900862501 1:5243525-5243547 CTGTCCTAGAGGCATGTGGGTGG + Intergenic
900956253 1:5888001-5888023 CTGGCCCAGGGAAACGGGGGAGG - Intronic
901004991 1:6167189-6167211 GTCCCCCCGGGGCAGGTGGGAGG + Intronic
901239053 1:7682346-7682368 CTGGCCCTGGGGTAGGTGTCTGG + Intronic
901257306 1:7841217-7841239 GTGGCCCATGGGCAGGAAGGGGG + Intronic
901672831 1:10866328-10866350 CTGGTGGGGGGGCAGGTGGGGGG - Intergenic
901692162 1:10980665-10980687 TCGGCCCGGTGGCAGGTGGGGGG + Intronic
902332908 1:15739309-15739331 GGGGCCCAGGCGCAGGTAGGCGG - Exonic
902383247 1:16062385-16062407 CTGGCCCTGGGGCGGGGGGGGGG - Intronic
902391978 1:16112271-16112293 CAGCCCCAGGGGGAGATGGGAGG - Intergenic
902543896 1:17174157-17174179 GTGGCCCAGGGGTAGGGGAGGGG - Intergenic
902939936 1:19793719-19793741 CTGGAGGAGGGGCAGGAGGGTGG + Intronic
903055469 1:20633432-20633454 CAGGCGCAGGCGCTGGTGGGCGG - Intergenic
903056853 1:20641997-20642019 CTTGCCCAGGGGCCCGAGGGTGG + Intronic
903172092 1:21560748-21560770 GAGGCCCAGGGGCCTGTGGGAGG + Intronic
903225976 1:21894454-21894476 CTGCCCCAAGGGCAGCTGGCAGG + Intronic
903285346 1:22273489-22273511 CTGGCCCTGGGCTAGGTGGGGGG - Intergenic
904273398 1:29364942-29364964 CTGGCTCAGGGGCAGGCAGATGG + Intergenic
904354049 1:29927009-29927031 TTGGCCCTGGTGCAGGTGGTGGG - Intergenic
904622266 1:31782534-31782556 CTGGCCTGGGGTCTGGTGGGTGG - Intergenic
904684682 1:32251497-32251519 CTCGCTCAAGGTCAGGTGGGAGG + Intronic
904741939 1:32684200-32684222 CTGGCTGAGGGGATGGTGGGAGG - Exonic
904773613 1:32894122-32894144 CGGGCCTTGGGGCTGGTGGGTGG - Exonic
904822510 1:33255418-33255440 CTGGCCCAGCGGTCGGGGGGTGG + Intergenic
904873221 1:33634840-33634862 GTGGCCAAGGAGCAGGAGGGAGG - Intronic
905044082 1:34982826-34982848 CTAGCCCAGGGGCTGTTGGTTGG + Intronic
905504368 1:38465498-38465520 CTGGGCCAGAGGCAGGAGGAGGG - Intergenic
905798842 1:40830728-40830750 CTGGGCCTGGCGCAGGTGAGTGG - Intronic
905851354 1:41277418-41277440 CTGGGGCAGGGGCCCGTGGGTGG + Intergenic
905874956 1:41426697-41426719 CTGTCCCCGGGCCTGGTGGGAGG + Intergenic
905997081 1:42390563-42390585 ATGTCACAGGTGCAGGTGGGTGG + Intronic
906210632 1:44010659-44010681 GTGGCCCAGGCCCTGGTGGGTGG + Intronic
906411851 1:45584736-45584758 CCGGCCCTGGGGCAGGGGGCGGG + Intronic
906662174 1:47590719-47590741 CTGGTACATGGGAAGGTGGGAGG + Intergenic
907304950 1:53508268-53508290 CTGGCACGGGCGCAGGTGTGTGG + Intronic
907306799 1:53517800-53517822 CTGGCCCCGGGGCAGGGGCAAGG - Intronic
908271448 1:62426498-62426520 TAGCCCCAGGGTCAGGTGGGAGG - Intergenic
908509518 1:64840288-64840310 CTGGCCTCGGGGACGGTGGGGGG + Intronic
909940848 1:81610054-81610076 CTCCCCAAGAGGCAGGTGGGAGG - Intronic
910099719 1:83563137-83563159 CTGGTCCAGGAGCAGGAGTGAGG - Intergenic
910487378 1:87730421-87730443 CATGCCCAGAGGCAGGAGGGTGG - Intergenic
910694306 1:89995389-89995411 CTGGGCCCGGGGCGGGCGGGCGG - Intronic
911070105 1:93825639-93825661 TTGGCCCTGGGGAAGGAGGGTGG - Intronic
911396318 1:97315200-97315222 CTGGCCCAGCTGCAGGAGTGTGG + Intronic
912385710 1:109270290-109270312 CTGGGCCAGAGGCAGGTGCTGGG - Intronic
912449503 1:109760502-109760524 CTGGGCCCTGGGCAGGGGGGTGG - Intronic
912451392 1:109769796-109769818 CTGGGCCAGGTGCTGCTGGGAGG + Intronic
912473994 1:109924245-109924267 CTGGCGGGGGTGCAGGTGGGGGG + Intronic
912518384 1:110229711-110229733 CTTGCGCAGGGGCAGCTGAGGGG + Intronic
912950318 1:114116262-114116284 CTGCCTCAGGGGAAGGAGGGAGG + Intronic
913045603 1:115071147-115071169 CAGGCCCAGGGGAGGGTGTGAGG + Intronic
913199681 1:116485535-116485557 CTGGCCCAGGGCATGCTGGGAGG - Intergenic
913260005 1:116989268-116989290 GTGGACATGGGGCAGGTGGGTGG - Exonic
914775190 1:150728987-150729009 CTGTCCGGGAGGCAGGTGGGGGG - Intergenic
915102923 1:153513720-153513742 CTGGACAAGGGGCTGGTGGTTGG - Intergenic
915345069 1:155193142-155193164 CTGGCTCCGGGGGAGGGGGGAGG + Intergenic
915569502 1:156736698-156736720 CTGACCCAGGGGCATCTTGGTGG - Exonic
915914777 1:159934374-159934396 CTGGCCCAGGGGAAGGGAGCAGG + Intronic
915937348 1:160097336-160097358 CTGGTCCCTGGGCAGGTGGCAGG - Intronic
916090565 1:161305451-161305473 CAGCCCCCGGGGCAGGTGAGGGG + Exonic
916215137 1:162387434-162387456 CTGGCCCAGGGGCAGCAAAGGGG - Intergenic
916443098 1:164846716-164846738 TTGGGGCAGGGGCAGGAGGGAGG + Exonic
916572355 1:166038860-166038882 CGGGCCCAGGAGCAGGGGCGGGG - Intergenic
916684721 1:167134052-167134074 CTGGCCCAGGTGCAGGCAAGAGG - Intergenic
916715305 1:167442614-167442636 CTGGCCCAGGGGCAGGAAGGGGG - Intronic
917089332 1:171337074-171337096 CTGGCACAGGTGCAGGTGTCTGG + Intronic
917437509 1:175036059-175036081 CTGGGCCACAGGCAGCTGGGAGG - Intergenic
919256542 1:195132429-195132451 CAGTCCCAGCGACAGGTGGGAGG - Intergenic
919727135 1:200891658-200891680 AGGGCGCAGGGGCAGGCGGGCGG + Intronic
920043810 1:203120823-203120845 CTGGCCTTGTGTCAGGTGGGGGG + Intronic
920207875 1:204306295-204306317 CTTGTACAGGGGCTGGTGGGTGG - Intronic
920231836 1:204475824-204475846 CTGGCCCAGAGCCAGGAGGATGG - Intronic
920295253 1:204952148-204952170 CAGGCCCAGAGGCAAGCGGGTGG - Intronic
920451710 1:206064636-206064658 CCGTCCCGGGGGGAGGTGGGGGG + Intronic
920560066 1:206932517-206932539 CAGGCCCAGGGGCACCAGGGTGG + Exonic
921219884 1:212965908-212965930 GTGCCCCAGGGCCAGGTTGGAGG + Intronic
922698144 1:227742172-227742194 GTGGGCTAGGGGCAGGGGGGAGG - Intronic
922709413 1:227815872-227815894 CTGCCCCAGGGGCGGATGGGCGG + Intronic
923306274 1:232691707-232691729 CTTACCCATGGGCAGGTGAGAGG - Intergenic
923437039 1:233977129-233977151 CAGACCCACGGGGAGGTGGGTGG - Intronic
923663564 1:235979495-235979517 TTGGCCCAGGGTCACGTGGCCGG - Intronic
923765291 1:236887684-236887706 ATGGCCCTGGGGCAGCAGGGCGG - Intronic
923791519 1:237115237-237115259 CTGGCCCAGAGCAAGGGGGGGGG - Intronic
924501846 1:244645500-244645522 CGTGCCCAGAGGCGGGTGGGAGG - Intergenic
924707472 1:246511541-246511563 CTGGCCCATGGGCAGTTTTGGGG - Intergenic
1062760035 10:11300-11322 CTGCCACGGGGGGAGGTGGGGGG - Intergenic
1062928331 10:1335150-1335172 CTGCCCCAGGCGCAGGTAGCTGG - Intronic
1063365618 10:5488588-5488610 CCTGCCCAGGGGCAGAAGGGAGG + Intergenic
1065139377 10:22705548-22705570 GTGCCTCAGGGGCTGGTGGGAGG - Intronic
1065144254 10:22751959-22751981 CTGGCCCAATGGCAGGGGGAAGG + Intergenic
1065877198 10:30007745-30007767 CTGGGGCAGGGGCAGCTGGTGGG - Intergenic
1067060485 10:43075770-43075792 CTTGCTGAGGGGCAGGTGGCCGG - Intergenic
1067148512 10:43710841-43710863 GTGGACCAGGGGTAGGTGGCAGG + Intergenic
1069379555 10:67828993-67829015 CGGGCGCAGAGGGAGGTGGGGGG + Intronic
1069876817 10:71568128-71568150 CTGGCCCAGTGGCTGTGGGGAGG + Intronic
1070290211 10:75108975-75108997 CTGGCCAAGGGGCATGGGGGTGG - Intronic
1070525645 10:77293642-77293664 CAGGCCAAGGGGAAGGTTGGAGG - Intronic
1070554243 10:77515812-77515834 CCAGCCCAGGGGCTGGAGGGAGG - Intronic
1070731761 10:78833682-78833704 CGGGTCAAGGGGCAGGAGGGAGG - Intergenic
1070788428 10:79175727-79175749 CTGGCCCATGGGGAGTGGGGAGG - Intronic
1070825438 10:79387865-79387887 CTGGGCCAGGGGCAGAAGGGTGG - Intronic
1072619040 10:97067809-97067831 CTGGCCCAGGAGGAGGAGGTGGG - Intronic
1072727033 10:97821133-97821155 CTGTCCCAGAGCCAGGCGGGTGG + Intergenic
1073219641 10:101859887-101859909 CTGGTCCATGGGCAGATGGAGGG + Intronic
1074208456 10:111305177-111305199 TTGGGGGAGGGGCAGGTGGGAGG + Intergenic
1074535341 10:114324912-114324934 CTGGCCCAGGAGACAGTGGGAGG + Intronic
1075688484 10:124379919-124379941 CAGGCCCAGGGGTTGGTGGTGGG - Intergenic
1075709098 10:124521251-124521273 CCGGCCCAGCGGCAGGTGCCCGG - Intronic
1075727548 10:124618257-124618279 GTGGGCCAGGGGCTGGCGGGGGG - Exonic
1075763095 10:124871457-124871479 CCTGCCTATGGGCAGGTGGGTGG - Intergenic
1075799873 10:125146972-125146994 CTGGACCAGGTGCAGCTGGGTGG - Intronic
1076093771 10:127713666-127713688 CTGACCAGGGAGCAGGTGGGCGG - Intergenic
1076137856 10:128057234-128057256 CTGGCCCAGCAGCAGGGGGGCGG + Intronic
1076383845 10:130043595-130043617 CAGACCAAGGGGCAGGTTGGGGG + Intergenic
1076473917 10:130739261-130739283 CTGGGCCAGGGCCAGGCAGGTGG + Intergenic
1076635574 10:131880145-131880167 CTGACCCAGGTGCTGATGGGTGG + Intergenic
1076685751 10:132197772-132197794 CTCGGGCAGGGGCATGTGGGGGG + Intronic
