ID: 1129302537

View in Genome Browser
Species Human (GRCh38)
Location 15:74633828-74633850
Sequence CTGAGAAATGCTAATACTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 198}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129302537_1129302543 21 Left 1129302537 15:74633828-74633850 CCTAGAGTATTAGCATTTCTCAG 0: 1
1: 0
2: 0
3: 22
4: 198
Right 1129302543 15:74633872-74633894 GCTTAGAATGTGCCACCGGGGGG 0: 1
1: 0
2: 0
3: 5
4: 60
1129302537_1129302541 19 Left 1129302537 15:74633828-74633850 CCTAGAGTATTAGCATTTCTCAG 0: 1
1: 0
2: 0
3: 22
4: 198
Right 1129302541 15:74633870-74633892 TTGCTTAGAATGTGCCACCGGGG 0: 1
1: 0
2: 0
3: 6
4: 56
1129302537_1129302539 17 Left 1129302537 15:74633828-74633850 CCTAGAGTATTAGCATTTCTCAG 0: 1
1: 0
2: 0
3: 22
4: 198
Right 1129302539 15:74633868-74633890 CCTTGCTTAGAATGTGCCACCGG 0: 1
1: 0
2: 0
3: 8
4: 121
1129302537_1129302540 18 Left 1129302537 15:74633828-74633850 CCTAGAGTATTAGCATTTCTCAG 0: 1
1: 0
2: 0
3: 22
4: 198
Right 1129302540 15:74633869-74633891 CTTGCTTAGAATGTGCCACCGGG 0: 1
1: 0
2: 1
3: 8
4: 102
1129302537_1129302542 20 Left 1129302537 15:74633828-74633850 CCTAGAGTATTAGCATTTCTCAG 0: 1
1: 0
2: 0
3: 22
4: 198
Right 1129302542 15:74633871-74633893 TGCTTAGAATGTGCCACCGGGGG 0: 1
1: 0
2: 0
3: 4
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129302537 Original CRISPR CTGAGAAATGCTAATACTCT AGG (reversed) Intronic
907081791 1:51630145-51630167 CTGAGAAATGCAACTACACCTGG - Intronic
908891965 1:68858862-68858884 GTGAGAAAGGCTTATAGTCTGGG - Intergenic
908909568 1:69057256-69057278 GTGAGAAATGGTAAGACTCTGGG + Intergenic
910161009 1:84272165-84272187 CTGAGAACTGCAAAAACTCTGGG - Intergenic
910615294 1:89190970-89190992 CTGAGAAACACTAATCCTATAGG + Intronic
911416684 1:97583572-97583594 CTGCCACCTGCTAATACTCTCGG + Intronic
912256334 1:108062324-108062346 CAGAGAAATGGCAACACTCTAGG + Intergenic
913238979 1:116811461-116811483 CTGCTGAATGTTAATACTCTGGG + Intergenic
913595091 1:120367721-120367743 TTGAGTCATGCGAATACTCTGGG + Intergenic
914306352 1:146422601-146422623 TTGAGTCATGCGAATACTCTGGG + Intergenic
914595696 1:149150202-149150224 TTGAGTCATGCGAATACTCTGGG - Intergenic
915692055 1:157699577-157699599 ATCAGCAATGCTAATGCTCTGGG - Intronic
916919115 1:169443615-169443637 CTGAGAAAAGCTAAAACTATAGG - Intronic
917130524 1:171737664-171737686 CTGAGAAATATTAATATTTTTGG + Intronic
918801197 1:188974258-188974280 CTGTGAAATTCTAATAGTCATGG + Intergenic
922247177 1:223812233-223812255 ATGAGAAATGCTGATACTTAGGG - Intronic
922409452 1:225357081-225357103 CTGAGAAATTCTCCTTCTCTAGG - Intronic
1063154792 10:3369119-3369141 CTGAGAACTGCAAATTCTCAAGG - Intergenic
1065580327 10:27164531-27164553 CTGAAACATGCTAATAATCTGGG + Intronic
1066602043 10:37120097-37120119 CTGAAACATGCTAATAATCTCGG - Intergenic
