ID: 1129301180

View in Genome Browser
Species Human (GRCh38)
Location 15:74626447-74626469
Sequence GGCTCCTTGGTGAAGTTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 121}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129301175_1129301180 25 Left 1129301175 15:74626399-74626421 CCAGGGCTCAGCGCAGTAGGATT 0: 1
1: 0
2: 0
3: 8
4: 77
Right 1129301180 15:74626447-74626469 GGCTCCTTGGTGAAGTTGGTAGG 0: 1
1: 0
2: 0
3: 15
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129301180 Original CRISPR GGCTCCTTGGTGAAGTTGGT AGG Intronic
900266027 1:1757630-1757652 GGCTCCTCAGTGACGCTGGTGGG + Intronic
900587684 1:3441006-3441028 GGCCCCTTGGTGGACTTGGGAGG - Intergenic
912726399 1:112062404-112062426 GGCTCCTTGGAGAGGATGGACGG + Intergenic
913201498 1:116498242-116498264 GGCTTCTTGGAGAAGCTGGCTGG - Intergenic
915221566 1:154379203-154379225 GGCTATTTGGTGAAGTTGCCTGG - Intergenic
915453038 1:156020332-156020354 GGCTGCAGGGTGAAGATGGTAGG - Intronic
917626103 1:176847740-176847762 GGCTCCTTGCTGAAGACGGTTGG + Intergenic
922572757 1:226643548-226643570 AGCAACTTGGAGAAGTTGGTGGG - Intronic
1063852499 10:10208886-10208908 GTCTTCATGGTGATGTTGGTGGG + Intergenic
1066441111 10:35439888-35439910 GGCTCTTTGTTATAGTTGGTGGG + Intronic
1067106769 10:43371719-43371741 GGCTGCTGGGTGAAGGGGGTGGG + Intronic
1068647147 10:59480495-59480517 GGCTCCTTGGGAAAGCTGGATGG - Intergenic
1069558891 10:69415903-69415925 GGGTCCTTGGGGAAGCTGGGGGG - Intronic
1069694861 10:70379270-70379292 GGCAGCATGGTGAAGTTGTTGGG - Intronic
1069955655 10:72049723-72049745 GGCTCCTTCTTGAAGTTCTTGGG - Intergenic
1073093634 10:100966783-100966805 GGATCCTAGGTGAAGGGGGTGGG - Intergenic
1080271500 11:30455312-30455334 GCCCCCTTGGCGATGTTGGTTGG - Intronic
1080454936 11:32409811-32409833 GGCTCCATAGATAAGTTGGTGGG - Intronic
1081915350 11:46726960-46726982 GGCTGCTGTGTGGAGTTGGTGGG - Intronic
1084598304 11:70130347-70130369 GGCTCCTTGTGGAAGTTGGGTGG - Intronic
1085667104 11:78423701-78423723 GGCTCCCTGGTGGTGTTGGTGGG + Intergenic
1089460523 11:118650454-118650476 GGCTACTTGGTCAAGATGGGCGG + Exonic
1090807241 11:130210171-130210193 GCCTCCTCAGTGAAGGTGGTGGG + Exonic
1091409152 12:227844-227866 GACTCCTAGGTGAAGTTTCTTGG + Intronic
1094139186 12:27163194-27163216 GTCAGCTTGGTGAAGTTGGTAGG - Intergenic
1096501039 12:52063998-52064020 GGCTGCCTGGTGAGGTTGGCAGG + Intergenic
1096766302 12:53893050-53893072 AACACCTTGCTGAAGTTGGTTGG + Intergenic
1097407491 12:59208635-59208657 GGCTCATTTGTGAACTTGATTGG + Intergenic