1076769015 10:132652981-132653003 CTGGCCGATGTGCAGGTGGGCGG + Intronic
1076850860 10:133092008-133092030 CTGGCCCAAAGGCAGGTTGTGGG + Intronic
1076907913 10:133372692-133372714 GCGGGCCAGGGTCAGGTGGGTGG + Intronic
1076931432 10:133534389-133534411 CTGCCCCAGGTGCCGCTGGGAGG - Intronic
1077144761 11:1039978-1040000 CTGGCCGAGGGGCAGGGAAGGGG - Intergenic
1077144771 11:1040001-1040023 CTGGCCAAGGGGCAGGGAAGGGG - Intergenic
1077184638 11:1230702-1230724 CTGGCCTGGGGGCTGGAGGGGGG - Intronic
1077229863 11:1453925-1453947 CTGGCCCCCGCGCTGGTGGGTGG + Intronic
1077305749 11:1868044-1868066 GTTGCCCAGGGGCAGGCAGGAGG - Intronic
1077402595 11:2366533-2366555 CTGGCCCAGGGCCAGGGGCTGGG + Intergenic
1077406900 11:2386772-2386794 CTGGGCCAGGAGGGGGTGGGAGG - Intronic
1077494917 11:2882266-2882288 CTGCCCCCGGTGGAGGTGGGAGG + Intergenic
1078577042 11:12511380-12511402 CTCAACCAAGGGCAGGTGGGTGG + Intronic
1079135026 11:17771573-17771595 CAGTCCCAGGGCCAGGCGGGGGG - Intronic
1079927467 11:26512459-26512481 CTGGCCAGGGGGCTGGTGCGGGG - Intronic
1080230116 11:30011390-30011412 CTGGCCCAGCAACAGGGGGGTGG - Exonic
1080467352 11:32510164-32510186 CTGGACCTGGGGCTGGAGGGAGG - Intergenic
1080858503 11:36132894-36132916 CTTGCCCAGGGTCACGTGGCTGG - Intronic
1080888324 11:36387000-36387022 CTGGCGCAGGGGCAGGCGTGGGG + Intronic
1081861001 11:46333276-46333298 ATGGCCGAGGGGCAGGGCGGCGG + Intronic
1082090558 11:48085950-48085972 CTGGCCCAGGGGTCTGGGGGTGG + Intronic
1082162502 11:48900583-48900605 CTGGCAGCGGGACAGGTGGGAGG + Intergenic
1082174904 11:49048576-49048598 CCGGCAGCGGGGCAGGTGGGAGG + Intergenic
1082238919 11:49852153-49852175 CCGGCAAAGGGGCAGGTGGGAGG - Intergenic
1082243222 11:49892177-49892199 CTGGCAGCGGGGCAGGTGGGAGG + Intergenic
1082657722 11:55873002-55873024 CCGGCAGCGGGGCAGGTGGGAGG + Intergenic
1082880005 11:58028055-58028077 CAGGCCCTGGGGCAGATGGTGGG + Intronic
1083258442 11:61510350-61510372 CTGGCCCAGGAGCAGGGGCTTGG + Exonic
1083281477 11:61629626-61629648 CAGGCCCTGGGGGAGGGGGGCGG + Intergenic
1083595616 11:63917243-63917265 CTGGCCCTGGGGTGGGAGGGAGG + Intergenic
1083611661 11:64007323-64007345 CTGGCCCCGAGGAAGGAGGGAGG + Intronic
1083611777 11:64007790-64007812 CTGGCACAGGGACAGGTGCGGGG + Intronic
1083662182 11:64256548-64256570 CTGGCTGGGGTGCAGGTGGGTGG + Intronic
1083694861 11:64436124-64436146 CTGGCCCAGAGCCATGTGGTAGG - Intergenic
1083710659 11:64546374-64546396 CAGGCCCAGGGGCAGGCTGGAGG + Intergenic
1083811355 11:65108537-65108559 CTGGCGCAGGAGCAGGGTGGTGG + Exonic
1083826407 11:65206452-65206474 CTGGCCCACCAGCTGGTGGGAGG - Exonic
1083839687 11:65297156-65297178 CTTACCAAAGGGCAGGTGGGAGG + Exonic
1083952363 11:65963962-65963984 CAGGCCCAGGTGCTGGTGAGGGG + Intronic
1084006727 11:66327016-66327038 CTGGCCCTGGGTGGGGTGGGTGG + Intergenic
1084040372 11:66539286-66539308 CTGGCAAAGGGGCAGCTAGGCGG + Exonic
1084043180 11:66554513-66554535 CTGGGTCGGGGGGAGGTGGGAGG - Intronic
1084383996 11:68830649-68830671 CTGGCGGAGGGGCAGGTGACAGG - Intronic
1084588831 11:70078749-70078771 CTCGCCAAGGCGCAGGTGCGCGG - Intronic
1084589028 11:70079447-70079469 CTGGCCCTGGGGAGGGTGGTGGG - Intronic
1084594954 11:70111345-70111367 CTTGCCCTCGGACAGGTGGGGGG + Intronic
1085122075 11:73973690-73973712 CTGGGGCAGGGGCAGGTGGAGGG + Intergenic
1085417059 11:76326138-76326160 CTGCCCCTGGGGTGGGTGGGTGG + Intergenic
1085489640 11:76903447-76903469 GTGGGCCGGGGGCGGGTGGGGGG - Intronic
1085512122 11:77093725-77093747 CTGGCCCTGGTGCAGGTCGTGGG - Exonic
1085933322 11:81112957-81112979 CTGGCACAGGTGCAGGTATGTGG - Intergenic
1086690870 11:89787510-89787532 CCGGCAGCGGGGCAGGTGGGAGG - Intergenic
1086697650 11:89864000-89864022 CTGGCAGCGGGGCAGGTGGGAGG + Intergenic
1086708509 11:89980488-89980510 CTGGCAGCGGGGCAGGTGGGAGG - Intergenic
1086714930 11:90052145-90052167 CCGGCAGCGGGGCAGGTGGGAGG + Intergenic
1087822400 11:102727250-102727272 CTGCCGAAGGGGCAGGAGGGAGG - Intergenic
1088756607 11:112890278-112890300 TTGGCCCAGGCTCAGGTTGGAGG - Intergenic
1089009239 11:115119273-115119295 CTGGCCCAAGGGAAGGGGGAGGG + Intergenic
1089074173 11:115724774-115724796 ATGGCCAAGGGGAAGATGGGAGG - Intergenic
1089495021 11:118903376-118903398 CTCGCTGAGGGGCAGTTGGGTGG + Exonic
1089643816 11:119864969-119864991 ATGGCCCAGGGGCACCAGGGAGG + Intergenic
1089685246 11:120142406-120142428 CTTGCCCAGGGGCAAGGGGATGG - Intronic
1090003161 11:122979253-122979275 CTGTCCGAGACGCAGGTGGGCGG - Exonic
1090146377 11:124327605-124327627 CGGGCACAGAGGAAGGTGGGAGG + Intergenic
1090214341 11:124947648-124947670 CTGGCCCAGGTGCTAGTGGGAGG + Intergenic
1090383525 11:126343403-126343425 CTCCACCAGGGGCAGGTGAGTGG + Exonic
1090505629 11:127310549-127310571 CTGGCCCATGGGAAGTTGTGAGG - Intergenic
1090832007 11:130426758-130426780 CTGGGCTAAGGGCAGCTGGGTGG + Intronic
1091196155 11:133732607-133732629 CTGGACAAGGGGCAGGGGGATGG - Intergenic
1091566770 12:1654534-1654556 CTGGCCGGGGGTGAGGTGGGAGG + Intergenic
1091740673 12:2959021-2959043 CTGTCCCGGGGGCGGGGGGGTGG - Intergenic
1091781541 12:3217198-3217220 GAGGCCCAGGGGCAGGTGGAAGG - Intronic
1092242103 12:6841401-6841423 GTGGCCCAGGGGGAGGGGGCTGG + Intronic
1093493171 12:19726832-19726854 AGGGCCCAGGAGCAGGCGGGAGG - Intergenic
1096002431 12:48140857-48140879 CTGGCCAAGGGGCAGGTATGGGG + Exonic
1096461086 12:51821709-51821731 CAGGCCCGGGGTCAGGTAGGGGG + Intergenic
1096499148 12:52054908-52054930 CTGGGGCTGGGGCCGGTGGGAGG - Exonic
1096856520 12:54488117-54488139 CTGTCCGAGAGGGAGGTGGGGGG - Intergenic
1097176814 12:57147964-57147986 CTGGGCCAGCGGCAGAGGGGAGG - Intronic
1097182930 12:57181139-57181161 ATGGTCTGGGGGCAGGTGGGAGG - Exonic
1097439799 12:59595967-59595989 CCGGCCCGGGGGGTGGTGGGGGG - Intergenic
1098918364 12:76280040-76280062 CTGGGCTAGGGCCAGGTGGAAGG + Intergenic
1098918389 12:76280215-76280237 CTGGGCTAGGGCCAGGTGGAAGG + Intergenic
1099487493 12:83246500-83246522 CGGGCACAGAGGGAGGTGGGGGG - Intergenic
1101059918 12:100960020-100960042 CTGCCCCAGAGGCAGGTGTCTGG - Intronic
1101779043 12:107819039-107819061 ATTGCCCAGGGGCATGTAGGTGG - Intergenic
1103023943 12:117558465-117558487 CTGCCCTAGGGGCAGGGGTGAGG - Intronic
1103292391 12:119857515-119857537 TTGGCCCAGGAGCAGGTAGGAGG - Exonic
1103367659 12:120394849-120394871 CCAGCCAACGGGCAGGTGGGAGG - Intergenic
1103934738 12:124469127-124469149 CTGGCCCAAGGTCAGATGGAAGG + Intronic
1103993553 12:124814894-124814916 CTGCACAAGGGGCAGGCGGGAGG + Intronic
1104056753 12:125236626-125236648 CTGTCCCAGGGGCAGCAGTGGGG - Intronic
1104448887 12:128853680-128853702 CTGGGCCGGGGGCCGGGGGGCGG + Intronic
1104842090 12:131830208-131830230 CGGGCAGGGGGGCAGGTGGGTGG - Intronic
1104926186 12:132315095-132315117 GTGGCCCAGGGGGAGGTGGTGGG + Intronic
1104980588 12:132571615-132571637 CCAGCCCAGGAGGAGGTGGGGGG + Intronic
1105027163 12:132856949-132856971 CTTGCCCAGGTGCTGGTGGAGGG + Intronic
1105859419 13:24395605-24395627 CTGGGCCTGGGGCAGGGGGCAGG - Intergenic
1105886726 13:24649051-24649073 CTGACCCACGGCCAGGTGTGAGG - Intergenic
1106286358 13:28321225-28321247 CTGCCCAAAGGACAGGTGGGAGG + Intronic
1106313431 13:28573808-28573830 CTTGCTCACGGGCAGCTGGGAGG + Intergenic
1107012166 13:35680117-35680139 CTCCCCCAGGGGCAGACGGGTGG + Intergenic
1107240015 13:38221587-38221609 CTGGCCCGTAGGGAGGTGGGGGG + Intergenic
1107436178 13:40382516-40382538 GCGGCCCTGGGTCAGGTGGGAGG - Intergenic
1110119414 13:71865125-71865147 GTGGCCCCGGGGCAGATGCGAGG - Intronic
1110915967 13:81021207-81021229 TTGTCCCAAGGGCAGGTTGGAGG - Intergenic
1111011418 13:82320162-82320184 CAGGGGCAGGGGCAGGGGGGAGG - Intergenic
1112256879 13:97842180-97842202 CTTGCCCACAGGAAGGTGGGAGG - Intergenic
1112325559 13:98440903-98440925 CTGGGCCAGGGGCTTGAGGGAGG + Intronic
1113305352 13:109072414-109072436 CAGGCCCAGGGAAAGGTGAGGGG - Intronic
1113446240 13:110369824-110369846 CTGGACAGGGGGCTGGTGGGTGG - Intronic
1113650108 13:112028499-112028521 ATGGCCCAGAGGAAGGAGGGAGG + Intergenic
1113866727 13:113531279-113531301 CTGGCCCGCGGACAGGTGAGTGG - Intronic
1113917811 13:113884550-113884572 AGGGGCCAGGGGCGGGTGGGTGG - Intergenic
1113976419 13:114231131-114231153 CTGGCGGTGGGGCTGGTGGGAGG + Intergenic
1113976451 13:114231245-114231267 CTGGCGGTGGGGCTGGTGGGAGG + Intergenic
