ID: 1129322376

View in Genome Browser
Species Human (GRCh38)
Location 15:74782312-74782334
Sequence CCGCGGGCTCCGGCGGCCAG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 224}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129322376_1129322384 -7 Left 1129322376 15:74782312-74782334 CCTCTGGCCGCCGGAGCCCGCGG 0: 1
1: 0
2: 1
3: 22
4: 224
Right 1129322384 15:74782328-74782350 CCCGCGGGGCGTGGAGCGCGAGG 0: 1
1: 0
2: 3
3: 35
4: 303
1129322376_1129322394 26 Left 1129322376 15:74782312-74782334 CCTCTGGCCGCCGGAGCCCGCGG 0: 1
1: 0
2: 1
3: 22
4: 224
Right 1129322394 15:74782361-74782383 CCCCGATCGAGCGTCCGGGGCGG 0: 1
1: 0
2: 0
3: 2
4: 17
1129322376_1129322386 3 Left 1129322376 15:74782312-74782334 CCTCTGGCCGCCGGAGCCCGCGG 0: 1
1: 0
2: 1
3: 22
4: 224
Right 1129322386 15:74782338-74782360 GTGGAGCGCGAGGAGCCCCGCGG 0: 1
1: 0
2: 0
3: 19
4: 154
1129322376_1129322391 22 Left 1129322376 15:74782312-74782334 CCTCTGGCCGCCGGAGCCCGCGG 0: 1
1: 0
2: 1
3: 22
4: 224
Right 1129322391 15:74782357-74782379 GCGGCCCCGATCGAGCGTCCGGG 0: 1
1: 0
2: 0
3: 1
4: 35
1129322376_1129322390 21 Left 1129322376 15:74782312-74782334 CCTCTGGCCGCCGGAGCCCGCGG 0: 1
1: 0
2: 1
3: 22
4: 224
Right 1129322390 15:74782356-74782378 CGCGGCCCCGATCGAGCGTCCGG 0: 1
1: 0
2: 0
3: 2
4: 26
1129322376_1129322392 23 Left 1129322376 15:74782312-74782334 CCTCTGGCCGCCGGAGCCCGCGG 0: 1
1: 0
2: 1
3: 22
4: 224
Right 1129322392 15:74782358-74782380 CGGCCCCGATCGAGCGTCCGGGG 0: 1
1: 0
2: 0
3: 2
4: 25

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129322376 Original CRISPR CCGCGGGCTCCGGCGGCCAG AGG (reversed) Exonic
900314423 1:2050027-2050049 CCGAGGGCCCCGCCGTCCAGGGG - Intergenic
900389302 1:2427168-2427190 CAGCGGGTGCCGGCGGCTAGGGG + Intronic
900393488 1:2443797-2443819 CCGCCAGCTCGGGCGGCCCGCGG - Intronic
900600203 1:3499598-3499620 GCGGGGGCCCCGGCGGCCAGCGG + Exonic
901602189 1:10430809-10430831 CGCCGGGGTCCGGCGGCGAGAGG + Intronic
903349806 1:22710893-22710915 CCCCGGGCTCGGGGGGCCAGGGG - Intronic
904128777 1:28260365-28260387 TCGCGGGGGCCGGCGGGCAGAGG + Intronic
904484563 1:30816240-30816262 CCTCGGGATGCTGCGGCCAGGGG + Intergenic
905027354 1:34859787-34859809 CCGAGAGAGCCGGCGGCCAGTGG - Exonic
906153707 1:43602061-43602083 CCGCGGTCAGTGGCGGCCAGAGG + Exonic
912515274 1:110212894-110212916 CTGCAGGCTCCCACGGCCAGTGG + Intronic
913047922 1:115089490-115089512 CGGCAGGCTCCGGCGGGGAGGGG + Intronic
913592552 1:120342356-120342378 CTGCGAGCCCCGGCGGCCCGCGG - Intergenic
913615872 1:120558880-120558902 CCACGTCCTCCGGCTGCCAGCGG + Intergenic
913650798 1:120912774-120912796 CTGCGAGCCCCGGCGGCCCGCGG + Intergenic
913972442 1:143424659-143424681 GCGCGGGCGCAGGCGCCCAGAGG - Intergenic
