ID: 1129320266

View in Genome Browser
Species Human (GRCh38)
Location 15:74770863-74770885
Sequence TGGGCTGCTCCCTGATTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129320266_1129320281 22 Left 1129320266 15:74770863-74770885 CCTTCAAATCAGGGAGCAGCCCA No data
Right 1129320281 15:74770908-74770930 CCAGCAGCCATATGCTGATCTGG No data
1129320266_1129320272 -5 Left 1129320266 15:74770863-74770885 CCTTCAAATCAGGGAGCAGCCCA No data
Right 1129320272 15:74770881-74770903 GCCCACGGTAGGGGGCCCTGTGG No data
1129320266_1129320276 -3 Left 1129320266 15:74770863-74770885 CCTTCAAATCAGGGAGCAGCCCA No data
Right 1129320276 15:74770883-74770905 CCACGGTAGGGGGCCCTGTGGGG No data
1129320266_1129320274 -4 Left 1129320266 15:74770863-74770885 CCTTCAAATCAGGGAGCAGCCCA No data
Right 1129320274 15:74770882-74770904 CCCACGGTAGGGGGCCCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129320266 Original CRISPR TGGGCTGCTCCCTGATTTGA AGG (reversed) Intergenic
No off target data available for this crispr