ID: 1129319638

View in Genome Browser
Species Human (GRCh38)
Location 15:74767429-74767451
Sequence GAGAGACAGAGGTTCAGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129319634_1129319638 -7 Left 1129319634 15:74767413-74767435 CCCAAATTTAGAGATGGAGAGAC No data
Right 1129319638 15:74767429-74767451 GAGAGACAGAGGTTCAGAGAGGG No data
1129319632_1129319638 5 Left 1129319632 15:74767401-74767423 CCTGTGAAATAACCCAAATTTAG No data
Right 1129319638 15:74767429-74767451 GAGAGACAGAGGTTCAGAGAGGG No data
1129319629_1129319638 30 Left 1129319629 15:74767376-74767398 CCCTCTTAGGAAAGGCATAGCCT No data
Right 1129319638 15:74767429-74767451 GAGAGACAGAGGTTCAGAGAGGG No data
1129319630_1129319638 29 Left 1129319630 15:74767377-74767399 CCTCTTAGGAAAGGCATAGCCTC No data
Right 1129319638 15:74767429-74767451 GAGAGACAGAGGTTCAGAGAGGG No data
1129319635_1129319638 -8 Left 1129319635 15:74767414-74767436 CCAAATTTAGAGATGGAGAGACA No data
Right 1129319638 15:74767429-74767451 GAGAGACAGAGGTTCAGAGAGGG No data
1129319631_1129319638 10 Left 1129319631 15:74767396-74767418 CCTCACCTGTGAAATAACCCAAA No data
Right 1129319638 15:74767429-74767451 GAGAGACAGAGGTTCAGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129319638 Original CRISPR GAGAGACAGAGGTTCAGAGA GGG Intergenic
No off target data available for this crispr