ID: 1129323529

View in Genome Browser
Species Human (GRCh38)
Location 15:74787736-74787758
Sequence CCATGATCAGGACAGCCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 224}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129323529_1129323540 13 Left 1129323529 15:74787736-74787758 CCCCCTGGCTGTCCTGATCATGG 0: 1
1: 0
2: 0
3: 18
4: 224
Right 1129323540 15:74787772-74787794 CTCGTGGGCAGGCGAAAACCTGG 0: 1
1: 0
2: 1
3: 1
4: 43
1129323529_1129323536 -3 Left 1129323529 15:74787736-74787758 CCCCCTGGCTGTCCTGATCATGG 0: 1
1: 0
2: 0
3: 18
4: 224
Right 1129323536 15:74787756-74787778 TGGCATGGTTGTAAGCCTCGTGG 0: 1
1: 0
2: 1
3: 5
4: 83
1129323529_1129323537 -2 Left 1129323529 15:74787736-74787758 CCCCCTGGCTGTCCTGATCATGG 0: 1
1: 0
2: 0
3: 18
4: 224
Right 1129323537 15:74787757-74787779 GGCATGGTTGTAAGCCTCGTGGG 0: 1
1: 0
2: 0
3: 3
4: 63
1129323529_1129323538 2 Left 1129323529 15:74787736-74787758 CCCCCTGGCTGTCCTGATCATGG 0: 1
1: 0
2: 0
3: 18
4: 224
Right 1129323538 15:74787761-74787783 TGGTTGTAAGCCTCGTGGGCAGG 0: 1
1: 0
2: 0
3: 5
4: 62
1129323529_1129323541 14 Left 1129323529 15:74787736-74787758 CCCCCTGGCTGTCCTGATCATGG 0: 1
1: 0
2: 0
3: 18
4: 224
Right 1129323541 15:74787773-74787795 TCGTGGGCAGGCGAAAACCTGGG 0: 1
1: 0
2: 0
3: 4
4: 35

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129323529 Original CRISPR CCATGATCAGGACAGCCAGG GGG (reversed) Intronic