ID: 1129313107

View in Genome Browser
Species Human (GRCh38)
Location 15:74725868-74725890
Sequence GGAGTCCCCGCGCCCCAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129313107_1129313110 2 Left 1129313107 15:74725868-74725890 CCATCCTGGGGCGCGGGGACTCC No data
Right 1129313110 15:74725893-74725915 TTCGTCATTTTTGCACCCACTGG No data
1129313107_1129313111 10 Left 1129313107 15:74725868-74725890 CCATCCTGGGGCGCGGGGACTCC No data
Right 1129313111 15:74725901-74725923 TTTTGCACCCACTGGAACGCTGG No data
1129313107_1129313112 11 Left 1129313107 15:74725868-74725890 CCATCCTGGGGCGCGGGGACTCC No data
Right 1129313112 15:74725902-74725924 TTTGCACCCACTGGAACGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129313107 Original CRISPR GGAGTCCCCGCGCCCCAGGA TGG (reversed) Intergenic