ID: 1129323529

View in Genome Browser
Species Human (GRCh38)
Location 15:74787736-74787758
Sequence CCATGATCAGGACAGCCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 224}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129323529_1129323538 2 Left 1129323529 15:74787736-74787758 CCCCCTGGCTGTCCTGATCATGG 0: 1
1: 0
2: 0
3: 18
4: 224
Right 1129323538 15:74787761-74787783 TGGTTGTAAGCCTCGTGGGCAGG 0: 1
1: 0
2: 0
3: 5
4: 62
1129323529_1129323536 -3 Left 1129323529 15:74787736-74787758 CCCCCTGGCTGTCCTGATCATGG 0: 1
1: 0
2: 0
3: 18
4: 224
Right 1129323536 15:74787756-74787778 TGGCATGGTTGTAAGCCTCGTGG 0: 1
1: 0
2: 1
3: 5
4: 83
1129323529_1129323540 13 Left 1129323529 15:74787736-74787758 CCCCCTGGCTGTCCTGATCATGG 0: 1
1: 0
2: 0
3: 18
4: 224
Right 1129323540 15:74787772-74787794 CTCGTGGGCAGGCGAAAACCTGG 0: 1
1: 0
2: 1
3: 1
4: 43
1129323529_1129323537 -2 Left 1129323529 15:74787736-74787758 CCCCCTGGCTGTCCTGATCATGG 0: 1
1: 0
2: 0
3: 18
4: 224
Right 1129323537 15:74787757-74787779 GGCATGGTTGTAAGCCTCGTGGG 0: 1
1: 0
2: 0
3: 3
4: 63
1129323529_1129323541 14 Left 1129323529 15:74787736-74787758 CCCCCTGGCTGTCCTGATCATGG 0: 1
1: 0
2: 0
3: 18
4: 224
Right 1129323541 15:74787773-74787795 TCGTGGGCAGGCGAAAACCTGGG 0: 1
1: 0
2: 0
3: 4
4: 35

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129323529 Original CRISPR CCATGATCAGGACAGCCAGG GGG (reversed) Intronic
900106297 1:982549-982571 CCAAGGTCAGGACGGCCTGGAGG - Intergenic
900132075 1:1091501-1091523 CCACGAGAAGGCCAGCCAGGAGG + Exonic
900359934 1:2283605-2283627 CCATGTTCAGGACAGGCTTGTGG + Intronic
900553918 1:3270368-3270390 TCAGGAGGAGGACAGCCAGGAGG + Intronic
900553922 1:3270383-3270405 CCAGGAGGAGGACAGTCAGGAGG + Intronic
900738462 1:4315425-4315447 CTATCATGAGGACAGCAAGGGGG + Intergenic
901514166 1:9734041-9734063 CCACGAGCAGGAGAGCCTGGAGG - Exonic
901630025 1:10643489-10643511 CCAGGGTTTGGACAGCCAGGGGG - Intronic
904143607 1:28372256-28372278 CTGGGATGAGGACAGCCAGGAGG + Intronic
905939542 1:41852290-41852312 CCATGAGCAGGGCAGCCAACAGG + Intronic
906283909 1:44573375-44573397 TCAGGATCAGGACAGCCCAGGGG + Intronic
906937450 1:50226497-50226519 CTATCATGAGGACAGCAAGGGGG - Intergenic
908035027 1:60042620-60042642 ACATGAGCAGGACACCCATGTGG - Intronic
910218463 1:84865514-84865536 CCATGATGAGGAAGGCCATGAGG + Exonic
910898221 1:92091158-92091180 CTATCATGAGAACAGCCAGGGGG - Intronic
914461945 1:147892872-147892894 GCATGATCAGCACAGCCAGCTGG - Intergenic
915580932 1:156813082-156813104 CCATGAACAAGACAGACAGATGG - Intronic
917534837 1:175866889-175866911 CCATGGTAAGGACCTCCAGGAGG + Intergenic