1067181994 10:43995194-43995216 CTCAGAAAGGCTAATTCCCTTGG + Intergenic
1068445302 10:57114471-57114493 CTGTAAAAGGATAATACTCTAGG - Intergenic
1070009107 10:72454865-72454887 CTGAGAAATGCTAGGAGTTTTGG + Intronic
1070820571 10:79351751-79351773 CTGAGAGATGAGAAAACTCTAGG - Intronic
1072246177 10:93546126-93546148 CTGAAAAATGAAAATAATCTGGG - Intergenic
1072348188 10:94529657-94529679 CTGAGTAACTCTAATGCTCTTGG - Intronic
1072511109 10:96125943-96125965 CTGTGAATTGGTAATACTATAGG + Intergenic
1072511751 10:96133593-96133615 CTTTGAAATGCTAAGATTCTTGG + Exonic
1072831123 10:98659901-98659923 GAGAAAAATGCTAATACTCTTGG - Intronic
1073699520 10:105910111-105910133 ATGAGAAATGCCACTATTCTGGG - Intergenic
1075849338 10:125574468-125574490 CTGATAAATGTTAATATTCTTGG - Intergenic
1077904447 11:6519012-6519034 CTGACAATTGCCAATGCTCTGGG - Intronic
1078951183 11:16136276-16136298 CTAAAAAATGCTAATGATCTTGG - Intronic
1080288094 11:30640036-30640058 CTGAGAATGCCTAACACTCTGGG - Intergenic
1080575427 11:33594589-33594611 TTGAGAAATGCTTATGCTTTGGG - Intronic
1080907222 11:36558344-36558366 CTGTTAAATGCTAATACAGTAGG + Intronic
1080971164 11:37279093-37279115 CTGAAAAATTCTAATAGTTTAGG + Intergenic
1082108079 11:48242513-48242535 CTGAGAAATGCTAAGCCACTGGG - Intergenic
1086166286 11:83782700-83782722 ATGAGAAAGGCTGATACTGTGGG + Intronic
1088682525 11:112256085-112256107 CCCAGAAATGCTGATTCTCTTGG + Intronic
1089393451 11:118117640-118117662 CTGATAAATGCAAATACCTTAGG + Intronic
1090357913 11:126152723-126152745 CTGTGAAATGCTGTTGCTCTGGG + Intergenic
1090514975 11:127415444-127415466 TTTAAAAATGCAAATACTCTTGG + Intergenic
1093516524 12:19993260-19993282 CTATGAAATCATAATACTCTGGG + Intergenic
1093726815 12:22522586-22522608 CTGGGAAAGGCCAATACTTTAGG - Intronic
1093778888 12:23111060-23111082 TTGAGAAATGCTCATGTTCTAGG - Intergenic
1095786729 12:46118305-46118327 CAGAGAACTCCTAAAACTCTTGG + Intergenic
1098251357 12:68572974-68572996 CAGAGATATCATAATACTCTTGG + Intergenic
1098928082 12:76375699-76375721 CTGAGCAAGGCAAACACTCTTGG + Intronic
1099813438 12:87615589-87615611 CTGAGAAATGTTTTTATTCTAGG - Intergenic
1100152386 12:91755129-91755151 CAGAGAAATGCTTATACAATAGG + Intergenic
1102228886 12:111248657-111248679 CAGAGAAACGCTAATGCTCATGG + Intronic
1102422464 12:112814844-112814866 CTGTGAAATGCTGACACTCAGGG + Intronic
1102560634 12:113759706-113759728 TTGAGAAAGGAAAATACTCTTGG + Intergenic
1103152461 12:118652749-118652771 CTGAGAAATTAAAATACTCAAGG + Intergenic
1106609528 13:31265215-31265237 CTGGCAACTGTTAATACTCTGGG - Intronic
1106706658 13:32287741-32287763 GTGAGCAATGCTAATACTGCTGG + Intronic
1106857295 13:33867091-33867113 CAAGGCAATGCTAATACTCTTGG + Intronic
1107245086 13:38284200-38284222 GTCAGAAATGCAAATACTGTTGG - Intergenic
1108141326 13:47425196-47425218 CTAAGAAATGTTGATATTCTGGG - Intergenic