1113976505 13:114231416-114231438 CTGGCGGTGGGGCTGGTGGGAGG + Intergenic
1114269412 14:21091958-21091980 CTGGGCCCGGGGCAGGTCGCTGG - Exonic
1114613049 14:24054566-24054588 CTGGCCCAGGGGAAGGAGGAAGG - Intronic
1115857763 14:37649447-37649469 CTGGCCCAGAGGAAGTTGGCAGG - Intronic
1117135434 14:52730448-52730470 CTGGCCCGCGGGCTGGTGGGTGG - Exonic
1119254457 14:73184523-73184545 CTGTCCGAGAGGGAGGTGGGGGG - Intronic
1119326827 14:73764823-73764845 CTGGGGAGGGGGCAGGTGGGAGG - Intronic
1119414336 14:74459645-74459667 CTGGTCCAGGAGCCTGTGGGGGG + Intergenic
1119473655 14:74914355-74914377 CTTGCCCAGGACCAGGTGGTGGG - Intronic
1119480868 14:74956816-74956838 CTGGGCCTGGGGCTGGTGGGTGG + Intergenic
1121511278 14:94515022-94515044 CAGGCCCAGCAGCAGGTGTGTGG - Intronic
1121608153 14:95256515-95256537 TGGGCCCAGCAGCAGGTGGGAGG - Intronic
1121618693 14:95331564-95331586 CCAACCCAGGCGCAGGTGGGAGG - Intergenic
1121700045 14:95945686-95945708 CTGGCCCCTGTGCAGGAGGGAGG - Intergenic
1122115018 14:99523263-99523285 CAGGCCGAGGGGCTGGTGAGTGG - Intronic
1122129036 14:99594488-99594510 CTTGCCTTGGGGCAGGTGTGGGG - Intronic
1122308938 14:100782699-100782721 ATGGCCCAGTTGCAGCTGGGAGG + Intergenic
1122686462 14:103510356-103510378 CCGGGGCAGGGGCAGCTGGGGGG - Intergenic
1122720116 14:103716794-103716816 TTGGCCAAGGGGCTGGTGTGAGG - Intronic
1122808961 14:104278392-104278414 CTGGCCCAAGGGGAGGCAGGAGG - Intergenic
1122847242 14:104506622-104506644 CTGGGCCTGGGGCAGGGGGCAGG - Intronic
1122876175 14:104666388-104666410 CCGGCCCTGGGGGAGGAGGGAGG - Intergenic
1122901488 14:104784053-104784075 CCGGCCATGGGGCAGGAGGGTGG - Intronic
1122920343 14:104877388-104877410 CAGTCCCACAGGCAGGTGGGAGG - Intronic
1122956199 14:105072677-105072699 CTGTCCCTGGGGCAGGCAGGGGG + Intergenic
1123043516 14:105500152-105500174 CTGGCGGAGGGGCCGGAGGGTGG - Intergenic
1202899801 14_GL000194v1_random:28421-28443 CCGGCGCAGGCGCAGGGGGGTGG - Intergenic
1124004607 15:25785848-25785870 CTGCCCCTGGGCGAGGTGGGTGG - Intronic
1124208328 15:27742150-27742172 CAGGTCCAGGGCAAGGTGGGAGG + Intergenic
1124668492 15:31615887-31615909 CTGGCACAGGGGCAGATGGGAGG + Intronic
1125600967 15:40915635-40915657 ATGCCCCAGGGGCAGGGGGCGGG - Intergenic
1125731298 15:41894076-41894098 CACGCCCTGTGGCAGGTGGGAGG - Exonic
1125862884 15:43014864-43014886 CCGTCCCAGAGGGAGGTGGGGGG + Intronic
1126101243 15:45119503-45119525 CTGGCTGAGGGGCATGTGGCTGG + Intronic
1127640826 15:60914303-60914325 CTTGCCCATGGGGAGGTGAGGGG + Intronic
1128146055 15:65333113-65333135 CTGGCCTGGGGGCCGGTGAGGGG + Intronic
1128639216 15:69323464-69323486 CTGGGCCAGAGGCAGGATGGGGG + Intronic
1128866827 15:71120577-71120599 CTGGCCAAGGGCCAGGAGGGTGG - Intronic
1129161810 15:73751949-73751971 CTGGCTGGGGGGAAGGTGGGGGG - Intronic
1129197624 15:73979842-73979864 GCGGGCCAGGGCCAGGTGGGAGG + Exonic
1129297620 15:74608618-74608640 CTGGCCCAGGGGCAGGTGGGAGG - Intronic
1129692229 15:77720360-77720382 CAGGCAGAGGGGCAGGTGCGTGG - Intronic
1129732217 15:77939029-77939051 CTGTCCCAGAGGCAGGTCTGAGG - Intergenic
1129741640 15:77992384-77992406 CTGGAGCAGGGGGAGGTGGCGGG + Intronic
1130060260 15:80564445-80564467 CTGGCCCAGGAGCAGGGCAGAGG - Intronic
1130661368 15:85833756-85833778 ATGGGGAAGGGGCAGGTGGGCGG + Intergenic
1130903910 15:88226687-88226709 TGGGCCCAGGGGCAGGGGTGGGG - Intronic
1131091083 15:89625362-89625384 CTGGCCCAGGAGGAAGAGGGCGG + Exonic
1131158056 15:90087099-90087121 CTGGCCCAGGGTACGCTGGGAGG - Exonic
1131272887 15:90957489-90957511 CTGGGGCGGGGGCAGGTGAGCGG + Exonic
1131296143 15:91150907-91150929 CTAGCCCAGGAGCAGAGGGGTGG - Intronic
1131517505 15:93089006-93089028 CTGCCCCGGGGCAAGGTGGGAGG + Intronic
1131559140 15:93424347-93424369 CTGGCCCAGGGGGTGGTGGAGGG - Intergenic
1132074696 15:98810146-98810168 CTGGCGGAGGGGGTGGTGGGTGG + Intronic
1132320403 15:100920657-100920679 CTGGACAAGGGGCAGGGTGGGGG - Intronic
1132340103 15:101072942-101072964 CTGGCGCGGGGGGAGGGGGGGGG + Intronic
1132501405 16:286177-286199 CGGGGCCGGGGGCAGGTGGGGGG - Intronic
1132527835 16:426226-426248 CCGGCCCCGGGGCTGGAGGGAGG + Exonic
1132556684 16:575710-575732 CAGGACAGGGGGCAGGTGGGAGG - Intronic
1132602286 16:778699-778721 CTGGTCCCGGGGCAGCTGGCTGG + Exonic
1132668027 16:1090763-1090785 CTGGCCCAGTGGTGGGTGGTGGG + Intronic
1132692402 16:1187469-1187491 CTGAGCCAGGGGCAGGGGTGTGG - Intronic
1132749326 16:1450259-1450281 CTGGACCAGGCGAAGGTAGGGGG - Intronic
1132784038 16:1644627-1644649 CTGGCCCAGGGAAAGGAAGGTGG + Intronic
1132881401 16:2163200-2163222 GGGGCTCAGGGGCTGGTGGGTGG - Intronic
1132932466 16:2465925-2465947 CTGGTGCTGGGGCAGGTGTGGGG + Intergenic
1132937390 16:2488071-2488093 CTAGCCAGGAGGCAGGTGGGAGG - Intronic
1132994368 16:2815360-2815382 CTGGCCCGGGGGCTGCAGGGAGG - Intergenic
1133020084 16:2963414-2963436 CGGGCCCAGGGGGAGGGGGCGGG + Intergenic
1133098885 16:3467114-3467136 CTGGACCAGGGGTTGGGGGGCGG + Intronic
1133337751 16:5017167-5017189 CTGTTCCAGAGGCGGGTGGGGGG + Exonic
1133975080 16:10594852-10594874 CTGGACCTGGGGCACCTGGGAGG - Intergenic
1134135416 16:11673722-11673744 CTGGGCCAGGGCCTGGTAGGAGG + Intronic
1134597867 16:15510285-15510307 CTGGACCAGAGGCAGCTGTGAGG + Intronic
1135041716 16:19122492-19122514 CTTGCCCAGGGGAATGTTGGTGG + Intronic
1135771932 16:25224419-25224441 CAGGAGCAGGGGCAGGTGGCAGG + Exonic
1136227499 16:28868958-28868980 CTGGGGCAGGGGCAGGGAGGAGG - Intronic
1136248014 16:28986174-28986196 CTGGCTCAGGGGTGGGTAGGAGG - Exonic
1136385953 16:29926106-29926128 CTGGCCCAAGGGCTGGGGGCCGG - Exonic
1136448744 16:30340201-30340223 CTGGCCCAGGTGCAGGGGCATGG - Intergenic
1136466167 16:30445453-30445475 CTGGGCCGGGGCCTGGTGGGTGG - Exonic
1136483798 16:30558275-30558297 CGGGCCCAAGGGAAGGAGGGAGG + Exonic
1136552534 16:30989303-30989325 CTGGCCCAGGGTGGGGTGGGGGG + Exonic
1136568778 16:31084772-31084794 CCCGCCCAGGAGCAGGTAGGTGG - Exonic
1136735212 16:32461233-32461255 CTGGCACGGGGGGAGGTGTGGGG + Intergenic
1137444203 16:48522050-48522072 TTTACCCAGGGGCAGATGGGTGG + Intergenic
1137538068 16:49342428-49342450 CTGGACCAGGGGCTGGGGGTGGG + Intergenic
1137610064 16:49811984-49812006 CAGGCCTAGGGGCAGGAGGAAGG - Intronic
1137670432 16:50275229-50275251 CTGGCCCACAGGCAGGTGCATGG + Intronic
1138099851 16:54243981-54244003 CTGGCCACGTGGCAGATGGGAGG + Intergenic
1138389884 16:56662727-56662749 ATGTCCCCGGGGCAGGAGGGAGG - Intronic
1138488274 16:57360617-57360639 ATGGCCCAGGTGCTGGTGGGTGG + Intronic
1138490408 16:57373042-57373064 CTGGCCCAGGGCCAGGGCTGCGG - Intronic
1138549984 16:57742170-57742192 CAGGCAGATGGGCAGGTGGGAGG - Intronic
1139090035 16:63634333-63634355 CTGGCACAGAGGGAGATGGGGGG - Intergenic
1139328394 16:66169152-66169174 CTGGCCCTGGGGGAGTTAGGAGG - Intergenic
1139436269 16:66938271-66938293 CAGGCCCTGGGGCAGGGGTGGGG + Intronic
1140857355 16:78989768-78989790 CTGGCCCAGGAGGAAGTGAGAGG + Intronic
1140895198 16:79318466-79318488 CTGGCTCTGGGGCAGGTTTGTGG - Intergenic
1141127257 16:81409426-81409448 CTGGACCAGGGCCAGCTCGGTGG - Intergenic
1141168889 16:81678650-81678672 CCGCCCCCGGGGCCGGTGGGAGG + Intronic
1141527201 16:84618753-84618775 CAGCCTCAGGGGCAGGGGGGTGG - Intergenic
1141864434 16:86740502-86740524 GTGGCCTAGGTGGAGGTGGGAGG + Intergenic
1141886879 16:86898473-86898495 CTGGCCCTGGGGCTGGCGTGAGG - Intergenic
1142057488 16:88007433-88007455 CAGGCCGAGGGCCAGGCGGGAGG - Intronic
1142214057 16:88822264-88822286 CAGGCCCTGGGGCAAGTAGGAGG - Intronic
1142347234 16:89561563-89561585 CTGGTTCTGGGGCAGGTGGCCGG + Exonic
1142558790 17:797545-797567 GTGGCCCAGGAGCAGATGCGCGG - Intergenic
1142608507 17:1095475-1095497 TGGGCTCAGGGGCAGGAGGGTGG + Intronic
1142748966 17:1976232-1976254 AAGGCCCAGGGGCAGGGGGCTGG + Intronic
1142963001 17:3563062-3563084 CTGGGCCAGAGGGAGGTGGGAGG - Intergenic
1143554627 17:7652371-7652393 CCGGCACAGGTGCAGGTGAGGGG + Intronic
1143781517 17:9231896-9231918 CTGGCCTCGGGGCGGTTGGGGGG + Intronic
1144326822 17:14190408-14190430 ATGGCCCAGGAACAGGTGGGTGG + Intronic
1144467680 17:15509312-15509334 CTGGACCAAGGGGAGGTGGTAGG + Intronic
1144475702 17:15587272-15587294 ATGGCCCAGGAACAGGTGGGTGG + Intronic
1144626781 17:16847989-16848011 CAGACTCAGGGGCAGGTGGGGGG - Intergenic