919920019 1:202162000-202162022 CCGTGCTCAGGACAGACTGGAGG + Intergenic
920052303 1:203171518-203171540 CCATGCCCTGGACAGCCAGCGGG - Exonic
922132073 1:222789885-222789907 CTATGATGAGAACAGCAAGGGGG + Intergenic
923400527 1:233612044-233612066 AAATGATCATGACAGGCAGGAGG + Intergenic
924369895 1:243336618-243336640 CTATCATGAGAACAGCCAGGGGG + Intronic
1065012424 10:21431640-21431662 CCATGATCATGCCAGCCTGCTGG - Intergenic
1065363654 10:24913531-24913553 CCATGATCATGACAACAAAGAGG + Intronic
1068536054 10:58242865-58242887 CCATCATGAGAACAGCAAGGGGG - Intronic
1069536254 10:69255530-69255552 CCATCATCTAGAAAGCCAGGGGG - Intronic
1070774099 10:79099851-79099873 CCATAACCAGGACCTCCAGGTGG - Intronic
1070888353 10:79923877-79923899 CCATTATCAGTACAGACAAGCGG + Intergenic
1072526803 10:96279030-96279052 CCATGAACATGAAAGGCAGGAGG + Intergenic
1072555459 10:96511372-96511394 CGATGATAAGGACAACCTGGGGG - Intronic
1073326846 10:102648145-102648167 CCAAGATTTGGACATCCAGGTGG + Intronic
1073396465 10:103222300-103222322 CTATCATGAGGACAGCAAGGGGG - Intergenic
1074382685 10:112993084-112993106 ACATGATCAGAAAAGTCAGGGGG - Intronic
1076075313 10:127529490-127529512 CCAGGATCAGCTCATCCAGGAGG + Intergenic
1076128073 10:127991974-127991996 CAGTGCTCAGGACAGGCAGGAGG - Intronic
1076476641 10:130758325-130758347 CCCTGATCAGCCCAGCCAAGAGG + Intergenic
1077301924 11:1851479-1851501 CCAGGAAGAGGACAGGCAGGTGG - Intergenic
1078320948 11:10334075-10334097 CCATGATCTCAACCGCCAGGAGG + Intronic
1078415265 11:11159688-11159710 CCATGTCCAGGGCAGCAAGGTGG - Intergenic
1079723034 11:23843444-23843466 CCATGATGAGAACAGCAAGGGGG + Intergenic
1079967358 11:26994967-26994989 CCAGGAACAGGACAGCCGGCAGG + Exonic
1080065760 11:28011084-28011106 ACATGAGCAGCAAAGCCAGGAGG - Intergenic
1080174439 11:29344752-29344774 CTATCATGAGAACAGCCAGGGGG - Intergenic
1082878517 11:58014211-58014233 CTATCATGAGGACAGCAAGGGGG + Intergenic
1084044876 11:66562745-66562767 CCATGAGCACTAAAGCCAGGAGG - Intronic
1084496830 11:69510072-69510094 CCAGGCTCTGGACACCCAGGGGG + Intergenic
1085482795 11:76836749-76836771 CCATGCTCAGGACAGCTGGAAGG - Intergenic
1088920567 11:114257586-114257608 CCAGGATCAGGACGGCTTGGGGG - Intergenic
1089048653 11:115526625-115526647 CCATGAGCTGGACAGCAAAGGGG - Intergenic
1089620314 11:119718344-119718366 GCAGGATCAGGACAGCAAGCTGG - Intronic
1091023617 11:132123013-132123035 CCAGGAGGAGGCCAGCCAGGGGG - Intronic
1095168463 12:39003961-39003983 CTATGAGCAGCACAGCCTGGTGG + Intergenic
1095675063 12:44907007-44907029 CTATCATCAGGACAGCATGGTGG - Intronic
1097167289 12:57092682-57092704 CCAAAAGCAGGACATCCAGGTGG - Intronic
