ID: 1129313018

View in Genome Browser
Species Human (GRCh38)
Location 15:74725543-74725565
Sequence GGCACTGCCACCTTTATAGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 83}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129313016_1129313018 -4 Left 1129313016 15:74725524-74725546 CCTTCAGGGTGAGGGTGAAGGCA 0: 1
1: 0
2: 2
3: 22
4: 266
Right 1129313018 15:74725543-74725565 GGCACTGCCACCTTTATAGGCGG 0: 1
1: 0
2: 1
3: 10
4: 83
1129313011_1129313018 10 Left 1129313011 15:74725510-74725532 CCAAGGAACTGTCACCTTCAGGG 0: 1
1: 0
2: 0
3: 24
4: 190
Right 1129313018 15:74725543-74725565 GGCACTGCCACCTTTATAGGCGG 0: 1
1: 0
2: 1
3: 10
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129313018 Original CRISPR GGCACTGCCACCTTTATAGG CGG Exonic
900353615 1:2249116-2249138 GGCACTGCCACCCTGATGGTCGG + Intronic
900570577 1:3356289-3356311 GGCACTGTCACCTTTAGAGATGG - Intronic
900726573 1:4220206-4220228 GGCTCTGCCCCCTTTTTAGTAGG + Intergenic
903236141 1:21951889-21951911 GGCACTGCCCCACTTCTAGGCGG - Intergenic
903651325 1:24923961-24923983 GGCACTGCCAGCGTTAGGGGTGG + Intronic
905346583 1:37315177-37315199 GCCACTGCCACCCTCAAAGGAGG - Intergenic
1065482894 10:26212802-26212824 GGCACTAGCATCTTTATAGATGG - Intergenic
1067049842 10:43008636-43008658 GGCACATCCACCATTATAGTTGG - Intergenic
1069022783 10:63507339-63507361 GGCACAGCCACTTTTAAAGACGG - Intergenic
1072089135 10:92109782-92109804 TGCACTCTCCCCTTTATAGGTGG + Intronic
1073686366 10:105758810-105758832 GTCACTGCCACCATTCTAAGTGG - Intergenic
1081728630 11:45352631-45352653 GGCCCAGCCTCCTTTATAGTAGG - Intergenic
1083599557 11:63938616-63938638 GGCACAGCCACCTTCCCAGGCGG - Intergenic
1083617792 11:64035215-64035237 GGCACTGCCCCCTTAATAGGTGG + Intronic
1092151418 12:6251511-6251533 GGCCCTGCCCCCTTTATGGAGGG + Intergenic
1098992047 12:77074278-77074300 GCCACTGCCACCATCATAGAGGG - Intergenic
1101722411 12:107361600-107361622 GTCACTGCAACCTTTCTGGGGGG - Intronic
1105903245 13:24776748-24776770 GGAACTGCCTCCTTCAGAGGGGG - Intronic
1106857957 13:33873178-33873200 GGCATTGCCAAGTTTAGAGGGGG + Intronic
1112419113 13:99231287-99231309 GACACTGCCACCATTCAAGGTGG - Intronic
1115763448 14:36598582-36598604 GGCACTGCCAGCTTTTCAGGAGG - Intergenic
1124205899 15:27719902-27719924 GGCATTAGCAGCTTTATAGGAGG - Intergenic
1126845730 15:52759064-52759086 GCCACTGCCACCTTTATATCTGG + Intronic
1127025487 15:54800649-54800671 GGTTCTGCAAGCTTTATAGGAGG - Intergenic
1127998571 15:64170327-64170349 GGCACGGCCACCTTTCTGGAAGG + Exonic
1129313018 15:74725543-74725565 GGCACTGCCACCTTTATAGGCGG + Exonic
1129666580 15:77582696-77582718 GTCACTGCCCCTTTTATGGGCGG - Intergenic
1129975354 15:79816902-79816924 GGCACTGCCAACCTCACAGGAGG + Intergenic
1132057525 15:98663458-98663480 GGAACTGTCACCTTTATTAGGGG + Intronic
1137037900 16:35581821-35581843 TGACTTGCCACCTTTATAGGAGG - Intergenic
1137692564 16:50439511-50439533 GGCACAGCCACTTTGAGAGGCGG + Intergenic
1138177208 16:54911144-54911166 GGCACTGCCATATTCAGAGGTGG - Intergenic
1138546654 16:57723432-57723454 GGCACTGCCTCCTTTAAATGTGG - Intronic
1146988904 17:37249307-37249329 TGCACAGCCACATTCATAGGAGG - Intronic
1147164656 17:38586871-38586893 GGCACTGACACCTGCCTAGGAGG + Intronic
1148865432 17:50625938-50625960 GGCACAGCCAGCTTGACAGGAGG + Intronic
1151545986 17:74793446-74793468 GGGGCTGCCTCCTCTATAGGAGG + Intronic
1151624228 17:75266672-75266694 TCCACTGCCAGCTTTAGAGGTGG + Exonic
1154968479 18:21383156-21383178 GGCCATATCACCTTTATAGGAGG - Intronic
1161433308 19:4246965-4246987 GGGACTTCCAGCTTGATAGGCGG + Intergenic
1162401018 19:10446560-10446582 GGAACTGAGCCCTTTATAGGAGG - Intronic
1166810216 19:45509672-45509694 GCCACTCCCACCTTTCCAGGGGG + Intronic