1102203815 12:111076545-111076567 GGCTCCTTGGAGCAGCTGCTGGG - Intronic
1102628363 12:114254732-114254754 GGCTACTTGGTGAAAGTGGATGG + Intergenic
1103900931 12:124303342-124303364 GGCTCCTGGGTGAAGCGGGTGGG + Intronic
1108482425 13:50887697-50887719 GGGTCCTTGGTGTACCTGGTGGG + Intergenic
1113225536 13:108155329-108155351 AGCTACTAGGTGAAGTAGGTGGG - Intergenic
1115153516 14:30312734-30312756 GCCTCCTTGGAGAAGTCTGTAGG + Intergenic
1116135478 14:40917749-40917771 GCCTCCTTGGTGAAGTTACCAGG + Intergenic
1116413277 14:44650151-44650173 GGCTCCTGGGTGACATTCGTGGG + Intergenic
1116855877 14:49951994-49952016 GGCTCCCTGGTGAAGTTAAGAGG - Intergenic
1117997916 14:61495406-61495428 GGTTGCTTGGTCAATTTGGTGGG - Intronic
1118882283 14:69840103-69840125 GGCTCCTTGGAAAAAATGGTTGG - Intergenic
1124869405 15:33525995-33526017 GGCTCCTTGCTGAGTTTGTTTGG - Intronic
1129301180 15:74626447-74626469 GGCTCCTTGGTGAAGTTGGTAGG + Intronic
1130823183 15:87516696-87516718 GGGTTCTTTGAGAAGTTGGTTGG - Intergenic
1132486079 16:192086-192108 TGCTGCTTGGTGAGGTTGGAAGG - Intronic
1141772902 16:86101719-86101741 GGCTCCTGGGGGAAATGGGTCGG - Intergenic
1143141367 17:4743612-4743634 GGTTTCTGGGTGGAGTTGGTAGG - Intronic
1143141413 17:4743773-4743795 GTCTCCCTGGAGAAGCTGGTAGG - Exonic
1144288752 17:13805483-13805505 GGCTTCTTGGTGATCCTGGTAGG - Intergenic
1146887433 17:36482036-36482058 GGCTTCTTGGGGAAGCTGGTCGG + Intergenic
1146977113 17:37122985-37123007 ATCTCCTTGGTGAAGATGGTAGG + Intronic
1151689563 17:75673575-75673597 GGCTTCCTGGGGAAGTTGGCTGG + Intronic
1151765407 17:76131081-76131103 GTGTCCTTAGTGCAGTTGGTGGG - Intergenic
1152249435 17:79203854-79203876 GGCTCCTTGGTGACTCTGATTGG - Intronic
1159278337 18:66250104-66250126 GTCTCATTGGTGAAGTTTTTAGG - Intergenic
1160252165 18:77212077-77212099 GGCTCTTTAGTCAAGCTGGTGGG + Intergenic
1162780235 19:13002843-13002865 GGGTCCTTGGCGATGGTGGTGGG - Intronic
1163607947 19:18286030-18286052 GGTTTCTTGGAGAAGGTGGTGGG - Intergenic
1163676125 19:18656159-18656181 GGCTTCATGGTGGGGTTGGTGGG + Intronic
1163717295 19:18879740-18879762 GGGGCCTTGGTGAGGTGGGTGGG - Intronic
1164655844 19:29921191-29921213 GGCTCATTGAAGAACTTGGTGGG - Intergenic
1165870002 19:38964948-38964970 GGCCTCTTGGTCAAGTTGGATGG - Intronic
1168633296 19:57974161-57974183 GGCTCTTTGGTGATGTTTCTGGG + Exonic
930856447 2:56024362-56024384 GGCTCCCTAGTGAATGTGGTGGG + Intergenic
931153516 2:59601477-59601499 GGGCCTTTGGTGAAGTGGGTGGG - Intergenic
931641118 2:64382004-64382026 GGCTGCTTTGTGAAATTAGTTGG + Intergenic