914066824 1:144250272-144250294 GCGCGGGCGCAGGCGCCCAGAGG - Intergenic
914112329 1:144716082-144716104 GCGCGGGCGCAGGCGCCCAGAGG + Intergenic
914170314 1:145216293-145216315 CTGCGAGCCCCGGCGGCCCGCGG - Intergenic
914525432 1:148460259-148460281 CTGCGAGCCCCGGCGGCCCGCGG - Intergenic
914574407 1:148952022-148952044 CCACGTCCTCCGGCTGCCAGCGG - Intronic
914598242 1:149175571-149175593 CTGCGAGCCCCGGCGGCCCGCGG + Intergenic
914640969 1:149606869-149606891 CTGCGAGCCCCGGCGGCCCGCGG + Intergenic
917565254 1:176206793-176206815 CCGCCGGCTCGGGCGGCCTCGGG - Exonic
919451332 1:197775592-197775614 CCCCGCGCCCGGGCGGCCAGAGG + Intronic
919464359 1:197912176-197912198 CGGCGGGAGGCGGCGGCCAGAGG - Intronic
919981295 1:202644098-202644120 CCGAGGGCTCCGGCAGCCCGCGG + Intronic
920352036 1:205343833-205343855 ACGCGCCCTCCGGCGGGCAGCGG + Intronic
922306977 1:224352737-224352759 CCGCGGGCCCCGCCGGCCCTGGG - Intergenic
922744926 1:228038280-228038302 CGGCGGGCTCCGGCGGGGACCGG + Intronic
923673960 1:236064729-236064751 CCCGGTGCCCCGGCGGCCAGCGG + Intronic
1065023119 10:21517028-21517050 CGGCGGGCGCCGGAGGCCCGGGG - Exonic
1065174501 10:23063556-23063578 ACCAGGGCTGCGGCGGCCAGCGG + Intergenic
1065993259 10:31032501-31032523 CCGCGGGAGCCGGGAGCCAGGGG - Intergenic
1067943314 10:50674796-50674818 CCGCGGACACCGGTGACCAGTGG + Intergenic
1070570725 10:77637963-77637985 CCCCGGGCGCGGGCGGCCCGCGG - Intronic
1070942012 10:80356638-80356660 TCGCTGGGTCCGGCGGGCAGAGG - Intronic
1073460119 10:103661314-103661336 CCGCGGGGTCCGGGGGACATGGG + Intronic
1074121687 10:110498098-110498120 CCGCCGCCGCCGCCGGCCAGCGG - Exonic
1076035601 10:127196502-127196524 CCGCGGAGCCGGGCGGCCAGAGG + Intronic
1076371748 10:129959808-129959830 GCGCGGGCTCGGGCGCCCTGGGG - Intronic
1076787871 10:132760002-132760024 CCGTGGACCCTGGCGGCCAGAGG + Intronic
1076977896 11:189460-189482 GCGCGGGCGCCGGCGCACAGTGG + Intronic
1077101055 11:822585-822607 CCAGGGGCTCCGGCGGGAAGAGG - Exonic
1077361018 11:2140074-2140096 ACGGAGGCTCCGGCCGCCAGAGG + Intronic
1083920976 11:65781233-65781255 CCGCGGCCCTCGGCGGACAGCGG + Intergenic
1083970353 11:66070527-66070549 CCGGGGGCGGCAGCGGCCAGCGG + Exonic
1084070146 11:66728421-66728443 CCGCGGGAGCCGGCGGCCTGCGG - Intronic
1084178397 11:67435028-67435050 CCGTGGGCTCCGGCAGGCTGGGG - Exonic
1084557513 11:69883747-69883769 CCTTGGGCTCCCCCGGCCAGAGG - Intergenic
1085263620 11:75223637-75223659 CAGCGGGCTCTGGAGGCCAGGGG - Intergenic
1085396895 11:76210888-76210910 CGGCGGGCGCCGCCGGTCAGTGG - Intergenic
1086981063 11:93198011-93198033 CGGCGGGCACCGCCGGCGAGGGG + Intergenic
1088893346 11:114060803-114060825 CCGCTGGCGCCGCTGGCCAGAGG + Intronic