1144675428 17:17158619-17158641 CTGGCTCAGGAGCGGGTGGGCGG + Exonic
1144891002 17:18494376-18494398 CTGGCCCTGGGGCCGGGGGCTGG + Exonic
1145141221 17:20449942-20449964 CTGGCCCTGGGGCCGGGGGCTGG - Exonic
1145152583 17:20519664-20519686 CAGACTCAGGGGCAGGTGGGGGG - Intergenic
1145249088 17:21287665-21287687 CTGGCGCTGGGGCCAGTGGGTGG + Intronic
1145794699 17:27648991-27649013 CTGGCCCTGGGGCCGGGGGCTGG + Exonic
1146006872 17:29166123-29166145 CTGGCCCTGGGGCTGGTGCCAGG - Exonic
1146379078 17:32315191-32315213 CTGGCCCAGGCCCAGCTCGGGGG - Intronic
1146683442 17:34824711-34824733 CTGGCCCAGAGGAGGGTGAGAGG + Intergenic
1146688441 17:34856971-34856993 CTCACCCAGGAGAAGGTGGGGGG + Intergenic
1147037378 17:37691865-37691887 CTGACAAGGGGGCAGGTGGGTGG - Intronic
1147160317 17:38565874-38565896 ATGGGCCAGGGGCAGTAGGGAGG + Intronic
1147341704 17:39756323-39756345 CTGGCCCAAGGGATGGTGGAGGG - Intergenic
1147671892 17:42181143-42181165 CTGGCCCGTGGGGAGGTGGGGGG - Exonic
1147693457 17:42333286-42333308 GAGGCCCCAGGGCAGGTGGGTGG - Intronic
1148135715 17:45290448-45290470 GTGGGCACGGGGCAGGTGGGTGG - Intronic
1148154055 17:45412532-45412554 CTGGCTCAGGGGCTGGCGAGGGG + Intronic
1148336877 17:46847854-46847876 CTGGCCTGGGGGCAGGTGCCGGG + Intronic
1148463260 17:47850159-47850181 CTGCCCCAGGGGCTGGAGGATGG + Intronic
1148481192 17:47960465-47960487 CAGTCCCAGGTGCAGGTGTGAGG + Intergenic
1148776078 17:50096318-50096340 GTGGCCCTGGGGCAGGAGGGAGG + Intronic
1148875979 17:50687477-50687499 GAGGCCCAGAGGCAGGTGGGAGG + Intronic
1149659012 17:58324781-58324803 CCGGCGCAAGGGCAGGTGTGTGG - Intronic
1149992073 17:61388874-61388896 CTGGCCCCGGGGCAGCTTTGTGG - Intronic
1150484971 17:65537252-65537274 CAGGTCCATGGGCAGGTGTGAGG - Intronic
1151436073 17:74098223-74098245 CTTTCCCAGGGGGAGGTGAGCGG - Intergenic
1151675752 17:75596541-75596563 CTGGCCCAGGAGGAGGTAAGAGG + Intergenic
1151697435 17:75724713-75724735 CTGGCCCATGGGCTGGGGCGTGG - Exonic
1151765675 17:76132170-76132192 GCGGCCCAAGGGCAGGTGAGGGG + Intergenic
1151890701 17:76949117-76949139 ATGGCCCAGGAGCAGGTGGTCGG + Exonic
1151927474 17:77209486-77209508 CCGGCCCAGGTGCAGGAAGGCGG - Intronic
1152022975 17:77790747-77790769 CAGGCCCAGGTGAAGGTGTGGGG + Intergenic
1152039702 17:77894781-77894803 CTGCGCCAGGAGCAGGAGGGAGG + Intergenic
1152247683 17:79193859-79193881 CTGGCCCACAGGAAGGTGGCTGG + Intronic
1152462650 17:80449612-80449634 CTGTCCCTGGGACAGGTGGGGGG + Intergenic
1152634942 17:81427040-81427062 CCGGGCCAGGGGCAGGTGAGGGG + Intronic
1152642366 17:81454552-81454574 CGGGGGTAGGGGCAGGTGGGTGG - Intronic
1152660773 17:81540978-81541000 CATCCCCAGGGCCAGGTGGGGGG - Intronic
1152720852 17:81923266-81923288 CTGGGCCGGGGGCGGGGGGGGGG - Intronic
1152781990 17:82230753-82230775 CGGGCCCTGGGGCAGGGGCGGGG + Intronic
1152806211 17:82357555-82357577 CTGGGATAGGGGCAGGTGTGGGG - Intergenic
1152952943 18:11653-11675 CTGCCACGGGGGGAGGTGGGGGG - Intergenic
1153614955 18:6925771-6925793 CAGGCACAGAGGGAGGTGGGGGG + Intergenic
1155555161 18:27010872-27010894 CTGTCTCAAGGGCAGATGGGTGG + Intronic
1156450628 18:37264429-37264451 CTGGCCCAGGGGCAGGGGCCTGG - Intronic
1156944957 18:42817650-42817672 TTGGTCCAGGGGAAGGAGGGAGG + Intronic
1157134342 18:45039322-45039344 TGGGCACAGGGGCTGGTGGGAGG - Intronic
1157427269 18:47594591-47594613 GGGGGCCAGGGGGAGGTGGGGGG + Intergenic
1157544684 18:48539454-48539476 CTGGCCCAGGAGCAGGGATGGGG - Intronic
1158533819 18:58289279-58289301 GGGGCTGAGGGGCAGGTGGGAGG + Intronic
1160173056 18:76570247-76570269 CTGGACCTGGGGTTGGTGGGGGG + Intergenic
1160310536 18:77786062-77786084 TCAGCCCAGGGGCAGCTGGGTGG - Intergenic
1160578210 18:79869043-79869065 CTGTCCCAGGTGCAGGGGTGGGG + Intronic
1160745294 19:708686-708708 CTGGCCCAGGAGCTGGGGAGGGG + Intergenic
1160778689 19:868319-868341 CGGGCTCAGGGGCAGCTGAGGGG + Intronic
1160816510 19:1038462-1038484 CTGGCCCCGGGGCAGGTCTGAGG - Exonic
1160818662 19:1047819-1047841 CGGGGCCTGAGGCAGGTGGGCGG + Intronic
1160876760 19:1300096-1300118 CTGGTCCTGGGGCGGGTGGATGG - Exonic
1160968095 19:1755390-1755412 CGCGCGCTGGGGCAGGTGGGGGG - Intronic
1161039641 19:2103414-2103436 GGGGCCCAGTGGCAGGAGGGCGG - Intronic
1161063702 19:2227532-2227554 CTGGCCCTGGGGCTGCTGCGGGG + Intronic
1161166668 19:2791475-2791497 CTGGGCCAGGGGCTGGAGGGAGG + Intronic
1161221225 19:3119133-3119155 CAGCCCAAGGGGCAGCTGGGGGG - Intronic
1161262101 19:3343824-3343846 CTGGGACAGGGGTGGGTGGGTGG - Intergenic
1161358646 19:3833922-3833944 CTGGCCCGGAGGCAGGGGGCAGG + Intronic
1161393188 19:4031879-4031901 CTGGCAAAGGGGCAGCTAGGAGG - Intronic
1161466246 19:4432229-4432251 TGGGCCCAGGAACAGGTGGGTGG - Intronic
1161482880 19:4519529-4519551 CTGTCTCAGGGGCAGGTAGGAGG - Intergenic
1161530375 19:4785380-4785402 CTGGCGCGGGGGCAGGTAGCGGG + Intergenic
1161608770 19:5229483-5229505 CTGGCCGATGCCCAGGTGGGCGG - Exonic
1161660314 19:5541738-5541760 CTGGTACAGGGCCAGGTGGCGGG - Intergenic
1161713732 19:5864033-5864055 CTCCCCCAGGCCCAGGTGGGAGG - Intergenic
1161722376 19:5910238-5910260 CTGGCCTGGGGGCAAGAGGGAGG + Exonic
1161845452 19:6709613-6709635 CTGGGGCTGGGGGAGGTGGGTGG - Intronic
1161961623 19:7526598-7526620 GTGGACCAGGTGCTGGTGGGCGG + Exonic
1161989717 19:7677761-7677783 CTTGGGAAGGGGCAGGTGGGCGG + Intronic
1162582603 19:11540007-11540029 CAGGGCCAGGGCCAGGTGAGGGG + Intronic
1162590444 19:11587891-11587913 CAGGCCTAGTGGCAAGTGGGGGG - Intronic
1162601497 19:11673669-11673691 CTGGCCTTGGAGCAGGAGGGGGG - Intergenic
1162767774 19:12930391-12930413 CTGGTCAGGGGGCAGGTGGACGG - Intronic
1162996284 19:14337807-14337829 CTGGGCCAGGGGGAGGAGGAGGG + Intergenic
1163018295 19:14470059-14470081 CTGTCCCAGGGTCAGGGTGGGGG - Intronic
1163125645 19:15242991-15243013 CTGGCCTGGGGGCGGATGGGGGG + Exonic
1163442147 19:17327681-17327703 ATCGGCCAGTGGCAGGTGGGGGG - Exonic
1163468752 19:17484923-17484945 CTGAAACAGGGGCAGGTGGGTGG + Intronic
1163469429 19:17487894-17487916 CTGGCACAGGTCCAGATGGGGGG - Intronic
1163591363 19:18195923-18195945 CTGGCCCAAGGGCAGGTAGAGGG + Intronic
1163591453 19:18196378-18196400 TTGGCCCAGAGCCAGGTGGATGG - Exonic
1163786094 19:19275642-19275664 CTGGCCCTGGGGCAGATGTGGGG + Intergenic
1164433506 19:28208349-28208371 CTGTCCCAGGGGGAGAGGGGTGG + Intergenic
1164563961 19:29312616-29312638 GTGGAGCAGGGGGAGGTGGGAGG + Intergenic
1164615309 19:29664024-29664046 CTGGGCCAGGACCAGGTGAGAGG - Intergenic
1165061385 19:33206845-33206867 AGGGCCCATGGCCAGGTGGGGGG + Intronic
1165158585 19:33802881-33802903 CAGGCCCTGGGGGAGGCGGGTGG + Intronic
1165300173 19:34963742-34963764 CTGGGGCACGGCCAGGTGGGTGG - Exonic
1165348342 19:35262757-35262779 CTGTCCTGGGGGCAGGTGGATGG - Intronic
1165476237 19:36032573-36032595 CTGGGCCTGGGGGAGGTGGCAGG - Intronic
1165712872 19:38024542-38024564 GGGGCCCAGGGCCAGCTGGGGGG - Intronic
1165794801 19:38512494-38512516 CTGACCCAAGGGCAGGTTGCGGG + Intronic
1165939138 19:39406685-39406707 CTGGCCCAGGGCCGGGCGGAAGG + Intergenic
1165993057 19:39826909-39826931 CGGGCCCGGGGGCCGGCGGGCGG - Exonic
1166359625 19:42247750-42247772 CTGGCCCATGGGCAGGCGGGTGG - Exonic
1166546415 19:43636772-43636794 CTGGCTCATGGGTGGGTGGGTGG + Intronic
1166646113 19:44533019-44533041 CTGGCTTAGGAGAAGGTGGGTGG - Intergenic
1166711535 19:44940820-44940842 CAGGCCCAGGGCCAGGGCGGTGG - Intergenic
1167314447 19:48755540-48755562 TTGGCCCACGGCCAGGTGAGAGG + Exonic
1167360120 19:49025631-49025653 GTGGCCCGGGGGTAGGTGGAGGG - Intronic
1167360965 19:49030150-49030172 GTGGCCCAGGGGTAGGTGGAGGG + Intronic
1167363450 19:49042542-49042564 GTGGCCCAGGGGTAGGTGGAGGG + Intergenic
1167367291 19:49061530-49061552 GTGGCCCGGGGGCAGGTGGAGGG - Exonic
1167418824 19:49390890-49390912 CTGCCCGAGGGCCCGGTGGGTGG + Exonic
1167485590 19:49761273-49761295 CTGGCCCAGGGGAAGCCAGGTGG + Intronic
1167592786 19:50413550-50413572 ATGGGCCCAGGGCAGGTGGGGGG + Intronic
1167859521 19:52271445-52271467 CAGGCCCTGAGACAGGTGGGTGG - Intronic
1168166749 19:54553858-54553880 GAGGCCGAGGGGCAGGTAGGTGG + Intergenic
1168251449 19:55144627-55144649 CCTGCGCAGCGGCAGGTGGGAGG - Intronic
1168308552 19:55449855-55449877 CTGGGCAGGGGGCTGGTGGGGGG - Intergenic
