ID: 1129318259

View in Genome Browser
Species Human (GRCh38)
Location 15:74759292-74759314
Sequence TTGGAAACACTACATGATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129318255_1129318259 11 Left 1129318255 15:74759258-74759280 CCTGAGTCAGGATTGTGGGACTG No data
Right 1129318259 15:74759292-74759314 TTGGAAACACTACATGATCAAGG No data
1129318254_1129318259 12 Left 1129318254 15:74759257-74759279 CCCTGAGTCAGGATTGTGGGACT No data
Right 1129318259 15:74759292-74759314 TTGGAAACACTACATGATCAAGG No data
1129318248_1129318259 28 Left 1129318248 15:74759241-74759263 CCCTACCTGTGTCTCTCCCTGAG No data
Right 1129318259 15:74759292-74759314 TTGGAAACACTACATGATCAAGG No data
1129318249_1129318259 27 Left 1129318249 15:74759242-74759264 CCTACCTGTGTCTCTCCCTGAGT No data
Right 1129318259 15:74759292-74759314 TTGGAAACACTACATGATCAAGG No data
1129318250_1129318259 23 Left 1129318250 15:74759246-74759268 CCTGTGTCTCTCCCTGAGTCAGG No data
Right 1129318259 15:74759292-74759314 TTGGAAACACTACATGATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129318259 Original CRISPR TTGGAAACACTACATGATCA AGG Intergenic
No off target data available for this crispr