1091124569 11:133082993-133083015 CCGCGGGCTCCGGCGCTGACGGG - Intronic
1091460942 12:643052-643074 CCGCGGGCTACGGCCGCCTGCGG + Intronic
1096542299 12:52314640-52314662 GAGGGGGCTCCTGCGGCCAGGGG - Exonic
1096773278 12:53949848-53949870 CGGCGGGCTCCTGCGGGAAGGGG - Intergenic
1098991162 12:77065810-77065832 ACGCGGGCCCCGGCGGCCGCGGG + Intergenic
1102644672 12:114396306-114396328 CCGGGGACTGTGGCGGCCAGCGG - Intronic
1104602346 12:130162307-130162329 CCGCGGGCTCCCGGGCCCCGCGG - Intergenic
1106555157 13:30803105-30803127 CTGCGGGCTCCCGCGCCCTGGGG + Intergenic
1106683463 13:32031685-32031707 GCGCGGGGTCAGGCGCCCAGAGG - Exonic
1108408079 13:50124557-50124579 GCGCGGGCTTCGGCGGGGAGAGG - Intronic
1110630190 13:77698182-77698204 CCGCGGCCTCAGGGGGCCTGGGG + Intronic
1112216318 13:97434313-97434335 CCGCCGCCGCCGGCGCCCAGGGG + Exonic
1113082829 13:106535550-106535572 CCGCGGGCTCCGGACGCGCGCGG + Intergenic
1113388101 13:109869874-109869896 ACGTGGGCTCCGGCTTCCAGAGG + Intergenic
1113905279 13:113816615-113816637 CCGCGGGGTCTGGTGGCCACGGG - Exonic
1114557696 14:23571291-23571313 CAGTGGGCTCCGGCAGGCAGGGG + Exonic
1117478467 14:56119309-56119331 TCTCGGGCTGCGGCGGCCCGCGG - Intronic
1123119370 14:105909728-105909750 CCGGGGGCTCCGGCGGGTCGGGG - Intergenic
1124323632 15:28737840-28737862 CGGCGCGCGCCGGCAGCCAGCGG + Intronic
1124496997 15:30192833-30192855 CCGAGGGCTCCGGCAGCCCGCGG + Intergenic
1124746579 15:32345814-32345836 CCGAGGGCTCCGGCAGCCCGCGG - Intergenic
1127588383 15:60398502-60398524 CCCCGGGAACTGGCGGCCAGAGG - Intronic
1129322376 15:74782312-74782334 CCGCGGGCTCCGGCGGCCAGAGG - Exonic
1130002613 15:80060055-80060077 GCGCGGGCGCCCGCGGCCGGGGG + Intronic
1130040905 15:80404566-80404588 CTGCGGGCTGCGGCGGGCGGCGG - Intronic
1132556316 16:574275-574297 CCTCGGGCTCCTGCCGGCAGTGG - Exonic
1132680826 16:1141088-1141110 CGGCGGGCTCTGATGGCCAGTGG + Intergenic
1132734783 16:1379852-1379874 GCGCGGGCAGCGGGGGCCAGAGG + Intronic
1132807690 16:1782590-1782612 CCATTGGCTCCGGCGGCGAGGGG + Exonic
1132893233 16:2214784-2214806 CGGCGGGCGGCGGCGGCCGGCGG - Exonic
1133220129 16:4316203-4316225 CTGCGGGCTCCGGCGGTCGGGGG - Intronic
1135190283 16:20348827-20348849 CCCCGGGCTCCTGCGGGCCGGGG - Exonic
1136428370 16:30183797-30183819 CCGCGGGCTGCGGGGGCGCGCGG + Intronic
1137582155 16:49640022-49640044 CCGCAGGCTGCTGCGGGCAGGGG + Intronic
1137655051 16:50152854-50152876 GCCCGGGATCCGGCGGCCACAGG + Intergenic
1138105685 16:54286114-54286136 CCGCGGGCTCCGGCGCGCATCGG + Exonic
1141132262 16:81444654-81444676 CCGCGGACTCCGCCCGCGAGAGG + Intergenic
1142240084 16:88941031-88941053 CCGGGGGATCCGGCGGGCGGCGG + Intronic