1168332681 19:55579263-55579285 CTGGCTCAGGAGCACGCGGGCGG - Exonic
925007840 2:458608-458630 CTCTCCCAGGGGCTGGGGGGAGG + Intergenic
925121500 2:1421990-1422012 CTGGGGCAAGGGCAGGAGGGAGG - Intronic
925128227 2:1476845-1476867 CAGGCCAGGGGGGAGGTGGGGGG + Intronic
925272864 2:2626975-2626997 CTCACCCTGGGGCAGGTGAGAGG - Intergenic
925306763 2:2852136-2852158 TTGGCCCAGAGGCAAATGGGTGG - Intergenic
925377760 2:3400461-3400483 CTGAGGCAGGGGCAGCTGGGGGG - Intronic
925924266 2:8659188-8659210 CTGCCCCAGGGGCAGGGGCAGGG + Intergenic
926122952 2:10254763-10254785 CTTGCCCAGAGGCAGCTGGAGGG + Intergenic
926126680 2:10276648-10276670 CTGGCCCAGGGGTGGGTGGAGGG - Intergenic
926152871 2:10434564-10434586 CTGGCTCAGGGACAGGTGCCAGG + Intergenic
927096282 2:19749944-19749966 CTGGCCCAGCTGCAGGAGGCTGG - Intergenic
927689208 2:25195790-25195812 AAGGCCCAGAGGCAGGAGGGTGG - Intergenic
927724272 2:25409088-25409110 CTGGAAAAGTGGCAGGTGGGAGG + Intronic
927853174 2:26512622-26512644 CTGGCCCAGGGGCAGGTATAGGG - Intronic
928201889 2:29252599-29252621 CTGGCCCAGAGGCTGGGAGGTGG + Intronic
928418138 2:31113802-31113824 CAGGCACAGAGGGAGGTGGGGGG + Intronic
929431653 2:41892706-41892728 CTGGCCCTGGGCCAGGAGAGAGG + Intergenic
929690189 2:44067257-44067279 CTGTCCGAGAGGGAGGTGGGGGG - Intergenic
930049843 2:47206480-47206502 CTGGGCAAGAGGGAGGTGGGTGG + Intergenic
931088857 2:58864442-58864464 GTTGCCCAGAGGCAGATGGGAGG + Intergenic
931248776 2:60512427-60512449 GTGGCACAGGGGCAGGTAGAAGG - Intronic
931630755 2:64296340-64296362 CTGGTTCAGGGGGAGGTGCGGGG + Intergenic
932025749 2:68130783-68130805 CTGGCCCAGAGGCTTGTGGCTGG + Exonic
932305966 2:70704534-70704556 CTGACCCAGGGGCAAGGGGTGGG - Intronic
932526515 2:72475554-72475576 CTGGCACAGGGGTTGGGGGGTGG + Intronic
932657864 2:73626032-73626054 CCGGCCAAGGGGCCGATGGGCGG - Intergenic
932704079 2:74009968-74009990 CTGGCTCAGGGACAAGTGGCAGG - Intronic
932758356 2:74423968-74423990 CCTGCCCAGGGACAGGTGAGTGG + Exonic
933240722 2:79917733-79917755 CTGACCCAGGCACAGGTGGTGGG + Intronic
933840754 2:86284068-86284090 CAGGCCAAGGGGGAGGTGGCTGG + Intronic
933877017 2:86630129-86630151 CTAGCCCAGTGGAAGGTGGGAGG - Intronic
934555626 2:95285696-95285718 CTGGCCCAGGCCCAAGTGAGTGG + Exonic
934570886 2:95372674-95372696 CTGGGCCAGGTGCAGGCAGGTGG + Intronic
934716857 2:96549577-96549599 CTGGCCCAGTGGCAGCCTGGAGG - Intronic
934882553 2:97996144-97996166 CTGGCGCAGGAGAAGGAGGGAGG + Intergenic
934966670 2:98730542-98730564 GGGGCCGCGGGGCAGGTGGGCGG - Intronic
935081094 2:99795392-99795414 ATGGCTGGGGGGCAGGTGGGAGG + Intronic
935196405 2:100819470-100819492 GCGGCCCGGGGGCAGGTGGGAGG - Intergenic
935237589 2:101151450-101151472 CGGGGCCAGGGGCGGGTGCGGGG - Intronic
935734179 2:106093382-106093404 CTGGGGCGGGGGCAGGTTGGGGG - Exonic
936093261 2:109514393-109514415 CTAGCCCTGGGGGCGGTGGGCGG - Intergenic
936118516 2:109721859-109721881 GTGGCCCACGGGCAGGCTGGTGG - Intergenic
936230386 2:110695235-110695257 CGGGCACAGAGGGAGGTGGGGGG + Intergenic
936381902 2:111993841-111993863 CTGGTTCAAGGGCAGGTGGCAGG + Intronic
937100217 2:119262955-119262977 CTGGCGGAGGGGAAGGAGGGTGG - Intronic
937830101 2:126410415-126410437 CTGGCTCAGGGTCAGCAGGGAGG - Intergenic
937883678 2:126886281-126886303 CTGGGCTAGGGCCAGGTGGCCGG - Intergenic
937900650 2:127016600-127016622 CTCGCTCAGGGCCACGTGGGAGG - Intergenic
937983504 2:127628318-127628340 CTGGATCAGGGGAAGGTGGAGGG + Intronic
937987112 2:127642853-127642875 CTGGCCCAGGGTAAGGGCGGTGG - Intronic
938976184 2:136480718-136480740 CCCTCCCAGGGGCATGTGGGAGG + Intergenic
941003276 2:160222772-160222794 AGGGCCCAGGGGCAGGTTGCTGG + Intronic
941616494 2:167726367-167726389 CTGGACAAGGGGCAGGTGGGCGG - Intergenic
941820529 2:169840242-169840264 CAGGCCCAGAGGGAGGTGGGGGG - Intronic
942525552 2:176849172-176849194 TTGGCCCAGTGGGGGGTGGGGGG - Intergenic
943670444 2:190654501-190654523 CTGGCACAGGGGCAGGGAAGTGG + Intronic
944591299 2:201220312-201220334 CTGGCATAGAGGGAGGTGGGGGG + Exonic
944933722 2:204545813-204545835 CTGGCCAGGCGGCAGGTGGCGGG - Intronic
945107221 2:206327530-206327552 CTGGAGTAGGGGCAAGTGGGTGG - Intergenic
945316628 2:208377549-208377571 CCGTCCCAGAGGCAGGTGGGGGG - Intronic
945316649 2:208377596-208377618 CTGTCCCGGAGGCAGGTGGGGGG - Intronic
946029722 2:216694573-216694595 CTGGCCGAGGGGCAGTCGTGCGG - Exonic
946114036 2:217446069-217446091 CTGGCCTAGGGGCAAGGGGATGG + Intronic
946171322 2:217897697-217897719 CTGGCACAGGGGCTGGTGGCAGG + Intronic
946190668 2:218006190-218006212 CTGGCCCTGGGGCTGGAGGAGGG + Intergenic
946312878 2:218892560-218892582 CTGGCCTGGTGGGAGGTGGGTGG + Intronic
946329693 2:219002221-219002243 CCCTCCCAGAGGCAGGTGGGTGG - Intergenic
946347130 2:219119581-219119603 CTGGGCCAGGGGCAGGGTGGCGG - Intronic
946391566 2:219419503-219419525 GAGGCCCTGGGGGAGGTGGGGGG + Intronic
946416331 2:219541820-219541842 CCGGCCCAGGTACAGGTGGGCGG + Exonic
947525484 2:230874550-230874572 CAGACCCAGGGGCTGCTGGGAGG - Intronic
948852519 2:240715404-240715426 CTCTCCCAGGGGCTGATGGGGGG - Exonic
949034428 2:241810095-241810117 CTGGGGCAGGGGCAGGTGGGTGG - Intronic
1168807617 20:681738-681760 CTTGCCCAAGGGCATGTGGCAGG + Intergenic
1168991712 20:2101903-2101925 CTGGCCCGGGCGCCGGCGGGAGG + Exonic
1169117009 20:3072299-3072321 CGGGGCCAGGGGGAGGCGGGCGG + Intronic
1169970169 20:11261532-11261554 CTGGCCTCGGAGCAGGAGGGTGG - Intergenic
1170859507 20:20089754-20089776 CTGGCACAGGGGGCGGTGGCAGG - Intronic
1171411032 20:24949238-24949260 CCAGCCCAGGGGCAGGTGCCAGG - Exonic
1172021552 20:31918138-31918160 CGGGCACAGAGGGAGGTGGGGGG - Intronic
1172122500 20:32607313-32607335 CTGGCCCAGGGGAGGCTGAGGGG - Intronic
1172210028 20:33190893-33190915 CCTGCCCTGGGGCAGATGGGCGG - Intergenic
1172272610 20:33663191-33663213 CTGGACCAGGCGGGGGTGGGAGG + Intronic
1172505023 20:35455246-35455268 GGGCCTCAGGGGCAGGTGGGAGG + Intronic
1172765384 20:37348068-37348090 AAGGCCCAGGGGCACGCGGGAGG - Intronic
1172771180 20:37383537-37383559 GTGACTCAGGGGGAGGTGGGTGG + Intronic
1172773697 20:37395624-37395646 CAGGCCCAGGCTCAGGCGGGAGG - Intronic
1173167710 20:40697642-40697664 CTGGCACAGGGCCAGGAGGGGGG - Intergenic
1173298804 20:41782358-41782380 CCTGCACAGAGGCAGGTGGGCGG + Intergenic
1173867564 20:46322389-46322411 CCGGCCAGGGGGCAGGTGAGTGG - Intergenic
1174069264 20:47888466-47888488 CAGACCCGGGGGAAGGTGGGTGG - Intergenic
1174082821 20:47983106-47983128 GTGACCCAGGGGGAGGTGAGAGG + Intergenic
1174110355 20:48194216-48194238 GTGGCCCAGGGGCAGGTCCTTGG + Intergenic
1174133134 20:48359876-48359898 GTGACCCAGGGGGAGGTGGGAGG - Intergenic
1174171436 20:48620296-48620318 GTGGCCCAGGGGCAGGTCCTTGG - Intergenic
1174396225 20:50248345-50248367 CTGGGTGAGGGGCAGATGGGTGG - Intergenic
1174861148 20:54092479-54092501 CTGAGCTAGAGGCAGGTGGGTGG - Intergenic
1175199286 20:57266716-57266738 CGGGGCCGAGGGCAGGTGGGAGG - Intergenic
1175440822 20:58989915-58989937 CTGGCCCAGGAGGAGCAGGGGGG + Exonic
1175517093 20:59576834-59576856 CAGGCCCAGGTGCTGGTGGGTGG + Intergenic
1175524109 20:59621714-59621736 CTGGCCCCTGGGGAGGTGTGGGG + Intronic
1175727797 20:61331602-61331624 GTGGGCCTGGGGCAGGTGGCCGG - Intronic
1175727829 20:61331682-61331704 GTGGCTCTGGGGCAGGTGGCCGG - Intronic
1175949843 20:62577596-62577618 CTCGCCCAAGGGCAGCTGGAGGG + Intergenic
1176124029 20:63467179-63467201 CTTGCCCAGAGGCAGGGGAGGGG - Intronic
1176171362 20:63697779-63697801 CTGCCCGAGGGGAAGGTGGCTGG + Intronic
1176408997 21:6437591-6437613 CTGGCAGGGAGGCAGGTGGGAGG - Intergenic
1176457943 21:6929228-6929250 CTGGCTCCAGGGCATGTGGGTGG + Intergenic
1176619175 21:9043195-9043217 CCGGCGCAGGCGCAGGGGGGTGG - Intergenic
1176836115 21:13794312-13794334 CTGGCTCCAGGGCATGTGGGTGG + Intergenic
1177586477 21:23102403-23102425 CTTGCCAAGGGGCACCTGGGAGG - Intergenic
1178293369 21:31387829-31387851 CTTCCCCAGGGGCAGGTGCATGG + Intronic
1178676261 21:34634218-34634240 CCGGACTTGGGGCAGGTGGGAGG - Intergenic
1179543886 21:42101532-42101554 CGGGCACAGGAGCAGGTCGGCGG - Intronic
1179586733 21:42378143-42378165 CTGGGCCTGGGCCATGTGGGTGG + Intronic
1179655918 21:42844718-42844740 CTCTCCCTGGGGCAGGAGGGAGG + Intronic
1179684490 21:43045913-43045935 CTGGCAGGGAGGCAGGTGGGAGG - Intergenic