1097323800 12:58253133-58253155 CCATGGTCATGACAGACAGATGG + Intergenic
1097446563 12:59679010-59679032 CCAAGATCAGAACAGGCAGCAGG + Intronic
1097588583 12:61545347-61545369 ACATCATGAGAACAGCCAGGGGG + Intergenic
1100994524 12:100289153-100289175 CGAGGCACAGGACAGCCAGGAGG - Intronic
1101365534 12:104066208-104066230 CCATGGGCAGCACAGCCTGGAGG - Exonic
1101443854 12:104723336-104723358 ACATAGTCAGGACAGCCTGGCGG + Intronic
1102567382 12:113805435-113805457 GCTTGATCATCACAGCCAGGTGG - Intergenic
1103546164 12:121703185-121703207 CCATGGGCAGGTCAGCCAGGCGG - Intergenic
1103553457 12:121751869-121751891 CCATGCTGGGGACAGGCAGGGGG - Intronic
1106869492 13:34003316-34003338 CCATGCTCAGGGCAGCGTGGCGG - Intergenic
1107283744 13:38765856-38765878 GCATGAGAAGCACAGCCAGGTGG - Intronic
1107382125 13:39867998-39868020 CCATGCTGAGGACAGCCAAGAGG + Intergenic
1107447412 13:40481260-40481282 CTATGACCAGAGCAGCCAGGTGG + Intergenic
1107632006 13:42351764-42351786 CCATGATTGGGACAGCAAAGAGG - Intergenic
1108696631 13:52907702-52907724 CCTTGATCAGGACAGAGGGGAGG - Intergenic
1110342414 13:74408061-74408083 CTATCATGAGGACAGCAAGGGGG - Intergenic
1111234456 13:85390450-85390472 CTATCATGAGAACAGCCAGGGGG - Intergenic
1113146847 13:107217247-107217269 CCATGATCAGGGCTGGCAAGAGG - Intronic
1113916190 13:113875445-113875467 CCATGACCGGGTCAGACAGGAGG - Intergenic
1115730641 14:36265693-36265715 CCATCATGAGAACAGCCTGGGGG + Intergenic
1120126095 14:80745129-80745151 CTATCATGAGGACAGCAAGGGGG - Intronic
1122262042 14:100529257-100529279 CCATGTCCAGGACTGCCAGGAGG - Intronic
1123132483 14:105999744-105999766 GCATGCTCAGGACCACCAGGGGG - Intergenic
1124081865 15:26506617-26506639 CTATCATGAGGACAGCAAGGGGG - Intergenic
1124879104 15:33625220-33625242 CTATTATGAGGACAGCAAGGGGG + Intronic
1125010080 15:34862335-34862357 CCAAGATCTGAAAAGCCAGGAGG - Intronic
1127244757 15:57160371-57160393 CCATCATAAGGACAGCATGGAGG + Intronic
1128759463 15:70205945-70205967 CCATAAGCAAGAAAGCCAGGGGG - Intergenic
1129093761 15:73181607-73181629 CCAGGATCAGGAGAGTGAGGTGG + Intronic
1129323529 15:74787736-74787758 CCATGATCAGGACAGCCAGGGGG - Intronic
1129457255 15:75682588-75682610 CCATGATCAGCACACCCACCTGG + Exonic
1129726528 15:77904357-77904379 CCATGATCAGCACACCCACCTGG - Intergenic
1132375706 15:101327008-101327030 GCATGCTCAGGACCGCCTGGTGG + Intronic
1132461519 16:57616-57638 CCATGATCTCCACAGCAAGGAGG + Exonic
1134490720 16:14693822-14693844 CCCAGATCAGGACAACCGGGAGG + Intronic
1134496101 16:14732940-14732962 CCCAGATCAGGACAACCGGGAGG + Intronic
1135172655 16:20200316-20200338 GAATGATCAGGAAAGCCATGAGG + Intergenic