1142465318 17:133925-133947 GCGCGGGCGCCGGCGCACAGTGG + Intergenic
1142656906 17:1400363-1400385 CAGCGGGCGCCGGAGCCCAGAGG + Exonic
1142664736 17:1456164-1456186 CGGCGGGCGCCGGGGGCCGGAGG - Exonic
1143324559 17:6090363-6090385 CTGCGGGAACCGGCTGCCAGCGG + Exonic
1143845781 17:9771836-9771858 CCGCGGACCGCGGCGACCAGCGG + Intronic
1144724929 17:17496963-17496985 CCGCGCGCTCGGGCCGCCAGAGG + Intergenic
1144730420 17:17522809-17522831 CCGCGTGCTCCTGCAGCCATGGG - Intronic
1146332245 17:31937142-31937164 CAGCAGGCTCCGGCGGACCGAGG - Exonic
1146581200 17:34040124-34040146 CCCCGGGCCCGGGCGGCCACGGG + Intronic
1147179450 17:38674924-38674946 ACGCGGTCTCCGGGAGCCAGCGG - Exonic
1147611289 17:41803195-41803217 CCCTGGGCTCCGGAGCCCAGCGG + Intronic
1148048748 17:44759156-44759178 CCGGGGGCTGCGGCTGCCAGCGG - Exonic
1148206795 17:45784452-45784474 CTGCGGGCTCGGGCGGCACGGGG - Intronic
1148615144 17:48996114-48996136 CCTCGGGCTCCGGGAGCCGGAGG + Intergenic
1148684780 17:49495309-49495331 CGGCCAGCTCCGGCGGGCAGGGG + Exonic
1150217150 17:63477105-63477127 CCCCGGCCCCCGGCGGCCCGAGG - Intergenic
1152375427 17:79916235-79916257 CAGCGGCATCCAGCGGCCAGGGG - Intergenic
1152912681 17:83014000-83014022 CCGTGGGCTCCTCCGCCCAGTGG - Intronic
1160592140 18:79951001-79951023 CCGCGCGCTCCTGCGGCCTCGGG + Exonic
1160719126 19:589882-589904 CCTCGGGCTCCGGCCGGCGGCGG + Exonic
1160725559 19:616490-616512 CCGCGGGCCCAGGCGGGCCGGGG + Exonic
1160861195 19:1237819-1237841 CGGCTGGCTCCGGCGCCCGGTGG + Exonic
1161062534 19:2222365-2222387 CCACGGGCGCTGGCGGTCAGGGG - Exonic
1161087299 19:2341029-2341051 CCCCGGGCCCCGGCGGGCAGCGG + Exonic
1161401185 19:4066744-4066766 CCGCGGACCCCGGAGGCGAGCGG - Exonic
1161439074 19:4280216-4280238 CCGCGGGGTCCGGCTCCAAGCGG - Exonic
1162738127 19:12757909-12757931 CCTCGGGCTCCGGCAGGCCGGGG - Exonic
1164594938 19:29526434-29526456 TGGCGGCCGCCGGCGGCCAGGGG + Intergenic
1165463756 19:35959878-35959900 CCGCGGGCCGCGGCGGCCTCGGG - Intergenic
1165511926 19:36271083-36271105 CCGAGGGCTCCGGCAACCCGAGG - Intergenic
1165512478 19:36273584-36273606 CCGAGGGCTCCGGCAACCCGAGG - Intergenic
1165513025 19:36276125-36276147 CCGAGGGCTCCGGCAACCCGAGG - Intergenic
1165513581 19:36278680-36278702 CCGAGGGCTCCGGCAACCCGAGG - Intergenic
1165514131 19:36281214-36281236 CCGAGGGCTCCGGCAACCCGAGG - Intergenic
1165514683 19:36283751-36283773 CCGAGGGCTCCGGCAACCCGAGG - Intergenic
1165515235 19:36286284-36286306 CCGAGGGCTCCGGCAACCCGAGG - Intergenic
1165515785 19:36288820-36288842 CCGAGGGCTCCGGCAACCCGAGG - Intergenic
1165516336 19:36291357-36291379 CCGAGGGCTCCGGCAACCCGAGG - Intergenic
1165516888 19:36293883-36293905 CCGAGGGCTCCGGCAACCCGAGG - Intergenic