1108690473 13:52855201-52855223 CTGGGAAATGGGAATACTCAGGG + Intergenic
1110123391 13:71911038-71911060 CTATGCAATGCTATTACTCTTGG - Intergenic
1111377040 13:87393927-87393949 CTGAACAATGTTAACACTCTTGG - Intergenic
1111909744 13:94297541-94297563 CTGAGAAATGCAAATCCTTCAGG + Intronic
1115672884 14:35635392-35635414 CTGAGAAATGTTATTTCTCTAGG + Intronic
1118361652 14:65062228-65062250 CTTAGTAGTGTTAATACTCTTGG - Exonic
1123203405 14:106690397-106690419 CTGAGAATTGCTAACACATTAGG + Intergenic
1124984411 15:34592059-34592081 CTGAGAAATACAAAAACTTTGGG - Intergenic
1127388960 15:58489979-58490001 CTGTGACCTGCTAATACTGTGGG + Intronic
1129302537 15:74633828-74633850 CTGAGAAATGCTAATACTCTAGG - Intronic
1130113412 15:80985568-80985590 CTGAAAAATACAAATATTCTAGG - Intronic
1130387734 15:83426753-83426775 CTGAGAAATCCCAATATTTTAGG + Intergenic
1130755666 15:86760427-86760449 TTGAGAAATGTTAATGGTCTAGG - Intronic
1130967682 15:88709386-88709408 CAGAGATATGCCTATACTCTGGG + Intergenic
1131381387 15:91966718-91966740 CTGAGACATTCTAATACACCAGG - Intronic
1134367159 16:13590034-13590056 ATGAGCAATTCTAAGACTCTTGG - Intergenic
1134803564 16:17106756-17106778 CTCAGGAATTCCAATACTCTTGG + Exonic
1136717807 16:32298837-32298859 CTGAAACATGGTAATAATCTGGG - Intergenic
1136836182 16:33505107-33505129 CTGAAACATGGTAATAATCTGGG - Intergenic
1137794314 16:51202417-51202439 CTGTGAATCGCTCATACTCTTGG + Intergenic
1141016975 16:80459838-80459860 CTGAGAAATAAAAATAGTCTTGG - Intergenic
1203008622 16_KI270728v1_random:218929-218951 CTGAAACATGGTAATAATCTGGG + Intergenic
1203146359 16_KI270728v1_random:1805399-1805421 CTGAAACATGGTAATAATCTGGG - Intergenic
1143466751 17:7142185-7142207 TTGAGAAATAGTAAAACTCTGGG + Intergenic
1144326144 17:14182217-14182239 CTAAAAAATGCTCAAACTCTTGG - Intronic
1144475019 17:15579104-15579126 CTAAAAAATGCTCAAACTCTTGG - Intronic
1147422662 17:40330430-40330452 CTGAGAAGTGCCAATGCTTTAGG + Intronic
1147644195 17:42024050-42024072 CTGGGAAGTGCAAATACTCTTGG + Exonic
1151628076 17:75289933-75289955 ATGAGAAATACTAAAACTCGGGG - Intergenic
1154474659 18:14744756-14744778 CTGAAACATGCTAATAATCTGGG - Intronic
1155918275 18:31577424-31577446 CTGGGGAATGGTGATACTCTCGG + Intergenic
1158527309 18:58226676-58226698 CTGAGCAGTGCTAATAGCCTCGG + Intronic
1160574888 18:79847677-79847699 TTGAAAAATCCTGATACTCTGGG + Intergenic
1163317151 19:16548553-16548575 CTTAGAAATGCTAAGACCCGGGG - Intronic
1165000694 19:32759384-32759406 CTGAGACATGCTAGAACTCCAGG - Intronic
1166423209 19:42654067-42654089 CTGAGAAATGCTCCTGCCCTGGG + Intronic
925603777 2:5637064-5637086 TTGAGTCATGCGAATACTCTGGG + Intergenic
926025097 2:9535229-9535251 CTGAAAAATGAGAAGACTCTGGG - Intronic
926375836 2:12226374-12226396 TTCAGAAATGCTAATCATCTGGG - Intergenic
926477403 2:13341626-13341648 CTCAGAAAGGCTAATTCACTAGG - Intergenic