1179983382 21:44907807-44907829 CAGGCAGGGGGGCAGGTGGGAGG + Intronic
1179996821 21:44977958-44977980 CTGGCTCCAGGGCATGTGGGTGG + Intergenic
1180138475 21:45876430-45876452 CTGGAGCAGGGGAAGGTGAGCGG + Intronic
1180149682 21:45941158-45941180 CAGGCCCATGGGCAGGAGGCTGG + Intronic
1180199487 21:46215877-46215899 CTGGCCCAGGGCCCTGAGGGCGG - Intronic
1181012939 22:20052850-20052872 TGGGCCCCGTGGCAGGTGGGTGG + Intronic
1181015028 22:20063801-20063823 CTGGCCCATTGGCAGGTGCAGGG + Intronic
1181166445 22:20985883-20985905 CTGCTCCTGGTGCAGGTGGGTGG + Exonic
1181439320 22:22927641-22927663 GTGGCCCTGGGCCAGGTGGCAGG - Intergenic
1181444344 22:22957254-22957276 ATTGCCCAGGGGTATGTGGGTGG - Intergenic
1181919073 22:26305837-26305859 CTGGGCAAGGGGCAGGGGTGGGG + Intronic
1182123883 22:27802550-27802572 GTGGCCCAGGGCAAGGTGTGCGG - Intergenic
1182689716 22:32150559-32150581 CTGGATCATGTGCAGGTGGGCGG + Intronic
1183272091 22:36868619-36868641 CTAGCCCAGGGGGAGAAGGGTGG - Intronic
1183360468 22:37380498-37380520 CAGCTCCAGGAGCAGGTGGGGGG + Intronic
1183659022 22:39207442-39207464 ATGGCCAAGGGGCAGGTGTGTGG + Intergenic
1183749899 22:39713951-39713973 CTGGCTCTGGGGGAGGTGAGGGG + Intergenic
1183986183 22:41571911-41571933 GGGGCCCAGGGGCCGGTGAGGGG - Exonic
1184164041 22:42717035-42717057 CGGGCACAGGGGAAGGTGTGTGG + Intronic
1184570833 22:45323938-45323960 CTGGTGCAGGGGAAGGTGCGTGG + Intronic
1184677445 22:46051385-46051407 CTGTCCCATGAGCAGGAGGGTGG + Exonic
1184764492 22:46564438-46564460 CTGATTCAGGGGCTGGTGGGCGG - Intergenic
1185215123 22:49594371-49594393 CTGGCCCTGAGGGAGCTGGGGGG - Intronic
1185278389 22:49959679-49959701 CTAGCCCTGGGGCTGGCGGGTGG + Intergenic
1185289420 22:50016136-50016158 CTGGGCCAGGACCAAGTGGGTGG + Intronic
1185340210 22:50287659-50287681 CGGGCCCAGGGGGAGGTGCGTGG - Exonic
1185388505 22:50547218-50547240 CTGGCCCTGGGTCAGCAGGGAGG + Intergenic
949578233 3:5359860-5359882 CTAGCCCAGTGGCAGGTTGGAGG + Intergenic
950095189 3:10324930-10324952 CTGGACCAGGGACAGATGGCGGG + Exonic
950138661 3:10600664-10600686 CCGGGCCAGGGGCAGGGAGGGGG - Intronic
950171041 3:10839320-10839342 CTGGGTCAGGGGCAGATGAGAGG - Intronic
950440862 3:13009470-13009492 CTGGCCCTGAGCCAGGTGGGCGG + Intronic
953417025 3:42728391-42728413 CTTGCACAGGGGAGGGTGGGGGG - Intronic
953420010 3:42747082-42747104 ATGGACCAAGGGCTGGTGGGAGG + Intronic
953626761 3:44578504-44578526 CTGGCCCAGGCGCTGGAGGCCGG - Intronic
953901251 3:46845474-46845496 CTGGCCCTGGGCCAGGGGGCAGG - Intergenic
954110037 3:48428813-48428835 CTGACCCCCGGGCGGGTGGGGGG - Intronic
954628783 3:52037121-52037143 CTGGGCTGGGGGAAGGTGGGAGG + Intergenic
954712109 3:52510265-52510287 CTGACCCAGAGGCAGGAGGTGGG + Intronic
954924115 3:54217344-54217366 CTAGCCCAGGGCAGGGTGGGAGG - Intronic
955163693 3:56490020-56490042 CAGGACCAGGGGAAGGTTGGAGG - Intergenic
956797954 3:72733000-72733022 CTGGCCACGGTGCAGATGGGTGG + Intergenic
956885674 3:73556951-73556973 CAGTCCCAGGGGCATGTGGGAGG - Intronic
958695817 3:97526468-97526490 CTGACCCAGTGGCAGTGGGGGGG + Intronic
960887407 3:122410196-122410218 ATGGCCCAGGTGCAGCTTGGAGG + Exonic
961351824 3:126308945-126308967 CTGGCCCAGGGTGAGGGCGGTGG + Intergenic
961445499 3:126979122-126979144 CTGCCCCAGGGGCAGGAGCATGG + Intergenic
961460160 3:127045119-127045141 CTGGCTCAGGTGCAGGTGGAGGG + Intergenic
961476494 3:127150076-127150098 CTTGCCCAGGGGCAGGAGGGTGG + Intergenic
961479067 3:127167873-127167895 AATGGCCAGGGGCAGGTGGGAGG - Intergenic
961574019 3:127820376-127820398 CTGGCACAGGGGGAGGGTGGTGG - Intronic
961619988 3:128216554-128216576 GGGGCAGAGGGGCAGGTGGGTGG - Intronic
961654454 3:128433467-128433489 CTGGCCTAGGACCAGTTGGGAGG - Intergenic
961667012 3:128498870-128498892 CTGGGATAGGGGCAGGTTGGTGG - Intergenic
962230481 3:133661645-133661667 CTGGCCCTGGAGCCGGCGGGTGG - Intronic
962346778 3:134624559-134624581 ATGTCTCAGGTGCAGGTGGGAGG - Intronic
962508259 3:136071169-136071191 ATGGCCCTGGGGCTGGTCGGTGG - Intronic
962650219 3:137480918-137480940 GGGGCCCAGGGGCAGGGGGTGGG - Intergenic
962828418 3:139119468-139119490 CTGGCCCAGGGATGAGTGGGTGG + Intronic
963331404 3:143920040-143920062 CTGGGCCTGGGGCAGGCAGGAGG + Intergenic
964203885 3:154148827-154148849 CTGACCCAGGGTCAGGATGGTGG + Intronic
964892877 3:161557849-161557871 GTGGAGCAGGGGCAGGTGGGAGG - Intergenic
967055015 3:185823999-185824021 CTGGCCGAGCGGGAGGCGGGGGG + Intronic
967567994 3:190993668-190993690 CTAGACCAGTGGCAGCTGGGTGG - Intergenic
967717711 3:192782331-192782353 TTGGACCCGGGGAAGGTGGGTGG + Intergenic
967913452 3:194560434-194560456 CTGGAGAATGGGCAGGTGGGTGG - Intergenic
967924732 3:194637267-194637289 CTGCCCCAGGGCCTGGTGGGAGG - Intergenic
968047454 3:195632054-195632076 CTGACCCAGGGGCAGGAGGTGGG + Intergenic
968188933 3:196653454-196653476 CTGGCCCAGGAGAAGATGGGAGG + Intronic
968307159 3:197657870-197657892 CTGACCCAGGGGCAGGAGGTGGG - Intergenic
968316785 3:197731804-197731826 CTGTCCCGGAGGGAGGTGGGGGG - Intronic
968554693 4:1240950-1240972 CTGGCCCAGGAGCAGGGCCGTGG - Intronic
968641559 4:1717484-1717506 CTGGGCCAGGGCCGGGTGGATGG - Intronic
968771924 4:2512905-2512927 CTGCCCCAAGGGCATGTGGGAGG - Intronic
968811495 4:2801470-2801492 CAGGCCCAGGAGCAAGAGGGAGG - Intronic
968936626 4:3614442-3614464 CTCACCCCGGGGCACGTGGGCGG + Intergenic
968981175 4:3850467-3850489 CTGGCCCAAGGCCAGGGGAGGGG - Intergenic
969115501 4:4868476-4868498 CTTGCGCGGGGGCGGGTGGGGGG - Intergenic
969240241 4:5892601-5892623 CCGGCCGAGGGGCAGGTCGCGGG + Exonic
969265620 4:6062340-6062362 CTGCTCCAGGAGCAGGTGGGAGG - Exonic
969283802 4:6190002-6190024 CAGGCCCAGGGGCAGGGGAATGG - Intronic
969429883 4:7147888-7147910 CAGGCCCAGAGGCAAGAGGGAGG - Intergenic
969457159 4:7306650-7306672 CTGGTCCTGGGGAAGGAGGGTGG + Intronic
969605827 4:8201829-8201851 CTAACCCAGGGGGAGGTGGTGGG + Intronic
969682250 4:8649810-8649832 CTGGAACTGCGGCAGGTGGGGGG - Intergenic
969843571 4:9901674-9901696 GGGGCCAAGGGGCTGGTGGGGGG - Intronic
969867908 4:10087273-10087295 GAGGTCCAGGGGCAGGAGGGAGG - Intronic
970791477 4:19862944-19862966 CTGGGGCAGGGGGAGGGGGGAGG - Intergenic
970824108 4:20252759-20252781 ATGGCTCGGTGGCAGGTGGGCGG - Intergenic
971263088 4:25074904-25074926 CTGGCCCAGGGACAGGATGACGG + Intergenic
971540728 4:27813488-27813510 CCGGCACAGAGGGAGGTGGGGGG + Intergenic
972120661 4:35697546-35697568 GTAGCCCAGGAGCAGGGGGGGGG + Intergenic
972687070 4:41361458-41361480 CTGGCACCGGGTCAGGTGTGAGG + Intronic
974577418 4:63744748-63744770 CTGGCGGAGGGGCGGGTGGGAGG + Intergenic
975021909 4:69501241-69501263 CTGGGCCGGGGGCGGGTGGAAGG + Intronic
977583108 4:98746469-98746491 CAGGCACAGTGGCAGGTGGCAGG - Intergenic
979114956 4:116812014-116812036 CTGGGCCAGGGGCTGGGGGCTGG + Intergenic
980536243 4:134127250-134127272 TTGCCCTAGGGTCAGGTGGGGGG - Intergenic
981088444 4:140707997-140708019 ATTGCCCAGGGTCTGGTGGGAGG - Intronic
982094907 4:151912697-151912719 CAGGGCCAGAGGCAGGTGAGGGG + Intergenic
983207953 4:164930884-164930906 CTGGCACAGGTAGAGGTGGGTGG - Intergenic
983828211 4:172291722-172291744 CTGGGGCAGGGGGAGGGGGGTGG - Intronic
984908167 4:184649068-184649090 CTGGCCCGGGGGCGGGAGGCTGG - Intronic
985122963 4:186662004-186662026 CTGGCCGGGGGGCGGGGGGGAGG - Intronic
985260075 4:188106716-188106738 CTGGACCAGGGCGAAGTGGGAGG + Intronic
985489542 5:171334-171356 CTGGCCCAGGGGCAGGAGCTGGG + Exonic
985519139 5:363109-363131 CTGGTGCTGTGGCAGGTGGGAGG + Intronic
985549520 5:525882-525904 GTGGACAAAGGGCAGGTGGGCGG + Intergenic
985588115 5:751308-751330 GGGGCGCAGGGGCAGGTGTGGGG + Intronic
985602785 5:843775-843797 GGGGCGCAGGGGCAGGTGTGGGG + Intronic
985744155 5:1637110-1637132 CTGACGCAGGGGCAGGAGGTGGG - Intergenic
985790874 5:1926351-1926373 CTGGGGCAGGGGCAGGTGCAGGG - Intergenic
985793537 5:1945730-1945752 CAGGGCCAGGGGTCGGTGGGGGG - Intergenic
985854216 5:2412605-2412627 CTGGACCAGAAGCAGGGGGGAGG + Intergenic
986165617 5:5269416-5269438 ATGACCCAGGGGCAGGTGTAAGG - Intronic
986262513 5:6160631-6160653 CAGGCCCAGAGTCAGATGGGAGG - Intergenic
987252024 5:16109640-16109662 CTGGACCCAAGGCAGGTGGGGGG + Intronic
988609311 5:32710577-32710599 GTGGCCCAGGGGGAGGGGGCTGG + Intronic
