ID: 1129319633

View in Genome Browser
Species Human (GRCh38)
Location 15:74767407-74767429
Sequence AAATAACCCAAATTTAGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129319629_1129319633 8 Left 1129319629 15:74767376-74767398 CCCTCTTAGGAAAGGCATAGCCT No data
Right 1129319633 15:74767407-74767429 AAATAACCCAAATTTAGAGATGG No data
1129319630_1129319633 7 Left 1129319630 15:74767377-74767399 CCTCTTAGGAAAGGCATAGCCTC No data
Right 1129319633 15:74767407-74767429 AAATAACCCAAATTTAGAGATGG No data
1129319628_1129319633 9 Left 1129319628 15:74767375-74767397 CCCCTCTTAGGAAAGGCATAGCC No data
Right 1129319633 15:74767407-74767429 AAATAACCCAAATTTAGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129319633 Original CRISPR AAATAACCCAAATTTAGAGA TGG Intergenic
No off target data available for this crispr