926711590 2:15886512-15886534 CTGAGAAATGGTGGTGCTCTAGG - Intergenic
926813897 2:16781421-16781443 CTGAGAAATGTTCTAACTCTGGG - Intergenic
927278367 2:21280960-21280982 CTGATAACTGCTTAAACTCTTGG - Intergenic
927754872 2:25700651-25700673 CAGAGATATCCTAATACCCTGGG + Intergenic
931292775 2:60890455-60890477 CTGAGAAATGGTAACACAGTGGG - Intronic
931458525 2:62431381-62431403 CTGAGAAGTGCCAACACTTTCGG + Intergenic
932173728 2:69580177-69580199 CTAAGAAATTCTAGTAGTCTAGG - Intronic
933044751 2:77521620-77521642 CTGAGCAAAGCTGATCCTCTTGG - Intronic
933158631 2:79000638-79000660 CTGAAAAATGCTCAGACTATGGG - Intergenic
936844880 2:116818924-116818946 ATGAATACTGCTAATACTCTAGG + Intergenic
937185871 2:120041870-120041892 CTGCCACATGCTAATACTTTTGG + Intronic
937696564 2:124814928-124814950 CTCCGTAATGCTAATACTGTTGG + Intronic
939447513 2:142329295-142329317 CAGAGACATGGTAAGACTCTAGG + Intergenic
940932808 2:159455019-159455041 CTGTGAAAAGAGAATACTCTAGG + Intronic
941554554 2:166960489-166960511 TTCAGAAATGCAAAGACTCTTGG + Intronic
943678704 2:190745068-190745090 CTGATACAAGCTAAGACTCTAGG + Intergenic
945263160 2:207863429-207863451 CTTAGTAGTGTTAATACTCTGGG - Intronic
947228753 2:227864662-227864684 CTGGGAAATTCTCATACTTTTGG + Intergenic
948184383 2:236008506-236008528 CTGTGAAAACTTAATACTCTTGG + Intronic
1169598704 20:7231107-7231129 GTTAGAAATGCTAATAGTCATGG + Intergenic
1170320836 20:15096123-15096145 CTGAGAAATGAAAAGACACTAGG + Intronic
1173355933 20:42290379-42290401 TTGAGAAATGCTTCTACTCAAGG + Intronic
1174274594 20:49394581-49394603 CTGAGAAGTGCTAAGACTTCTGG - Intronic
1175107296 20:56624747-56624769 CCCAGAAATGTTAATACTTTTGG + Intergenic
1175877146 20:62235748-62235770 CTGAGAAATGCTCATCCTGCAGG - Intronic
1176705329 21:10112984-10113006 CTGAAAAAAGATAAAACTCTCGG - Intergenic
1178799760 21:35781793-35781815 CAGAGAAATACTTATTCTCTAGG + Intronic
1178801423 21:35799255-35799277 CTGAGAGATGAAAATATTCTTGG - Intronic
1180627041 22:17200585-17200607 CTTAGATATGTTAATACCCTTGG - Intronic
1180708458 22:17823939-17823961 TAGAGAAATACTAATACTTTGGG + Intronic
1182843203 22:33409044-33409066 CTGAGATAGGCTATTTCTCTTGG + Intronic
1183104922 22:35608833-35608855 TTGAGAAATGGAAACACTCTCGG + Intronic
949203347 3:1407619-1407641 CTGTGAAATGCTCATTCTTTGGG + Intergenic
950394223 3:12721323-12721345 CTGAGAATTGCTAAGACTTTGGG + Intergenic
951564567 3:24000323-24000345 CTGGGTGATGCTAATGCTCTTGG + Intergenic
951872789 3:27383772-27383794 CTCAGAAATTGAAATACTCTCGG + Intronic
952172480 3:30823304-30823326 GTGAGAAGTGATAATACTCCAGG - Intronic
953261610 3:41344659-41344681 ATGAGAAATGCTTAAACTCGGGG + Intronic
955418972 3:58718420-58718442 CTTAGAAAAGCTAAGACTCCAGG + Intronic
956053826 3:65277588-65277610 CAGAGCATTGCAAATACTCTGGG - Intergenic