989146719 5:38257755-38257777 CTGGGCCTGGGGCAGGGGGCCGG - Intergenic
992482813 5:77168321-77168343 CTGGCACGGGGGCTGGAGGGAGG + Intergenic
994028581 5:95114388-95114410 CTGTCCCAAGGGCAGGTCGAAGG - Intronic
994227139 5:97265572-97265594 CAGGCCCCGGGGGAGGGGGGTGG + Intergenic
995840413 5:116438517-116438539 CTGCCCCAAGGGCAGGAGGAAGG + Intergenic
995912536 5:117204626-117204648 CTGGCGAAGGGGGAGGGGGGGGG + Intergenic
997206220 5:132051698-132051720 CTGGCTCAGAGGCACGTGGTTGG + Intergenic
997367849 5:133337142-133337164 CTGGTGCAAGGGCAGGTTGGGGG - Intronic
997468542 5:134104001-134104023 CAGCCCCAGGGGCAGATTGGAGG + Intergenic
997720850 5:136077482-136077504 CTGGCCTAGAGGGATGTGGGGGG - Intergenic
997865904 5:137462479-137462501 CTGGCTAAGGGGCAGGTTCGTGG + Intronic
998041057 5:138951345-138951367 CAGACCCAGGGGTAGGTGAGGGG + Intronic
998161456 5:139814966-139814988 AAGGGCCAGGGGCAGGTGGTGGG - Intronic
998483974 5:142485796-142485818 CTGGGCCAGGTGCAGCAGGGAGG - Intergenic
999113640 5:149142499-149142521 CTGGCCTGTGGGCAGGCGGGAGG + Intronic
999271458 5:150298540-150298562 CTGGTCCAGGGGCAGGCAGTTGG + Exonic
999317639 5:150594500-150594522 CAGATCCAGGGGCAGGTGGAGGG - Intergenic
999861873 5:155656825-155656847 CTGGCACAAGGGCATCTGGGAGG + Intergenic
1000042856 5:157498130-157498152 GTGGCCCAGGAGCAGGGGAGGGG - Intronic
1000159455 5:158583292-158583314 CTGTCCGGGAGGCAGGTGGGGGG + Intergenic
1000819094 5:165960979-165961001 CATCCCCAGGGGCATGTGGGAGG + Intergenic
1001395995 5:171419951-171419973 CTGGCGCAGGGGCTGCGGGGCGG - Exonic
1001492850 5:172168012-172168034 CTGGCTGAGTGGCAGGTGTGAGG + Intronic
1001959482 5:175871713-175871735 CTGGCCGAGGGCCGGGAGGGCGG + Intronic
1002054391 5:176590341-176590363 CTGCCCTTGGGGCAGGTGTGAGG + Intronic
1002061947 5:176630358-176630380 GTGGACCAGGGGCCGGAGGGGGG + Exonic
1002135253 5:177103774-177103796 CTGGCCCAGGGTCACAGGGGGGG + Intergenic
1002211974 5:177604617-177604639 CTGGGGCAGGGGCAGGAGGGCGG + Intronic
1002476498 5:179469300-179469322 GTGACCCAGGGGCCAGTGGGGGG - Intergenic
1002649249 5:180679684-180679706 CGGGTACAGGGGGAGGTGGGGGG + Intergenic
1002772853 6:304218-304240 CTGGCCAAGGGTGAGGTGGGCGG + Intronic
1002898978 6:1394964-1394986 CTGGCTAAGTGGCAGGTGTGTGG - Exonic
1003260445 6:4511390-4511412 CTGGCCAAGGAGCAGCTGGGGGG - Intergenic
1004780966 6:18908131-18908153 AAGGCCCAGGAGCAGATGGGTGG + Intergenic
1006117114 6:31781349-31781371 CTGACCCGGGGGCTGGTGTGGGG - Intronic
1006152295 6:31995986-31996008 TTGGCCCAGGAGCAGGTAGGAGG + Exonic
1006158598 6:32028724-32028746 TTGGCCCAGGAGCAGGTAGGAGG + Exonic
1006437068 6:34031216-34031238 CGGGCTAAGAGGCAGGTGGGTGG - Intronic
1006718059 6:36132553-36132575 AGGGCCCAGGAGGAGGTGGGAGG + Intronic
1006792898 6:36715400-36715422 CTGGACCAGGGCTGGGTGGGAGG + Intronic
1007365180 6:41386389-41386411 CTGGCCCAGGGGAAGGGCTGAGG + Intergenic
1007473464 6:42105038-42105060 GTGGCCCTGGGGGAGGTTGGAGG + Exonic
1007474007 6:42107215-42107237 CTGGCACAGGAGGCGGTGGGGGG + Exonic
1007474102 6:42107473-42107495 CTGGGCCTGGGGGAGGTGGGGGG + Exonic
1007721924 6:43890337-43890359 CTGCCCCAGAGGCTGGTGTGAGG - Intergenic
1007751105 6:44072621-44072643 CTGGGCCACTGGCAAGTGGGTGG - Intergenic
1007795480 6:44343294-44343316 CGGGGGCGGGGGCAGGTGGGGGG + Intronic
1007821041 6:44561012-44561034 CAGCCCCAGGGCCAGGCGGGTGG + Intergenic
1008905381 6:56672139-56672161 CTGGCTCTGTGGCAGCTGGGAGG - Intronic
1009508168 6:64512477-64512499 ATGGCCCAGGGGAAGGGGGAGGG + Intronic
1013268217 6:108521093-108521115 ATGGACCAGGGGCAGGGGGATGG - Intronic
1013272774 6:108559312-108559334 CTGGCCCAGAGCCCGGCGGGCGG + Intergenic
1015493499 6:133855063-133855085 TGGGGCCAGGAGCAGGTGGGAGG - Intergenic
1015663590 6:135603101-135603123 TGGGCCCAGGAGCAGGCGGGAGG + Intergenic
1015744183 6:136492088-136492110 CTGGGCCAGGGGCAGGGGGTGGG + Intronic
1016932805 6:149426745-149426767 CAGGCCCACAAGCAGGTGGGAGG - Intergenic
1017900645 6:158715997-158716019 CTGGCCCAGGTGCTGAAGGGTGG + Intronic
1017929266 6:158938352-158938374 GTGGCCCAGAGGAAGCTGGGAGG + Intergenic
1018003051 6:159596744-159596766 CTAGACCAGGAGCAGGTGAGAGG + Intergenic
1018081618 6:160263692-160263714 CAGGACCAGGGCCAGGTGTGGGG + Intronic
1018202672 6:161410172-161410194 GGGGGCCTGGGGCAGGTGGGTGG + Intronic
1018684716 6:166295166-166295188 CAGGCACAGAGGCAGGTGTGGGG + Intergenic
1018818204 6:167351383-167351405 CTGGTCCGGGGGCGGGGGGGGGG + Intronic
1019052656 6:169195075-169195097 CAGACCCAGGGAGAGGTGGGAGG - Intergenic
1019190938 6:170250258-170250280 CAGGCCCAGAGGCAGGAGGGTGG - Intergenic
1019299419 7:295947-295969 CTGGCCCTGGGGCAGGGCGGGGG - Intergenic
1019360639 7:602591-602613 CTGGCGCTGGGGCAGGAGGGTGG + Intronic
1019412501 7:912373-912395 CACCCCCAGGGGCAGGCGGGGGG + Intronic
1019453094 7:1109758-1109780 CTGCCCCAGGGCCCGGCGGGCGG - Intronic
1019491204 7:1314400-1314422 CAGGCCCAAGAGCAGGTCGGAGG - Intergenic
1019549163 7:1593703-1593725 CTGGCCAAGGGGAAGGAAGGAGG + Intergenic
1019624596 7:2009559-2009581 CTCACCCAGGGGCAGGTGCTGGG - Intronic
1020091770 7:5345864-5345886 CTGGGCCAGGGGGCGGTGGGGGG - Intronic
1020634113 7:10675449-10675471 CTCCCCCAGGGTCACGTGGGTGG - Intergenic
1021175017 7:17440239-17440261 CAGGCCCACGGGCAGGGGGTGGG - Intergenic
1022098529 7:27155713-27155735 CTGGCACAGGGTCGGGTGAGAGG + Intronic
1022103897 7:27184980-27185002 TTGGACCTGGGGCAGGTTGGAGG + Exonic
1022223003 7:28332594-28332616 CTGGCCCAGGAGAAGGTTGCTGG - Intronic
1022471345 7:30683419-30683441 CTGGGCCAGGGTGGGGTGGGGGG - Intronic
1022473419 7:30695153-30695175 CTGGCCGAGGGGCGGGCGAGGGG + Intronic
1022475072 7:30704752-30704774 CTGGCTCCCAGGCAGGTGGGTGG - Intronic
1023131474 7:37007393-37007415 CATGCCCAGGGGAAGCTGGGAGG - Intronic
1023256592 7:38318645-38318667 GTGGCCATGGGGAAGGTGGGTGG - Intergenic
1023287182 7:38631709-38631731 TGGGCCCAGGGGCAGCTCGGGGG + Intergenic
1023706360 7:42945798-42945820 CTGGGCCAGAGGCGGGTGAGGGG + Intronic
1023841851 7:44102593-44102615 CTGGCCTGGGGGCACGTGGCAGG + Intergenic
1023873686 7:44275896-44275918 CTGACCCTGGGGCAGGGGAGGGG + Intronic
1024226939 7:47332528-47332550 CTGGCCCTGGGGCAGCTCGCGGG - Intronic
1024356307 7:48416772-48416794 ATGGGTCTGGGGCAGGTGGGAGG - Intronic
1025294520 7:57764843-57764865 CGGCCCCATGGTCAGGTGGGAGG + Intergenic
1026136285 7:67664178-67664200 CGGGCACAGAGGGAGGTGGGGGG - Intergenic
1026144921 7:67738411-67738433 CTGGCCCAGGAGGATTTGGGAGG + Intergenic
1026633997 7:72065373-72065395 CTGGGGCAGGGGCAGGGGGGCGG - Intronic
1026874114 7:73869943-73869965 CTGGGCCTGGGGCAGCAGGGGGG - Intergenic
1026916109 7:74121192-74121214 TGGGCCCAGTGGCAGGTGGCCGG - Exonic
1027373978 7:77534080-77534102 CTGTCCCGGAGGGAGGTGGGGGG - Intergenic
1028175918 7:87657897-87657919 CTCCCACAGGGGAAGGTGGGAGG - Intronic
1028477403 7:91266267-91266289 CTGGCGCTGGGCCAGGTGGACGG + Exonic
1029012884 7:97281303-97281325 ATGGCACAGGGGCGAGTGGGTGG - Intergenic
1029159833 7:98543787-98543809 ATGGCTGAGGGTCAGGTGGGTGG - Intergenic
1029280932 7:99435072-99435094 CTGGCCGAGGGGCAGCTGAGAGG + Exonic
1029386391 7:100246463-100246485 GTGGCCCAATGGCAGGTGGTCGG - Intronic
1029409798 7:100401679-100401701 TTGGCCCAGGGGCAGGAGAATGG - Intronic
1029422712 7:100479327-100479349 CTGGCCCCGGGCCAGCTGGCGGG - Intergenic
1029474193 7:100773435-100773457 CTGGCCAAGGGGCACGCAGGAGG - Exonic
1029491057 7:100870362-100870384 CTGGCTCAGGGGCACCTGGAAGG - Exonic
1030270724 7:107665808-107665830 CTTGCCCAGGGTCACGTGGCTGG + Intronic
1030866287 7:114705014-114705036 ATGGCCCAGTGGCAGCTGGTTGG + Intergenic
1031857333 7:126938200-126938222 CTGGCCCATGGGAAGGGGGAAGG - Intronic
1032075403 7:128833542-128833564 CTGGCCCAGGGCCAGTTGCTGGG + Intronic
1032096472 7:128940735-128940757 CTGGCCCAGGGGCTGGGACGGGG - Intronic
1032201379 7:129825348-129825370 CTGGCCCGGGGGCACGTGGCCGG - Intergenic
1032260439 7:130331770-130331792 GTGGCCCTGGCGCAGGAGGGAGG - Intergenic
1032410447 7:131690319-131690341 CTGGCCCTAGGGCAGCAGGGAGG + Intergenic
1033064132 7:138136651-138136673 GTGGCCCAGGCCAAGGTGGGTGG - Intergenic
1033155914 7:138956899-138956921 CAGGCCCAGTGCCAGGTGGAGGG + Intronic
1033369911 7:140698135-140698157 CTGGAGCTGGGGCAGGTGTGGGG + Intronic