1165517441 19:36296406-36296428 CCGAGGGCTCCGGCAACCCGAGG - Intergenic
1165517993 19:36298941-36298963 CCGAGGGCTCCGGCAACCCGAGG - Intergenic
1165518544 19:36301476-36301498 CCGAGGGCTCCGGCAACCCGAGG - Intergenic
1165519093 19:36304008-36304030 CCGAGGGCTCCGGCAACCCGAGG - Intergenic
1165519643 19:36306523-36306545 CCGAGGGCTCCGGCAACCCGAGG - Intergenic
1165928698 19:39342687-39342709 CCGCGGGCGGCGGCGGCGGGCGG + Intronic
1166118026 19:40667596-40667618 GCGCTGGCTCAGGGGGCCAGGGG + Exonic
1167638465 19:50668018-50668040 GCGCGGGCTACGGCGGCTACGGG - Exonic
1168076180 19:53981990-53982012 CCGCTGGCGCAGGCGGGCAGGGG + Intronic
1168293783 19:55369401-55369423 GCTCGGGCTCCCGCGGCCCGGGG - Intronic
925984955 2:9207543-9207565 CGGCGGGCGGCGGCGGGCAGCGG - Intronic
926914480 2:17879001-17879023 CGGCGGGCTCTGGGGACCAGAGG - Intronic
927357071 2:22186441-22186463 CCGCGGGCCCCGCCGGCCCCGGG + Intergenic
929468734 2:42169782-42169804 CCGCGGACTCCGGTGGACTGAGG + Intronic
931348745 2:61470561-61470583 CCCCGGGCTGCCGCGGCCTGCGG - Intronic
931614570 2:64143773-64143795 CCGCGCGCTCCGGCTGCGAGAGG - Intronic
931671749 2:64653969-64653991 GGGCGGGGTCGGGCGGCCAGGGG - Intronic
933206376 2:79512796-79512818 CCGCGGGCGCGCGCGGCCTGGGG - Intronic
933374943 2:81467321-81467343 CCGAGAGACCCGGCGGCCAGCGG + Intergenic
935059309 2:99593833-99593855 CCGCGGGCTCCTCGGGCCGGTGG + Exonic
935820187 2:106886565-106886587 GCGGCGGCTCCCGCGGCCAGAGG + Exonic
937045047 2:118846767-118846789 CTGGTGGCTGCGGCGGCCAGAGG - Exonic
937221683 2:120345944-120345966 CCGAGGGCCCCGGGGGCCCGAGG - Intergenic
937221837 2:120346362-120346384 CGGCGGCTTCCGGCGGCCAGAGG + Exonic
937928581 2:127187306-127187328 CCACGGGCTCCTGACGCCAGGGG - Exonic
938775301 2:134536494-134536516 CCCCGGGCTCTGGAGGCTAGCGG + Intronic
941819171 2:169827697-169827719 CCGCCGGCAGCCGCGGCCAGCGG - Exonic
942116755 2:172735815-172735837 CCGCGGGCTCCCGCGGCCTGGGG - Intronic
944496093 2:200307591-200307613 CCGCGGGCTGCGGACCCCAGCGG + Intronic
946245978 2:218387698-218387720 CCGCGGGCTGCGGGGGGCTGGGG + Intronic
946248456 2:218399954-218399976 CCGCGAGCTCCGGAGGGGAGGGG - Exonic
947641626 2:231710431-231710453 CCCGGGGCTTCGGCCGCCAGGGG + Intronic
948694735 2:239727488-239727510 CCAGGGGCTCAGGCAGCCAGAGG - Intergenic
1169262556 20:4149083-4149105 CCGAGGGCTCGGCCGGCCCGGGG + Intronic
1173704701 20:45101129-45101151 CCGCCGCCTCCGGCCGCCAGCGG - Intergenic
1175624056 20:60475817-60475839 CCCCGGGCTCAGGCGCTCAGGGG - Intergenic
1175856337 20:62122801-62122823 CAGCGGGCTCGGGCGGGCGGCGG - Intronic
1180698632 22:17769908-17769930 CTGAGGGCACCGGAGGCCAGCGG - Intronic
1183358941 22:37373481-37373503 CCGCTGGTGCCGGCGGGCAGCGG - Exonic