932879807 2:75490649-75490671 GGCTCTTAAGGGAAGTTGGTGGG + Intronic
933395041 2:81720417-81720439 GGCTCCTTGGTGAAGTTTCCCGG + Intergenic
933587978 2:84200658-84200680 GGCTTTTTGATGAAGTTAGTGGG - Intergenic
935826897 2:106961229-106961251 GGCTCCTTGGTGAAGATCTGGGG + Intergenic
942188044 2:173443417-173443439 GGCTCCTTGGAGAGGTTCCTGGG + Intergenic
947803225 2:232945393-232945415 GGATCCTTGTTGAAGTGGATTGG + Intronic
948469002 2:238165541-238165563 GTGTCGTAGGTGAAGTTGGTGGG + Intronic
948485420 2:238277884-238277906 GGCTCCTTGGTGGGGTTACTGGG + Exonic
948784258 2:240343293-240343315 GGTTTCTTGGCCAAGTTGGTGGG - Intergenic
948918161 2:241048749-241048771 GGCTTCTCTGTGAATTTGGTAGG + Exonic
1170154170 20:13254537-13254559 TGCTCCTTGGTGCACTTGCTGGG + Intronic
1171102131 20:22394214-22394236 AGCTCCTTGGTGTTGTGGGTGGG + Intergenic
1171253990 20:23672421-23672443 GGCATCTTGGTGAACTTGGTGGG + Intergenic
1171260489 20:23727701-23727723 GGCATCTTGGTGAACTCGGTGGG + Intergenic
1171269606 20:23803517-23803539 GGCATCTTGGTGAACTTGGTGGG + Intergenic
1178258666 21:31078544-31078566 GGATTCTTGTTGAAATTGGTGGG + Intergenic
1179953453 21:44724423-44724445 GCCTCTTTGGGGAAGGTGGTGGG + Intergenic
1179953468 21:44724464-44724486 GGCTCTGTGGGGAAGGTGGTGGG + Intergenic
1181137916 22:20782156-20782178 GGCTCTTTGGTGTACTTGGGGGG - Intronic
1184254765 22:43280643-43280665 GGCTGATAGGGGAAGTTGGTAGG - Intronic
1184801516 22:46763125-46763147 GGCTCCTTGGGGAGGCTGGAAGG + Intronic
952314539 3:32221173-32221195 GGCACCTTGGTGGAGTTGGCTGG - Intergenic
952314622 3:32221861-32221883 GGCACCTTGGTGGAGATGGCTGG + Intergenic
953712325 3:45284648-45284670 GACACCTTGGTGAAGTTTCTGGG - Intergenic
953748201 3:45591214-45591236 GGCTCCTGGGTGAAATGGGATGG - Intronic
954539215 3:51382619-51382641 GGCTCCTGGGTAAAGAGGGTGGG + Exonic
956961672 3:74409956-74409978 TGATCCTTGGTGAAGTATGTTGG - Intronic
957109420 3:75933681-75933703 GGCTTGTTGGTCAAGTTGGCTGG + Intronic
957641386 3:82858118-82858140 AGCTTCTTGTTGAAGATGGTTGG - Intergenic
959079426 3:101784389-101784411 GTCTCCTTTGTGAAGCTGATTGG + Intronic
965604157 3:170483034-170483056 TGCTCCTTTGTGAAGATGATGGG - Intronic
970246767 4:14072316-14072338 GGCTGGTTGCTGCAGTTGGTGGG - Intergenic
971194861 4:24462919-24462941 TGCTCCTGGGTGAAGGTGGAGGG - Intergenic
971756739 4:30717540-30717562 GGCTCCGCCGCGAAGTTGGTAGG + Intergenic
975938329 4:79609373-79609395 GGCGCTTTGGTGAAGTCCGTAGG + Intergenic
978308687 4:107361537-107361559 GGGTCTGTGGTGAAGATGGTTGG + Intergenic
982106982 4:152019747-152019769 GGCTGCTTGGTGGAGTAGGAGGG + Intergenic