1034140871 7:148814750-148814772 CTGGCACAGGGCCAGGTATGGGG + Intronic
1034342019 7:150363559-150363581 CTGGCACAGTGGCAGATGGTGGG + Intergenic
1035055264 7:156031074-156031096 CTGGCCCAGTGGAAGCTGGAAGG - Intergenic
1035129623 7:156640319-156640341 GGGGCCCAGGCCCAGGTGGGCGG + Exonic
1035172156 7:157022795-157022817 GTGGACCAGGGGCTGCTGGGGGG - Intergenic
1035271454 7:157722387-157722409 CAGGGCCAGGGGCAGGGCGGGGG + Intronic
1036678037 8:10851163-10851185 CTGGCCCCGGGGTTGGGGGGAGG + Intergenic
1036678532 8:10853783-10853805 AAGTCCCAGGGGCAGATGGGTGG + Intergenic
1037154536 8:15684196-15684218 TTGCCCCAGGGGTGGGTGGGGGG + Intronic
1037765146 8:21768147-21768169 ATGGCCAAGGAGCAGGTGTGGGG - Intronic
1037812730 8:22096529-22096551 CTGGGCCAGGCCGAGGTGGGAGG + Intronic
1037812759 8:22096629-22096651 CTGGGCCAGGCTGAGGTGGGCGG + Intronic
1039075747 8:33689319-33689341 CTGGCCCAGGGACAGCTGCCTGG - Intergenic
1039882554 8:41634085-41634107 CGGACCCAGTGGGAGGTGGGAGG - Intergenic
1039905266 8:41781772-41781794 GTGACCCAGGGCCAGGAGGGAGG + Intronic
1040110245 8:43564010-43564032 CTGGCGCAGGGCCTGTTGGGAGG + Intergenic
1040554863 8:48469598-48469620 ATAGCCCAGGGTCAGGTGCGTGG + Intergenic
1041602139 8:59731730-59731752 CAGTCCCAGGGGCATGTGAGGGG + Intergenic
1041662258 8:60411846-60411868 GTGGCGCAGGGTCAGCTGGGTGG - Intergenic
1041799771 8:61786414-61786436 GTGGCCAGGGGGCAGGTGAGTGG + Intergenic
1041978931 8:63832860-63832882 CTGGCCCAAGGGCAGGAAGCTGG - Intergenic
1042976746 8:74478347-74478369 CAGGCAAAGTGGCAGGTGGGAGG + Intronic
1044628352 8:94256206-94256228 CAGGCCAAGGAGCAGGTGGGAGG - Intronic
1044628369 8:94256291-94256313 TTAGCCAAGGAGCAGGTGGGAGG - Intronic
1045244815 8:100433813-100433835 GTGGCCCTGGGTGAGGTGGGAGG + Intergenic
1045674208 8:104589488-104589510 CTGGCCCAGCGGGTGGGGGGAGG + Intergenic
1046519413 8:115305036-115305058 CTGGCCCAGGGGCACATGCTGGG + Intergenic
1046529031 8:115420155-115420177 CTGGTCCAGAGTCGGGTGGGGGG - Intronic
1047730332 8:127722779-127722801 CAGGGCGAGGGGGAGGTGGGAGG - Intergenic
1048386087 8:133913752-133913774 ATAGCGCAGGGGCAGGTGGGAGG + Intergenic
1048496511 8:134940277-134940299 CAGGGCAGGGGGCAGGTGGGGGG + Intergenic
1048976212 8:139674439-139674461 GGGGGCCAGGGCCAGGTGGGAGG + Intronic
1049005624 8:139853704-139853726 CTGGGCCAGGGGCAGGCTGGGGG + Intronic
1049042841 8:140125231-140125253 CTGGCCCAGGGGCACTCGGAGGG + Intronic
1049309619 8:141926693-141926715 CTGTCCCAGGGGCTGGAGGCTGG + Intergenic
1049432420 8:142571511-142571533 CTGGACCAAGGGCTGCTGGGAGG - Intergenic
1049438369 8:142598069-142598091 CTGGAGCAGGGTCAGCTGGGAGG - Intergenic
1049446097 8:142632324-142632346 GTGGGCAAGGGGCAGGTGGCAGG + Intergenic
1049468330 8:142763902-142763924 CTGGCCCAGGGGCATGTATGAGG + Intergenic
1049527201 8:143133403-143133425 GTGCCGCAGGGGCAGGTAGGAGG - Intergenic
1049534025 8:143169752-143169774 CTGGCTCATGGTCAGGTGGCAGG - Intergenic
1049537459 8:143188951-143188973 CTGGCCGAGGTCCAGGTGAGAGG + Intergenic
1049773127 8:144392897-144392919 GTGGCCGCGGGGCAGGTGGGTGG + Intronic
1050472314 9:6007100-6007122 CTGGGCCAGGGGCCTGGGGGCGG - Intronic
1050526157 9:6548667-6548689 GTTGCCCAGGTGCAGGCGGGTGG + Intronic
1051563890 9:18474076-18474098 CTGACCGAGGGGTGGGTGGGTGG - Exonic
1053048619 9:34940073-34940095 CAGGCACAGAGGGAGGTGGGGGG + Intergenic
1053066927 9:35075515-35075537 CTGGCCCTGAAGCAGGTGGGTGG + Exonic
1054528079 9:66153593-66153615 CTGGCACTGGCGCAGGTTGGCGG + Intergenic
1054925397 9:70583902-70583924 ATAGCCCAGGGGAAGGTGGGTGG - Intronic
1056007134 9:82284882-82284904 CTGCCTCGGGGGAAGGTGGGTGG - Intergenic
1056132445 9:83599769-83599791 CTGGCCCATGGGCAGCAGTGGGG - Intergenic
1056221209 9:84452148-84452170 CTGTCCTAGTGGCAGGTTGGTGG - Intergenic
1056526429 9:87447018-87447040 CTGTCCAATGGGCAGGTAGGAGG - Intergenic
1056954603 9:91072191-91072213 CTCGGCCAGGGGCATGTGGAAGG - Intergenic
1056968381 9:91183003-91183025 CTGGTGCAGGAGCAGGAGGGAGG - Intergenic
1057133359 9:92669900-92669922 GTGGCCCACGCGCAGGTGAGCGG - Exonic
1057481217 9:95447088-95447110 CAGGCCCAGGGACAGGCGGCGGG + Exonic
1057518277 9:95739465-95739487 ATGGCCCAGGCAGAGGTGGGGGG + Intergenic
1057630442 9:96715623-96715645 CCGTCCGAGGGGGAGGTGGGGGG - Intergenic
1057944049 9:99309252-99309274 CTGGCCTGGGGTAAGGTGGGCGG - Intergenic
1058487603 9:105458034-105458056 CTGGCCAAGCTGCAGGTGGCAGG - Intronic
1058860461 9:109113078-109113100 CGGGGCCAGGGGCAGGGCGGGGG + Intronic
1059445782 9:114337023-114337045 GGGGCCCAGAGGCAGATGGGTGG - Exonic
1059538202 9:115103817-115103839 CTGTTCAAGGGGCAGGAGGGAGG - Intronic
1060213772 9:121726142-121726164 CTGCCCCAGGGGCTGTGGGGTGG - Intronic
1060519972 9:124288756-124288778 CTGGCCCAGGCTCACATGGGCGG + Intronic
1060521985 9:124299150-124299172 GAGGCCCCAGGGCAGGTGGGCGG + Intronic
1060817172 9:126641107-126641129 CTGGCACGGGGGCATGTGGAAGG + Intronic
1060986047 9:127819570-127819592 CTGGCCCAGGGGCTGCTGCTGGG - Intronic
1061010626 9:127952369-127952391 TTAGCCCAGTGGCAGGAGGGTGG - Intronic
1061050713 9:128193078-128193100 CTGGCTCTGCGGCAGATGGGCGG + Intronic
1061085074 9:128393666-128393688 CTGGCCCAGGAGAAGGGAGGGGG - Intergenic
1061255342 9:129451919-129451941 ATGGCCCAGGGGCAGGAGCCAGG + Intergenic
1061307135 9:129738624-129738646 CTGGCTCAGGTGTGGGTGGGAGG - Exonic
1061371791 9:130201541-130201563 CTGGGCCTGGGGGAGGAGGGCGG + Intronic
1061391372 9:130319067-130319089 CTGGCCCAGGAGGAGGCGAGGGG + Intronic
1061625425 9:131838397-131838419 CTGGACCTGGGGCGGGGGGGGGG + Intergenic
1061907002 9:133703981-133704003 CTCGCCCAGGGACAGGGGAGAGG + Intronic
1061932489 9:133840418-133840440 GTGGCTCAGGGGCAGGAGTGGGG - Intronic
1062082893 9:134633855-134633877 CTGGCACAGGGACAGGAGAGCGG - Intergenic
1062116892 9:134814416-134814438 CAGGCCCAGGACCAGCTGGGTGG + Intronic
1062144249 9:134980058-134980080 CTGGCCCTGTGGCAGGAAGGAGG + Intergenic
1062190334 9:135244768-135244790 CTGGCAAAGAGGCAGGTGGGAGG + Intergenic
1062249900 9:135588748-135588770 CTGGGGCTGGGGCTGGTGGGGGG + Intergenic
1062261409 9:135664960-135664982 CTGGCCCAGGGGAAGCAGGGAGG + Intronic
1062311279 9:135938797-135938819 CTGGCACGGGGGATGGTGGGGGG + Intronic
1062341207 9:136094744-136094766 CTGGCCCGGGGCCAGGGCGGAGG - Intronic
1062378556 9:136275907-136275929 CTGGGACACGGACAGGTGGGAGG + Intergenic
1062391466 9:136335654-136335676 CTGGGCCTGGGGCAGGGGGCTGG - Intronic
1062464036 9:136673413-136673435 ATGGCCCAGGAGCAGATGGGAGG - Exonic
1062622171 9:137428061-137428083 CTGGCCCTGGAGCAGCTGAGGGG + Exonic
1062636068 9:137492534-137492556 CGGGGCCATGGGCGGGTGGGTGG + Intronic
1203654532 Un_KI270752v1:10101-10123 CTGGGGCTGGGGCGGGTGGGGGG + Intergenic
1186482536 X:9907032-9907054 CTGGCGTTGGGGCAGGGGGGAGG + Intronic
1186770373 X:12812227-12812249 CTGGCCCAGTGGAAGGTTAGAGG + Intronic
1187700677 X:21962099-21962121 CTGCCCCAAGGGCAGGAGAGGGG - Intronic
1188002200 X:24993666-24993688 CAGGGACAGGGGCTGGTGGGGGG - Intronic
1190266065 X:48827614-48827636 CTGGCGCAGCGGCAGTTTGGGGG - Intergenic
1190310755 X:49115645-49115667 CTGGCCCAGGCAAAGCTGGGAGG - Intronic
1190429493 X:50365563-50365585 CAGGGCCAGGGGCTGGTTGGGGG - Exonic
1191715771 X:64192575-64192597 TTGGCCCAGGGGCATCTTGGGGG + Exonic
1193205885 X:78746937-78746959 CTTGCCATGGGGGAGGTGGGCGG + Intergenic
1195252399 X:103062037-103062059 ATGGGCTGGGGGCAGGTGGGGGG + Intergenic
1195257120 X:103101708-103101730 CGGGCACAGAGGGAGGTGGGAGG + Intergenic
1195825639 X:108997516-108997538 CTGGCCCATGGGCAGTAGTGTGG + Intergenic
1197871384 X:131065745-131065767 CTGACCCAGGCCCAGCTGGGGGG + Intronic
1198153051 X:133930214-133930236 CTGGGCCTGGGGCAGTTGGGGGG - Intronic
1198214912 X:134546544-134546566 CCGGCTCAGGAGCAGGTAGGTGG - Intergenic
1198364580 X:135927997-135928019 ATGGGACAGGGACAGGTGGGTGG + Intergenic
1199793331 X:151175072-151175094 CTTGCCCCGGGGTGGGTGGGGGG - Intergenic
1200100078 X:153685885-153685907 CTGGCCCAGGGGCTGGTAGTGGG + Intronic
1200216291 X:154369514-154369536 CTGGCCCAGGGGCTGGGGAAAGG - Intronic
1200252939 X:154563494-154563516 CTGGCGCAGTGCCTGGTGGGTGG + Intronic
1200264828 X:154640921-154640943 CTGGCGCAGTGCCTGGTGGGTGG - Intergenic
1200746768 Y:6910479-6910501 CTGGAGCTGGGGCTGGTGGGAGG + Intergenic