1135483669 16:22844616-22844638 CCATCACGAGAACAGCCAGGAGG - Intronic
1137958904 16:52861954-52861976 CCATCACCAAGACAGTCAGGAGG + Intergenic
1138276872 16:55741462-55741484 CCAGGATGAAGACATCCAGGCGG - Intergenic
1138286175 16:55811967-55811989 CCAGGATGAAGACATCCAGGTGG + Intronic
1139432377 16:66918062-66918084 CCATGGTCAGGACAGGCCTGAGG + Exonic
1140827514 16:78720942-78720964 CCATCATCAGGGGAGCCAAGTGG + Intronic
1141635456 16:85311790-85311812 CCATCACCAGGACTGCAAGGTGG - Intergenic
1142379431 16:89723095-89723117 CCATGAGCAGGACAAGCAGGCGG - Intronic
1142483658 17:233489-233511 CCATGATCATGGCAGCCACTAGG + Intronic
1142484177 17:236074-236096 CCAAGATCAGGGAAGCCATGTGG - Intronic
1142712821 17:1732643-1732665 CTATGAGCAAGACACCCAGGGGG - Intronic
1143104135 17:4519965-4519987 CTCTGCTCAGGACAGACAGGAGG - Intronic
1149604431 17:57914769-57914791 CCAGGATCAGGCCAGGGAGGAGG + Intronic
1151346979 17:73508194-73508216 CCATCATCTGGGCAACCAGGCGG - Intronic
1154372209 18:13774611-13774633 CTATGATGAGAACAGCAAGGGGG + Intergenic
1156450854 18:37265849-37265871 CCCTGATCAGGTCAGGCAGTAGG + Intronic
1157434070 18:47653809-47653831 CAATTATCTGGACAGCCAAGTGG - Intergenic
1157725145 18:49958529-49958551 CCATGAGAAGGACAGAAAGGTGG - Intronic
1159231020 18:65606746-65606768 CCATCATGAGAACAGCAAGGGGG - Intergenic
1160225696 18:77009208-77009230 CAAAGAAGAGGACAGCCAGGAGG - Intronic
1162431546 19:10631807-10631829 CCATGATCAGGCCAACCACAGGG - Intronic
1163818580 19:19483088-19483110 CCAGCATCAGCACAGCCAGGGGG - Intronic
1165252731 19:34553801-34553823 CTATGCTAAGGCCAGCCAGGAGG + Intergenic
1166177593 19:41085994-41086016 CCATGATCTGGCCAGGGAGGGGG - Intergenic
1167213074 19:48145728-48145750 CCATGCTCAGGCCACACAGGTGG - Intronic
1167712631 19:51121886-51121908 CAATGATCAAGACAGCAAAGAGG - Intergenic
1167981229 19:53277390-53277412 TCATGATTAGGTTAGCCAGGGGG + Intergenic
925335700 2:3097876-3097898 CCATGACCAGGACGGACAGACGG + Intergenic
929463530 2:42124192-42124214 CAATAATGAGGACAGTCAGGTGG - Intergenic
929781993 2:44962901-44962923 CCATAATCAGGTCAGCTGGGTGG - Intergenic
929853692 2:45616827-45616849 CTATCATGAGGACAGCAAGGAGG + Intergenic
930747698 2:54901787-54901809 CCAGGGATAGGACAGCCAGGTGG - Intronic
931818968 2:65932745-65932767 GGATGATCAGGACATCCTGGGGG - Intergenic
934659255 2:96134425-96134447 CCATGTTCAGGGAAGCCTGGTGG - Intronic
935069820 2:99684215-99684237 CCTTGTTCAGGACAGCCATGGGG + Intronic
935438525 2:103063663-103063685 CCACAATCTGTACAGCCAGGGGG + Intergenic
936448590 2:112616399-112616421 CCATGATGATGACTCCCAGGAGG + Intergenic
940466212 2:154030678-154030700 CCATCATGAGAACAGCAAGGGGG - Intronic
