ID: 1129313391

View in Genome Browser
Species Human (GRCh38)
Location 15:74726983-74727005
Sequence CCTGGACCAGCGACGGATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129313391_1129313402 19 Left 1129313391 15:74726983-74727005 CCACCATCCGTCGCTGGTCCAGG No data
Right 1129313402 15:74727025-74727047 CCTCCCATTCCGGTCATATGCGG No data
1129313391_1129313397 9 Left 1129313391 15:74726983-74727005 CCACCATCCGTCGCTGGTCCAGG No data
Right 1129313397 15:74727015-74727037 AATCCCCTCACCTCCCATTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129313391 Original CRISPR CCTGGACCAGCGACGGATGG TGG (reversed) Intergenic