ID: 1129321487

View in Genome Browser
Species Human (GRCh38)
Location 15:74777455-74777477
Sequence CCTGCTCTGCAGGAAATAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129321482_1129321487 8 Left 1129321482 15:74777424-74777446 CCTCTTGCTAGCAGCCAACTCAG No data
Right 1129321487 15:74777455-74777477 CCTGCTCTGCAGGAAATAGAAGG No data
1129321479_1129321487 14 Left 1129321479 15:74777418-74777440 CCGGCCCCTCTTGCTAGCAGCCA No data
Right 1129321487 15:74777455-74777477 CCTGCTCTGCAGGAAATAGAAGG No data
1129321480_1129321487 10 Left 1129321480 15:74777422-74777444 CCCCTCTTGCTAGCAGCCAACTC No data
Right 1129321487 15:74777455-74777477 CCTGCTCTGCAGGAAATAGAAGG No data
1129321481_1129321487 9 Left 1129321481 15:74777423-74777445 CCCTCTTGCTAGCAGCCAACTCA No data
Right 1129321487 15:74777455-74777477 CCTGCTCTGCAGGAAATAGAAGG No data
1129321478_1129321487 15 Left 1129321478 15:74777417-74777439 CCCGGCCCCTCTTGCTAGCAGCC No data
Right 1129321487 15:74777455-74777477 CCTGCTCTGCAGGAAATAGAAGG No data
1129321483_1129321487 -6 Left 1129321483 15:74777438-74777460 CCAACTCAGCCTGAGCACCTGCT No data
Right 1129321487 15:74777455-74777477 CCTGCTCTGCAGGAAATAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129321487 Original CRISPR CCTGCTCTGCAGGAAATAGA AGG Intergenic
No off target data available for this crispr