940572494 2:155456262-155456284 CCATGCTCATGACAGCCAAATGG - Intergenic
941728462 2:168889870-168889892 AGATCATCAGGATAGCCAGGTGG + Intronic
942885238 2:180915556-180915578 CCATGGGGAGGACAGTCAGGAGG + Intergenic
944886937 2:204072648-204072670 CCCTGATCAGGACACCCTAGGGG - Intergenic
945738508 2:213631541-213631563 CCATCATGAGAACAGCAAGGGGG - Intronic
946995149 2:225383064-225383086 CCATCATAAGAACAGCAAGGGGG - Intergenic
947369021 2:229425855-229425877 CTGTGATCAGGACAACCAGGGGG + Intronic
948061354 2:235045084-235045106 CCAGGTTCTGGAGAGCCAGGAGG - Intronic
1171358455 20:24568382-24568404 CCATGCTCACGACAGACAGATGG - Intronic
1171777042 20:29378484-29378506 TCATTATCAGGACAGCATGGGGG + Intergenic
1173472131 20:43332335-43332357 CCTTGGACAGGAGAGCCAGGGGG + Intergenic
1173479369 20:43387136-43387158 CCATCATGAGAACAGCAAGGGGG + Intergenic
1174949488 20:55028741-55028763 CCAAGATCAGGACATACGGGGGG - Intergenic
1175182310 20:57157272-57157294 ACATCAGCAGGCCAGCCAGGAGG + Intergenic
1178989248 21:37338708-37338730 CCATGGTCCAGACAGCCACGTGG + Intergenic
1179230419 21:39499085-39499107 CCATCATGAGGACAGCATGGAGG + Intronic
1180204896 21:46253507-46253529 CTATCATGAGAACAGCCAGGGGG - Intronic
1182789440 22:32937612-32937634 CTATAATGAGGACAGCAAGGCGG + Intronic
1183210074 22:36445696-36445718 CCAGGACCAGAACAGACAGGTGG + Intergenic
1183362673 22:37390800-37390822 CCATGACCATGACTGCCAGAAGG + Intronic
1183646740 22:39131540-39131562 CCCAGCTCAGGGCAGCCAGGTGG - Exonic
1184104430 22:42359333-42359355 CCGTGATCAGGGCAGCCCAGGGG + Intergenic
1184266332 22:43348674-43348696 CTATCATGAGAACAGCCAGGGGG - Intergenic
949214549 3:1550157-1550179 CTATCATGAGAACAGCCAGGGGG - Intergenic
953791748 3:45952843-45952865 CCATCACCTGGAAAGCCAGGTGG - Intronic
954147017 3:48639533-48639555 CCAGGCTCAGCACAGCCAGAGGG - Intronic
954147781 3:48642752-48642774 CCAGGACCAGGACAGCCAGCGGG - Exonic
956572686 3:70713856-70713878 CTATTATCAGAACAGCCAGGGGG + Intergenic
960149187 3:114232919-114232941 CCATGAGCAGGCCACCCCGGAGG + Intergenic
960785830 3:121372159-121372181 CTATGATAAGGACCCCCAGGAGG + Intronic
961440648 3:126951101-126951123 CCATCATGAGAACAGCCCGGGGG - Intronic
961463932 3:127070216-127070238 CCGTAACCAGGACAGCCTGGGGG - Intergenic
965607035 3:170507906-170507928 CCATGCTCAGTACAGCCCTGGGG - Intronic
970403191 4:15737450-15737472 CCATGGTCTGGGCAGCAAGGGGG + Intronic
970856394 4:20653374-20653396 CCATCATAAGGACAGCAAGGTGG + Intergenic
973953091 4:56037322-56037344 CCATTATGAGAACAGCAAGGGGG + Intergenic
975413217 4:74079298-74079320 CTATCATGAGGACAGCAAGGGGG + Intergenic
979884444 4:126008241-126008263 CCATGTCCTTGACAGCCAGGTGG - Intergenic
