ID: 1129320274

View in Genome Browser
Species Human (GRCh38)
Location 15:74770882-74770904
Sequence CCCACGGTAGGGGGCCCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129320262_1129320274 18 Left 1129320262 15:74770841-74770863 CCAGGGGCCAGCGTGGTGGTGGC No data
Right 1129320274 15:74770882-74770904 CCCACGGTAGGGGGCCCTGTGGG No data
1129320259_1129320274 20 Left 1129320259 15:74770839-74770861 CCCCAGGGGCCAGCGTGGTGGTG No data
Right 1129320274 15:74770882-74770904 CCCACGGTAGGGGGCCCTGTGGG No data
1129320256_1129320274 27 Left 1129320256 15:74770832-74770854 CCAGGATCCCCAGGGGCCAGCGT No data
Right 1129320274 15:74770882-74770904 CCCACGGTAGGGGGCCCTGTGGG No data
1129320260_1129320274 19 Left 1129320260 15:74770840-74770862 CCCAGGGGCCAGCGTGGTGGTGG No data
Right 1129320274 15:74770882-74770904 CCCACGGTAGGGGGCCCTGTGGG No data
1129320263_1129320274 11 Left 1129320263 15:74770848-74770870 CCAGCGTGGTGGTGGCCTTCAAA No data
Right 1129320274 15:74770882-74770904 CCCACGGTAGGGGGCCCTGTGGG No data
1129320266_1129320274 -4 Left 1129320266 15:74770863-74770885 CCTTCAAATCAGGGAGCAGCCCA No data
Right 1129320274 15:74770882-74770904 CCCACGGTAGGGGGCCCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129320274 Original CRISPR CCCACGGTAGGGGGCCCTGT GGG Intergenic
No off target data available for this crispr