985652081 5:1111966-1111988 GGCACCACGGTGAAGTTGGTGGG + Exonic
985685722 5:1280603-1280625 GGCTCCCTGGTGCTGATGGTGGG - Intronic
989215800 5:38903056-38903078 GGCTCATTGGTGAAGTAGAAGGG - Intronic
989368097 5:40679147-40679169 GGAGCCTTGGTGAGGTTGGGAGG - Intergenic
991427933 5:66510774-66510796 GGGACCTTGGTGGAGATGGTTGG - Intergenic
993716815 5:91283131-91283153 AGCTGCTTGGGGAAGTTGATGGG - Intergenic
994386236 5:99136367-99136389 GGCTCCTAAGCGAAGTTGGTAGG - Intergenic
996030556 5:118699794-118699816 GGGTCCTTGGGCAAGTTAGTTGG - Intergenic
998959222 5:147466911-147466933 GGCTCCTTGGATAAGTTGCTCGG - Intronic
1010333076 6:74646946-74646968 GGCCCCTGGGTGAAGTGTGTGGG - Intergenic
1010496413 6:76538039-76538061 GGCTCCTTGCTGTAGCTGCTTGG + Intergenic
1010621171 6:78077213-78077235 AGATCCTTGGTGAATTTTGTTGG + Intergenic
1013074107 6:106755254-106755276 GGATCCTGGGTGGAGGTGGTGGG + Intergenic
1013659349 6:112278984-112279006 GGTGCCTTGGTGAAGTGGGAAGG + Intergenic
1019226316 6:170512880-170512902 GGCTGTTTGGTGAGATTGGTGGG + Intergenic
1021399814 7:20196855-20196877 GGCTGCGAGGTGAAGTTTGTGGG - Intronic
1031755782 7:125640205-125640227 GGCTCATTGTTCAAGTTGGACGG - Intergenic
1033866339 7:145694652-145694674 GGCTCCTTGTTGAAGATCATTGG + Intergenic
1034472582 7:151263395-151263417 GCCCCCTTGGTGAAAGTGGTAGG - Intronic
1035611368 8:967122-967144 GGCTCCTTGGAGAGGTGGCTGGG + Intergenic
1037197628 8:16210446-16210468 AGCTCCTAGGTGACCTTGGTAGG + Intronic
1038779556 8:30558306-30558328 GGCTCCTTGCTGAAGGCTGTAGG + Intronic
1047169727 8:122480292-122480314 GGGTTCTTTGAGAAGTTGGTTGG - Intergenic
1048912541 8:139149819-139149841 GGCTCATTCCTGAAGCTGGTTGG + Intergenic
1049611069 8:143555570-143555592 GCCTCCATGGTGAAGATGGAAGG - Intronic
1057451825 9:95169590-95169612 GGCAGCTTGGTGAGATTGGTAGG - Intronic
1187204687 X:17170892-17170914 TGCTCCTTTGTGACATTGGTTGG + Intergenic
1187485103 X:19695668-19695690 AGCTCCTTGATGAAGTTGGAAGG + Exonic
1189351855 X:40281449-40281471 GGCTCCTTGGTCAAATCTGTAGG - Intergenic
1191845588 X:65545230-65545252 GGCTGCCTGGGGAAGGTGGTAGG + Intergenic
1192199414 X:69056024-69056046 GGCTCCTTGGAGAAATGGCTGGG + Intergenic
1199385262 X:147216227-147216249 GGCTCCTTGTGGGAGTTGTTTGG + Intergenic
1200138094 X:153884755-153884777 AGCTCCTTGCTGCAGGTGGTGGG - Intronic
1200219227 X:154382875-154382897 GGCTCCTTGCTGCAGGTAGTGGG + Intergenic
1202373267 Y:24212401-24212423 GGCTCCTTGGTGAGGTGTGGTGG - Intergenic
1202497515 Y:25457719-25457741 GGCTCCTTGGTGAGGTGTGGTGG + Intergenic