1184035292 22:41915111-41915133 GCGCGGGCTCGGGCGGGCGGGGG + Intergenic
1184767074 22:46577504-46577526 CCGCGGGCACCTGCGGCCGCAGG + Intronic
1184788750 22:46686066-46686088 GCGAGGGCTCCGGCGACCAGAGG - Exonic
1185310954 22:50153927-50153949 CCACGGGCCCCGGAGGACAGGGG + Intronic
950623203 3:14224493-14224515 CAGCAGGCTCCAGCAGCCAGAGG - Intergenic
950831183 3:15877926-15877948 CCGCGGGCTGGGCAGGCCAGGGG - Intergenic
953356848 3:42263526-42263548 CCGCGGGCTCCGGGCTGCAGCGG - Exonic
953385410 3:42503113-42503135 CAGCGGGGTGGGGCGGCCAGTGG + Intronic
954076866 3:48188032-48188054 CCGCGGGCGCCGGTGGCGCGCGG - Exonic
961594679 3:128006903-128006925 CCCAGGGCTCCGGCTCCCAGAGG + Intergenic
961831811 3:129626937-129626959 CCTCGTCCTCCCGCGGCCAGAGG + Intergenic
963236795 3:142963861-142963883 GCCCGGGCTGCGGCGGCCCGAGG - Intergenic
965590619 3:170357581-170357603 CCGCCGTCTCCGGCCGCCCGGGG - Intergenic
968515138 4:1012543-1012565 CCTCGGGCGGCGGCGGCCGGCGG - Exonic
969330772 4:6472443-6472465 CCGCGGGTTCGGGCGGGCCGGGG + Intronic
969361003 4:6663979-6664001 CCGTGGGGCCCGGCGGCCAGCGG - Intergenic
969455855 4:7299199-7299221 CGCCTGGCTCCGGCTGCCAGGGG - Intronic
969559550 4:7938872-7938894 CCCCGGGGCCCGCCGGCCAGGGG + Intronic
973907629 4:55546914-55546936 CCGCGGGCTCAGACGGCCGGCGG + Intronic
973945236 4:55948758-55948780 CCGCGGGCGCCGACCTCCAGGGG + Intergenic
977908225 4:102501457-102501479 CCGAGGGCTGCGGCGGCTGGCGG - Exonic
984734802 4:183099180-183099202 CCGCGACCCTCGGCGGCCAGAGG + Intergenic
985353829 4:189096278-189096300 CCGCGTGCCCAGCCGGCCAGTGG - Intergenic
985549204 5:524607-524629 CCGCGGGCTCCGGGGGAGGGTGG - Intergenic
985660697 5:1155501-1155523 CCGCGCGCTCCGGGGACCTGGGG - Intergenic
997398505 5:133583124-133583146 CTGCTGTCTCCAGCGGCCAGTGG + Intronic
997505282 5:134412024-134412046 CCACGGGCTGCGGCGGTCTGAGG - Intergenic
998095721 5:139394634-139394656 ACGCTGGCCCCGGCGGCAAGGGG + Exonic
1002487732 5:179550923-179550945 GCGCCCGCGCCGGCGGCCAGCGG - Intronic
1003290867 6:4776884-4776906 CGGCGGGCGCGGGCGGCGAGCGG - Intronic
1003345206 6:5260619-5260641 CAGCGGGCACCGGGGGCCGGGGG - Intronic
1004228991 6:13814248-13814270 CCTCGCGCCCCGGCGGCCCGCGG - Exonic
1005648866 6:27867662-27867684 CCGCGAGCGGCGGCGGCCAGAGG - Intergenic
1006441303 6:34055410-34055432 CCGTGGGCTCTGGCCACCAGAGG + Intronic
1007739474 6:44002138-44002160 CAGCGTGCTCCGGAGGGCAGGGG + Intronic
1011643084 6:89433266-89433288 CCGCTGGCTCCGGCGGCCCCAGG - Intronic
1015251770 6:131135281-131135303 CCGCGGCCTCCGACGGCCTTTGG - Intergenic
1019685402 7:2379288-2379310 CCGCGGGCACCAGGGCCCAGGGG - Intronic
1020124115 7:5523276-5523298 GAGCTGGCTCCGGAGGCCAGAGG - Intergenic