980888888 4:138793152-138793174 CTATGATGAGAACAGCAAGGGGG - Intergenic
981370519 4:143953525-143953547 CCATCATGAGGACAGCATGGGGG - Intergenic
982177006 4:152715324-152715346 CCATTATCAGAACAGCGAGGGGG - Intronic
982787163 4:159549402-159549424 CCATGATCATGACAGCTATGAGG - Intergenic
985822402 5:2169205-2169227 CGATGAGCAGAACAGCCAGTGGG - Intergenic
986386874 5:7243332-7243354 ACACGAGCAGGACAGCCAGATGG + Intergenic
987138958 5:14926327-14926349 CCATCATCAGCAAAGCCAGGGGG - Intergenic
988162741 5:27542900-27542922 CTATGATGAGGACAGCATGGAGG - Intergenic
989613546 5:43317505-43317527 CCAGTATGAGGAGAGCCAGGAGG + Intergenic
991042484 5:62190292-62190314 CCATCATGAGAACAGCAAGGGGG - Intergenic
992021144 5:72625327-72625349 CCATGGTCAAGACAGCCATCTGG - Intergenic
993559191 5:89382729-89382751 CTATCACCAGGACAGCAAGGGGG - Intergenic
994368816 5:98946497-98946519 ACAGGATGAGGACAGCTAGGGGG - Intergenic
997598841 5:135125887-135125909 CCATGTCCAGGAATGCCAGGTGG + Intronic
998135102 5:139670264-139670286 CCACGCTCAGGCCAGGCAGGCGG + Intronic
998435081 5:142101211-142101233 CCATCATGAGAACAGCCTGGAGG + Intergenic
999293556 5:150443607-150443629 CCATGGTTAGGACAGGCTGGTGG - Exonic
1000005512 5:157179854-157179876 GCATAATCAAGACACCCAGGAGG - Intronic
1001172457 5:169433327-169433349 CCGTGATTAGGGCAGCCATGGGG + Intergenic
1003499088 6:6689576-6689598 CCATGGTGAAGACAGACAGGAGG - Intergenic
1003667019 6:8120955-8120977 CTATCATCAGAACAGCAAGGGGG + Intergenic
1003876445 6:10441928-10441950 CTATCATGAGGACAGCAAGGGGG + Intergenic
1007784769 6:44273275-44273297 ACATGAGCAGGAAGGCCAGGGGG - Exonic
1008632059 6:53371489-53371511 CCATGATCAGGCCATCACGGTGG - Intergenic
1009194405 6:60666798-60666820 CCATCATAAGAACAGCAAGGAGG + Intergenic
1017159264 6:151350047-151350069 CGATTCTCCGGACAGCCAGGAGG + Exonic
1019129164 6:169860742-169860764 CCATCATGAGAACAGCCTGGGGG - Intergenic
1021654920 7:22865320-22865342 ACCTGATCAGGACATCCATGTGG - Intergenic
1024891617 7:54210578-54210600 CCATGAGCTGTGCAGCCAGGGGG - Intergenic
1025186090 7:56859935-56859957 CCATGATCAGGAAAAGCAAGAGG - Intergenic
1025685831 7:63716977-63716999 CCATGATCAGGAAAAGCAAGAGG + Intergenic
1026311202 7:69186157-69186179 CTCTGATCAGGTCAGCCAGTGGG - Intergenic
1028402727 7:90441900-90441922 CCATCATGAGAACAGCAAGGGGG + Intronic
1029750381 7:102539634-102539656 CCGTGAGGAGGACGGCCAGGAGG + Intronic
1029768333 7:102638742-102638764 CCGTGAGGAGGACGGCCAGGAGG + Exonic
1029859048 7:103549520-103549542 CTATGAGCAGGACAGGCAAGGGG - Intronic
1030649633 7:112103411-112103433 CCATGTTCCTGAGAGCCAGGGGG + Intronic
