ID: 1129319630

View in Genome Browser
Species Human (GRCh38)
Location 15:74767377-74767399
Sequence GAGGCTATGCCTTTCCTAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129319630_1129319637 28 Left 1129319630 15:74767377-74767399 CCTCTTAGGAAAGGCATAGCCTC No data
Right 1129319637 15:74767428-74767450 GGAGAGACAGAGGTTCAGAGAGG No data
1129319630_1129319636 18 Left 1129319630 15:74767377-74767399 CCTCTTAGGAAAGGCATAGCCTC No data
Right 1129319636 15:74767418-74767440 ATTTAGAGATGGAGAGACAGAGG No data
1129319630_1129319633 7 Left 1129319630 15:74767377-74767399 CCTCTTAGGAAAGGCATAGCCTC No data
Right 1129319633 15:74767407-74767429 AAATAACCCAAATTTAGAGATGG No data
1129319630_1129319638 29 Left 1129319630 15:74767377-74767399 CCTCTTAGGAAAGGCATAGCCTC No data
Right 1129319638 15:74767429-74767451 GAGAGACAGAGGTTCAGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129319630 Original CRISPR GAGGCTATGCCTTTCCTAAG AGG (reversed) Intergenic
No off target data available for this crispr