ID: 1129319219

View in Genome Browser
Species Human (GRCh38)
Location 15:74764654-74764676
Sequence CAGCTTCCCCTCACAGAGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129319219_1129319226 17 Left 1129319219 15:74764654-74764676 CCGTGCTCTGTGAGGGGAAGCTG No data
Right 1129319226 15:74764694-74764716 CCACAGACTCCCTGGCCCTCTGG No data
1129319219_1129319230 29 Left 1129319219 15:74764654-74764676 CCGTGCTCTGTGAGGGGAAGCTG No data
Right 1129319230 15:74764706-74764728 TGGCCCTCTGGCTCCTAGACGGG No data
1129319219_1129319224 9 Left 1129319219 15:74764654-74764676 CCGTGCTCTGTGAGGGGAAGCTG No data
Right 1129319224 15:74764686-74764708 GCTTCTATCCACAGACTCCCTGG No data
1129319219_1129319229 28 Left 1129319219 15:74764654-74764676 CCGTGCTCTGTGAGGGGAAGCTG No data
Right 1129319229 15:74764705-74764727 CTGGCCCTCTGGCTCCTAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129319219 Original CRISPR CAGCTTCCCCTCACAGAGCA CGG (reversed) Intergenic
No off target data available for this crispr