1032335785 7:131023205-131023227 CCATCATGAGAACAGCCTGGGGG - Intergenic
1033222673 7:139538976-139538998 CCATGGTCAGTACTCCCAGGTGG + Intronic
1035386000 7:158473402-158473424 CCACGCCCAGGACAGCCGGGAGG + Intronic
1036054311 8:5233648-5233670 CTATCATGAGAACAGCCAGGGGG - Intergenic
1036122479 8:6033419-6033441 CGATCATGAGAACAGCCAGGAGG - Intergenic
1036813758 8:11886078-11886100 CCAGGACCAGGACAGCAGGGTGG - Intergenic
1037717779 8:21414335-21414357 CCAGGATCTGGACAGCCTAGTGG + Intergenic
1037904557 8:22708081-22708103 GTAATATCAGGACAGCCAGGAGG + Intergenic
1039845591 8:41323419-41323441 CTATGCTCAGGAGGGCCAGGAGG - Intergenic
1048148025 8:131864587-131864609 CTATGATGAGAACAGCAAGGGGG + Intergenic
1048522784 8:135172138-135172160 CCACGATCAGGAGAGGCAGGGGG - Intergenic
1048857705 8:138698248-138698270 CCTTGCACAGGACAGCCAGCCGG + Intronic
1049600268 8:143504295-143504317 CCATGAGCATCACAGCCAAGGGG + Intronic
1050643256 9:7692005-7692027 CCATCATGAGAACAGCAAGGGGG - Intergenic
1052871793 9:33514662-33514684 TGATGCTCAGGACAGCCAGTGGG + Intergenic
1053072239 9:35108172-35108194 CCATGAGCAGGCCACCCTGGAGG + Exonic
1055135948 9:72829012-72829034 CTTTGATCTGGACAGCCTGGAGG + Intronic
1055662543 9:78519816-78519838 CCAAGGGCAGGACAGTCAGGTGG - Intergenic
1057685814 9:97233291-97233313 TGATGCTCAGGACAGCCAGTGGG - Intergenic
1057701360 9:97365406-97365428 CCAAGATCATTAAAGCCAGGTGG + Intronic
1058907815 9:109495900-109495922 CCCTGGTCAGGCCAGACAGGTGG - Intronic
1059121492 9:111642963-111642985 CAAGGCTCAGGACAGACAGGAGG + Intronic
1059465077 9:114463855-114463877 CCATAACCAGGCCAGCCAGATGG - Intronic
1060343936 9:122800593-122800615 CCATGAGCAGGATATACAGGAGG - Exonic
1060917107 9:127397898-127397920 CCAGGGTCACGACAGCCTGGAGG - Exonic
1061067143 9:128285631-128285653 GCATGATCCAAACAGCCAGGTGG - Intronic
1061447238 9:130646996-130647018 CTATGATGAGAACAGCAAGGGGG + Intergenic
1062499697 9:136847063-136847085 CCTGGATCAGGACGGCGAGGCGG + Exonic
1187822553 X:23303816-23303838 TCATAATCAGCACACCCAGGAGG + Intergenic
1188221366 X:27545590-27545612 CTATGATGAGAACAGCAAGGGGG - Intergenic
1189702696 X:43728163-43728185 CTATGAACAGGACTGCTAGGCGG + Exonic
1191734314 X:64373339-64373361 CTATCATGAGAACAGCCAGGGGG - Intronic
1192292140 X:69809390-69809412 CTATCATGAGGACAGCAAGGGGG + Intronic
1194300395 X:92180232-92180254 CTATCATGAGGACAGCAAGGGGG + Intronic
1194438220 X:93895248-93895270 CCAAAATCAGGTGAGCCAGGTGG - Intergenic
1194894697 X:99426336-99426358 CTATGTTCAGGACATACAGGAGG - Intergenic
1200213714 X:154358198-154358220 CCGTGATCTGGACAGCCAGCAGG + Exonic
1201922895 Y:19253808-19253830 CCATGACCAGGACAGAAAGGAGG - Intergenic