ID: 1129319637

View in Genome Browser
Species Human (GRCh38)
Location 15:74767428-74767450
Sequence GGAGAGACAGAGGTTCAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129319635_1129319637 -9 Left 1129319635 15:74767414-74767436 CCAAATTTAGAGATGGAGAGACA No data
Right 1129319637 15:74767428-74767450 GGAGAGACAGAGGTTCAGAGAGG No data
1129319634_1129319637 -8 Left 1129319634 15:74767413-74767435 CCCAAATTTAGAGATGGAGAGAC No data
Right 1129319637 15:74767428-74767450 GGAGAGACAGAGGTTCAGAGAGG No data
1129319628_1129319637 30 Left 1129319628 15:74767375-74767397 CCCCTCTTAGGAAAGGCATAGCC No data
Right 1129319637 15:74767428-74767450 GGAGAGACAGAGGTTCAGAGAGG No data
1129319632_1129319637 4 Left 1129319632 15:74767401-74767423 CCTGTGAAATAACCCAAATTTAG No data
Right 1129319637 15:74767428-74767450 GGAGAGACAGAGGTTCAGAGAGG No data
1129319630_1129319637 28 Left 1129319630 15:74767377-74767399 CCTCTTAGGAAAGGCATAGCCTC No data
Right 1129319637 15:74767428-74767450 GGAGAGACAGAGGTTCAGAGAGG No data
1129319629_1129319637 29 Left 1129319629 15:74767376-74767398 CCCTCTTAGGAAAGGCATAGCCT No data
Right 1129319637 15:74767428-74767450 GGAGAGACAGAGGTTCAGAGAGG No data
1129319631_1129319637 9 Left 1129319631 15:74767396-74767418 CCTCACCTGTGAAATAACCCAAA No data
Right 1129319637 15:74767428-74767450 GGAGAGACAGAGGTTCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129319637 Original CRISPR GGAGAGACAGAGGTTCAGAG AGG Intergenic
No off target data available for this crispr