956144346 3:66177183-66177205 CTGAGAACTGCAAATACGCTGGG + Intronic
960561922 3:119093898-119093920 CTGAGATGTGTAAATACTCTTGG - Intronic
960900665 3:122551233-122551255 TGGAGAAATGCTAATATTTTTGG + Intronic
962169754 3:133088364-133088386 CTGAGCAAAGCTAATACACAGGG + Intronic
963877413 3:150492139-150492161 ATTAGAAATGCAAATTCTCTAGG - Intergenic
963991336 3:151658991-151659013 CTGAGGATTTCTAACACTCTTGG + Intergenic
964555458 3:157932651-157932673 CTAGGAAATGCTGATACCCTTGG + Intergenic
965951114 3:174309227-174309249 CTCATAAAAGCTATTACTCTAGG - Intergenic
966902441 3:184496497-184496519 CTGAAAAACCCTAATACACTGGG + Intronic
967642418 3:191881748-191881770 GTGAAAAATGATGATACTCTTGG + Intergenic
968279553 3:197465860-197465882 CTGAGAAAGGAAAATACTCCAGG - Intergenic
969987725 4:11228996-11229018 CAGTGAAATCCTCATACTCTGGG - Intergenic
970320954 4:14874930-14874952 GTGAGAAATGCTATAACTCCTGG + Intergenic
974108243 4:57495609-57495631 TTGATAAATGATAATACGCTGGG - Intergenic
975033231 4:69650050-69650072 CTGAGAAATGGCAATCCTCTTGG + Intronic
976568585 4:86582041-86582063 CTGAGAATTCCTATTACACTTGG - Intronic
978499184 4:109390433-109390455 CTGATAACTGCTAATACAATTGG + Intergenic
978926335 4:114250191-114250213 CTGACAAATGCTAGGACTGTAGG + Intergenic
978935414 4:114368887-114368909 CTCAGAAATGCCAAAACTTTGGG + Intergenic
980377592 4:131969668-131969690 CTGAAAAAAGATAAAACTCTCGG - Intergenic
980701301 4:136434824-136434846 CTGTGAAATGTTAGTTCTCTGGG + Intergenic
980999838 4:139818053-139818075 CTGAGAATTTCTGATACTGTAGG + Intronic
984145123 4:176050996-176051018 CTCAGAAAGGCTAATTTTCTGGG - Intergenic
984613039 4:181863011-181863033 ATGAAAAATGTTAATACTTTTGG + Intergenic
985358213 4:189143949-189143971 CTTAGATATGCTAATATCCTGGG + Intergenic
987158743 5:15117651-15117673 CTGAGAAAATGTAATTCTCTAGG - Intergenic
987652774 5:20765458-20765480 TTAAGAAATGCTAAAACTTTAGG + Intergenic
988731000 5:33972488-33972510 CTGAGAAATGCTTGTACTGAAGG + Intronic
988742784 5:34096026-34096048 TTAAGAAATGCTAAAACTTTAGG - Intronic
989243900 5:39231795-39231817 CTGAGAATTGCTGATTCTGTGGG - Intronic
989273388 5:39558168-39558190 CTGAGAAATTCTTAAACTCTAGG + Intergenic
990101145 5:52188948-52188970 CTGAAAAATGCTGAGACACTAGG + Intergenic
992442775 5:76811399-76811421 CTGAAAAATGATACTGCTCTAGG - Intergenic
995932005 5:117456713-117456735 CAGGGACATGCTAATGCTCTTGG + Intergenic
998299911 5:141007943-141007965 TTGAGAACTGCTCATTCTCTGGG + Intronic
1000778928 5:165455003-165455025 TAGAGAAATACTTATACTCTAGG - Intergenic
1001831315 5:174791489-174791511 CTGAGAAATGCTGATTCTGTAGG - Intergenic
1002663957 5:180809714-180809736 CTGAGAAATGGGAACACTGTGGG - Exonic
1002968238 6:1989252-1989274 CTAAGAAATGGGCATACTCTTGG + Intronic
1003338772 6:5199796-5199818 GTGACAAATGCTAATACCCTGGG - Intronic
1003594057 6:7458908-7458930 CTGAGAACCGCAAAAACTCTCGG - Intergenic