1020275776 7:6623654-6623676 CCAGGGGCTCCGGCGGGCATCGG + Exonic
1026220469 7:68392132-68392154 CAGCTGGCTCCGGCCACCAGTGG - Intergenic
1026807099 7:73435470-73435492 CCGCGGGGCCCGGAGGCCGGAGG + Exonic
1026982756 7:74536287-74536309 CCGCGGGCCTCCGGGGCCAGGGG - Intronic
1029540523 7:101179793-101179815 CCCCAGGGTCCGGCGCCCAGGGG - Intronic
1029640704 7:101817250-101817272 CTGGGGGCTCCGGCGGCCCCCGG + Intronic
1029737438 7:102472621-102472643 CCGCGGGATGGGGCGGGCAGGGG - Intronic
1031966550 7:128031651-128031673 CCGCGCGCTCCTCCGGCCGGCGG - Intronic
1032306171 7:130733934-130733956 CCTCGGGGTCCGGCGGGCGGCGG + Exonic
1032781952 7:135170729-135170751 CCGCGCGCTCCGGGGTCCCGCGG + Intronic
1034200736 7:149281684-149281706 CCACGGCCACCGGGGGCCAGTGG + Exonic
1034347684 7:150397281-150397303 CCGCGGTCTCCGGCCCCGAGGGG + Exonic
1034446069 7:151114969-151114991 CCGCGGGCGCCGGTGGGCGGCGG - Intronic
1034494303 7:151410603-151410625 CCGCGGGCTCCCTCGGCCTGGGG + Intronic
1035264991 7:157685477-157685499 CCGCCGGCTCCGGCTCCCCGAGG + Intronic
1035368766 7:158365265-158365287 CTCAGGGCTCCGGAGGCCAGCGG + Intronic
1038017779 8:23529501-23529523 CCGCTGGCTTCGGCGGCGACTGG + Intronic
1042039514 8:64577501-64577523 TCCCGAGCTCCAGCGGCCAGGGG + Intergenic
1042146888 8:65739045-65739067 CCCAGGGCTCCAGCGGCCTGGGG + Intronic
1049710310 8:144060359-144060381 CCGAGGGCTCCAGGGTCCAGCGG - Intronic
1053435126 9:38069168-38069190 GCGCGGGCTCCGGCGGGCGCCGG - Exonic
1054798581 9:69325258-69325280 CGGCCGGCTGCGGCGGGCAGAGG - Intronic
1055397538 9:75891062-75891084 CTGCGAGCTGCGGCGGCCCGGGG + Exonic
1055611610 9:78030996-78031018 CCGCGGGCGCCGGGGGGCGGGGG + Intronic
1055757776 9:79573241-79573263 CCGCTCGCCCCGGCGGCCCGCGG - Intronic
1056216266 9:84408587-84408609 CCGCCGGCTCCGGCAGTGAGGGG + Intergenic
1060811961 9:126615177-126615199 CCTCGGGCTCCGGCGTGGAGAGG - Intronic
1061532665 9:131227296-131227318 CAGTGGGCTCAGGCTGCCAGAGG - Intronic
1061857642 9:133451041-133451063 CCGTGGGGTCCGGAGCCCAGTGG + Intronic
1062228051 9:135464994-135465016 CCGCAGGCCCCTGCGGCCTGTGG + Intergenic
1203794591 EBV:169756-169778 CCGCGGGCTCCGGGGGCTGCGGG + Intergenic
1203794792 EBV:170294-170316 CCGCGGGCTCCGGGGGCTGCGGG + Intergenic
1203794983 EBV:170817-170839 CCGCGGGCTCCGGGGGCTGCGGG + Intergenic
1203795184 EBV:171355-171377 CCGCGGGCTCCGGGGGCTGCGGG + Intergenic
1198468100 X:136921508-136921530 CAGCTGGCTCCGCCGGCCCGGGG + Intergenic
1198518277 X:137429091-137429113 CCGCGGGCTAGGGAGGCCACGGG + Intergenic
1199699627 X:150365554-150365576 CCCTGAGCTCCGGCGGCGAGGGG - Intronic
1200233715 X:154458478-154458500 CCCGGGGCTCCGGCAGCCCGGGG + Intronic
1200277859 X:154751159-154751181 CCGGGGGCCGCGGCGGCCGGAGG - Intronic