931568330 2:63640377-63640399 GCCACTGCCACCTGAATAGCTGG - Intronic
945054873 2:205859735-205859757 GGCACTCCCAGCTTTTGAGGTGG - Intergenic
946521366 2:220468337-220468359 GGAATTGCCACCTTTACTGGAGG + Intergenic
947795454 2:232891273-232891295 GGCCCTGTCAGCTTTCTAGGAGG - Intronic
1169308354 20:4514386-4514408 AGCACTGACACCTTCATAGGTGG + Intergenic
1169774589 20:9238543-9238565 GGCAAGGCCACCTTTCTGGGTGG + Intronic
1174044981 20:47727042-47727064 GGCTCTGCAGCCTTTATGGGGGG + Intronic
1175751224 20:61499342-61499364 GGCACTGCTATCCTTCTAGGTGG - Intronic
1179559707 21:42207638-42207660 GGCACTGCCACCTTACTACCAGG + Intronic
949751523 3:7357603-7357625 TACACTGCCACCTTTCTAGCTGG + Intronic
950427031 3:12929891-12929913 GGCTCAGCCAGCTTTAGAGGAGG - Intronic
950892123 3:16413435-16413457 GGCATTGCCACCTTCCTATGGGG + Intronic
951629759 3:24706798-24706820 GACACTGCCACCTACATAGGGGG - Intergenic
959908930 3:111741122-111741144 AGCACTGCCAGCTTTCTAGCAGG + Intronic
962417218 3:135193994-135194016 GTCAGTGCCATCTTTCTAGGTGG + Intronic
963841659 3:150114019-150114041 GGAACTGCCACCTTCATCGGTGG - Intergenic
968521998 4:1038243-1038265 GGCACTGCCTACTTTAAAGGAGG + Intergenic
972906421 4:43753244-43753266 GCCATTGCCACCTTGTTAGGTGG - Intergenic
974809606 4:66929076-66929098 GCCACTGCAAGCTTTCTAGGTGG + Intergenic
977019084 4:91736701-91736723 GGGACTGGCAGCTTTATAAGAGG + Intergenic
978067621 4:104424957-104424979 GGCATTTGCACATTTATAGGAGG + Intergenic
979674874 4:123399066-123399088 GGCACTGCCACTTTAAAAGTGGG + Intronic
979679506 4:123444306-123444328 GTCACTGTCCCCTTTAAAGGGGG + Intergenic
986900871 5:12432136-12432158 GGCAGAACCACCTTTATAAGAGG - Intergenic
987288095 5:16479895-16479917 GGCACTGCTACCTTTCGATGGGG - Intronic
989632085 5:43495790-43495812 GGCACTGCCATCCTTACGGGTGG + Intronic
992425061 5:76648335-76648357 GGCACTGCCTCATTACTAGGAGG - Intronic
999221090 5:149978319-149978341 AGCACTGTAACCTTTATAGCTGG + Exonic
1002626617 5:180534060-180534082 GGCACTTTTACCTCTATAGGGGG + Intronic
1014913759 6:127120715-127120737 GGCACTGCCACCTTTTTAAAAGG - Intronic
1015135987 6:129871398-129871420 GGCACTGTCACCTTTCTGGCCGG - Intergenic
1015724783 6:136289247-136289269 GGGACTGCCACCTTTCTTCGTGG - Intronic
1022712935 7:32869341-32869363 TGCACTACCACCTGTATAGTGGG - Exonic
1026204069 7:68240183-68240205 GGCACTGCCTCCTCTAGAGTGGG + Intergenic
1032762212 7:134954042-134954064 GGCCCTGCAACTTTTATAAGTGG + Intronic
1033534417 7:142298815-142298837 GGCACTGGCACCTCAAGAGGTGG - Intergenic
1040894785 8:52354834-52354856 AGCACTGCCAGCATTAGAGGTGG - Intronic
1041532125 8:58880986-58881008 GACAATGCCTCCTATATAGGAGG - Intronic
1046792313 8:118335142-118335164 GGCACAGCCACCACTAAAGGAGG + Intronic
1048296281 8:133216917-133216939 TTCACGGCCACCTTTAGAGGAGG + Intronic
1048300622 8:133248650-133248672 AGCAAGGCCACCTTTATAGTGGG + Intronic
1048502620 8:134992560-134992582 GTCACTGCCACATTGAAAGGAGG - Intergenic
1053726960 9:41014185-41014207 GGCACTTTCACCTGTATGGGGGG - Intergenic
1054319301 9:63638366-63638388 GTCACTGTCACCTTTATACCAGG + Intergenic
1055050906 9:71979637-71979659 TGCACTCACACCTTTATGGGTGG - Intronic
1058700364 9:107595245-107595267 TGAAAGGCCACCTTTATAGGTGG + Intergenic
1186233831 X:7485435-7485457 AGCACTGCCACCTTGATATTTGG - Intergenic
1187593099 X:20740540-20740562 GGCTCTGATACCTTTATAGCAGG + Intergenic
1189556018 X:42146209-42146231 GGCACTGCCATCTTAACAAGTGG - Intergenic
1194111748 X:89842253-89842275 GTCTTTGCCACCTTTATAGGTGG + Intergenic
1200464410 Y:3497043-3497065 GTTTTTGCCACCTTTATAGGTGG + Intergenic
1200968648 Y:9126103-9126125 GTCACAGCCACCCTTACAGGTGG - Intergenic
1201232046 Y:11874572-11874594 GGCAATGCCAGCCATATAGGAGG - Intergenic