1005431319 6:25760547-25760569 CTGAGAAAAGGCAATACTTTAGG - Intronic
1006317080 6:33297564-33297586 CTGAAAAAGACTAATTCTCTGGG - Intronic
1008906054 6:56678977-56678999 CTGAGAACTGCTCATTCCCTGGG + Intronic
1012679593 6:102162924-102162946 CTGAGAAATGAAAATAATTTTGG - Intergenic
1014238391 6:118987090-118987112 CTGTGAAATTCTGATACTCCTGG - Intronic
1014260010 6:119205654-119205676 CTGAGACATGGCAGTACTCTTGG + Intronic
1017680299 6:156857157-156857179 CTGGAAAATGGTAATACTTTTGG - Intronic
1020623290 7:10544846-10544868 CTCAGAAATGATTATAATCTAGG - Intergenic
1023714940 7:43034508-43034530 CTGAGAGATGGCAATACTCTAGG + Intergenic
1024449355 7:49521312-49521334 CTTAGAAATGCCAATTCACTTGG - Intergenic
1028110261 7:86932240-86932262 CTGTGTAATGCTAATATTCTTGG - Intronic
1030561580 7:111093676-111093698 CTGAGAAATACCAACACTCCAGG + Intronic
1032457202 7:132082233-132082255 CTCAGCAATGATATTACTCTGGG + Intergenic
1035390368 7:158500454-158500476 CTGAGACTTGCTAATTCCCTGGG - Intronic
1035944916 8:3951592-3951614 GAGAGAAATACTACTACTCTAGG + Intronic
1038008301 8:23452864-23452886 CTGTGATAAGCAAATACTCTGGG - Intronic
1038416793 8:27402609-27402631 TTGGGATATGCTAATACCCTAGG - Intronic
1038778927 8:30554667-30554689 GTCAGAAATGCCAAAACTCTGGG - Intronic
1039131202 8:34266023-34266045 TTGAAAAATGCTCATACTCTTGG + Intergenic
1039811161 8:41049434-41049456 CTGAGAAACCCAAATACTCCTGG + Intergenic
1043614260 8:82105828-82105850 CTGATAAAAGATAATAATCTTGG + Intergenic
1047184724 8:122622491-122622513 TTGAGAAATACTAATATGCTTGG - Intergenic
1048095715 8:131290951-131290973 ATGAAAAATGCTAATAACCTTGG + Intergenic
1048358470 8:133673819-133673841 CTGAGAAAAGGTTATACTCTAGG - Intergenic
1048827294 8:138440752-138440774 CTGAGATATACTCATACTGTAGG + Intronic
1048879818 8:138863125-138863147 CTGAGAAATAGTAAAAGTCTGGG - Intronic
1050722724 9:8609175-8609197 CTGAGAAAAGCTGATATTCCGGG + Intronic
1051001231 9:12285321-12285343 CTGAGGAATGCTAACACACCTGG + Intergenic
1051055468 9:12979909-12979931 ATGAGAAATGCTCATAGACTTGG - Intergenic
1051073124 9:13197418-13197440 CTGAGCAATTCTAACACTATCGG + Intronic
1052217262 9:25982501-25982523 CTTAGAAATCATAATAATCTTGG + Intergenic
1053763544 9:41365411-41365433 CTGAAAAAAGATAAAACTCTCGG + Intergenic
1054542153 9:66276550-66276572 CTGAAAAAAGATAAAACTCTCGG + Intergenic
1185668322 X:1786166-1786188 ATGAGGAAAGCTAATACTCAAGG + Intergenic
1187940696 X:24378033-24378055 CTTGGAAATGCTAATTCTCAGGG - Intergenic
1189154977 X:38747805-38747827 CTGAAAAATGCTATTAATATGGG - Intergenic
1194442306 X:93947785-93947807 CTGAGGAATGCTAATATTTATGG - Intergenic
1194978174 X:100413451-100413473 CTAAGAAATACTAATACTAATGG + Intergenic
1196752934 X:119133522-119133544 CTGAGAAATGCTGCTGCTCTTGG - Intronic
1201503960 Y:14677352-14677374 CTGAGAAAACCTAAAACCCTTGG + Intronic