ID: 1129325504

View in Genome Browser
Species Human (GRCh38)
Location 15:74798414-74798436
Sequence CTTTTTCCCAGCACTCAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 235}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129325504 Original CRISPR CTTTTTCCCAGCACTCAGTC AGG Intronic
901826340 1:11864210-11864232 CTAATTCCCACCACTCAGTCTGG + Intergenic
902105504 1:14032578-14032600 CTTTTTCCTCTCTCTCAGTCTGG + Intergenic
903210880 1:21817682-21817704 CATATACCCAGCACTCAGTTTGG + Intronic
903331266 1:22598259-22598281 CTATCTCCCAGCACCCAGACTGG - Intronic
903726934 1:25455003-25455025 CTTTTTCCCATGACCCAGTGAGG - Intronic
903776977 1:25799868-25799890 CTTTGTCCCAGTCCCCAGTCTGG + Intergenic
907914845 1:58859363-58859385 CTTTTCCCCAGCAAACAATCTGG + Intergenic
908033419 1:60026345-60026367 CTATTTCCCAGGATTCTGTCAGG + Intronic
911205127 1:95084903-95084925 CTTTCTTCCAGACCTCAGTCTGG + Intergenic
911766939 1:101688631-101688653 ATTTTTCCTAGAATTCAGTCTGG + Intergenic
912826620 1:112910042-112910064 CTTTTTTCCTCCATTCAGTCTGG - Intergenic
913071611 1:115303966-115303988 CTATTTTCTAGCACTCATTCTGG + Intronic
913199367 1:116483716-116483738 GTGTTTCCCAGCACTCAGTGTGG - Intergenic
915261770 1:154681958-154681980 CTTATTCCTAGCACTCTGCCAGG - Intergenic
922064554 1:222124411-222124433 TATTTCCCCAGCACCCAGTCTGG + Intergenic
922619120 1:226979742-226979764 CGTGTCCCCAGGACTCAGTCCGG - Intronic
923827568 1:237516842-237516864 CCTTTCCACAGCAGTCAGTCTGG + Intronic
1063354265 10:5383121-5383143 CATTTTCCTAGCGCTCACTCAGG + Intergenic
1067357655 10:45545800-45545822 CTTCTTCCCTTCACTCAGCCAGG + Intronic
1067478886 10:46582922-46582944 CCTCTTCCCAGCTCTCAGCCAGG - Intronic
1067615852 10:47758879-47758901 CCTCTTCCCAGCTCTCAGCCAGG + Intergenic
1069849388 10:71395520-71395542 CTTCTTCCTAGCACTGATTCTGG + Intergenic
1070709892 10:78673307-78673329 CTTCGTCCCAGCCGTCAGTCAGG - Intergenic
1070789156 10:79179492-79179514 CTCTTTGCCAACACTCAGCCTGG - Intronic
1072199271 10:93144164-93144186 CTTTTTCCAGGCTCTCAGACAGG - Intergenic
1072484496 10:95842393-95842415 CTCTTTCCATGCAATCAGTCAGG - Exonic
1072571793 10:96664655-96664677 ATATTTCCCAGCATTCAGACAGG + Intronic
1072583915 10:96764765-96764787 CTTTTCCCCAGCTCTCAGCCAGG + Intergenic
1074080722 10:110166204-110166226 CAACTGCCCAGCACTCAGTCAGG - Intergenic
1074699406 10:116079989-116080011 CTTTTTCCCAGCAGGCTTTCTGG - Intronic
1074717279 10:116231240-116231262 CTTTGTCCCAGGAGTCAGCCAGG + Intronic
1076647779 10:131965250-131965272 CTTCTTCCCAGCACGGAGGCTGG + Intergenic
1077623127 11:3745668-3745690 CTTTCGCCCAGGACTCAGCCTGG - Intronic
1078389844 11:10927619-10927641 CTTTCTCCAAGCACTCAGCAAGG + Intergenic
1078858772 11:15228320-15228342 CCTTTTCCTAGGACTCAGTGAGG - Intronic
1079438878 11:20488020-20488042 TTTTTTACCACCACTCAATCTGG + Intronic
1080851525 11:36074411-36074433 CTTTTTCCCAGGGCTCAGCATGG - Intronic
1081171183 11:39871629-39871651 TTCTTTTCCAGCACTCAATCTGG - Intergenic
1081576935 11:44324694-44324716 CTTTTTACAAGCTCTCAGCCTGG + Intergenic
1081744162 11:45461423-45461445 CTTGTTCCCAGCACCCCTTCTGG - Intergenic
1084190232 11:67495336-67495358 CTTTCCCCCAGCACACAGCCTGG - Intronic
1086504228 11:87486711-87486733 CTTGTTCCCACCAGTCAGACTGG + Intergenic
1089483016 11:118822472-118822494 CTGTGCCACAGCACTCAGTCTGG - Intergenic
1091216510 11:133905647-133905669 CTTTTTCCCAGCAGGCTGGCGGG - Intergenic
1091408248 12:222170-222192 CTTGTGCCCAGCACAAAGTCAGG + Intronic
1091771603 12:3155754-3155776 CGTTTTCCCATCACGCAGTGAGG + Intronic
1092853907 12:12655171-12655193 CTGGTTCCCAGCAGGCAGTCAGG - Intergenic
1093453228 12:19338852-19338874 CTTTTGCCCATCACTCAGGCTGG - Intronic
1098756165 12:74365680-74365702 CTTGTTCCCAGAACACAGCCTGG - Intergenic
1099553665 12:84080690-84080712 CTTTTTCACAGCACTCACTCTGG - Intergenic
1100342977 12:93699128-93699150 CTTTAATCCAGCACTCAGTTAGG - Intronic
1103412797 12:120724854-120724876 TTCTTTCCCAGCACTCAGCCAGG - Intergenic
1104039291 12:125118990-125119012 ATTTTTCTCAGCCCTCACTCTGG - Intronic
1105898456 13:24738227-24738249 CTTTCTCCCAGCACTGGGCCTGG - Intergenic
1106259930 13:28057606-28057628 CATGTGCCCAGCACTCAGCCTGG + Intronic
1109497311 13:63189830-63189852 CTTTATCCCAGCACTCTGGGAGG - Intergenic
1110254746 13:73420330-73420352 CTTTATCCCACCACCCAGCCAGG - Intergenic
1111386849 13:87538888-87538910 CTTTTCCCCAGGACTGACTCAGG + Intergenic
1111478033 13:88780101-88780123 TTCTTTCCCAGCACGCACTCAGG + Intergenic
1113354803 13:109568741-109568763 CTTTTTATCATCACCCAGTCTGG + Intergenic
1118438113 14:65789718-65789740 CTGTTTCCCAGCAGGCATTCAGG - Intergenic
1118904110 14:70010956-70010978 GTTTTTCCCAGGACCCAGTCTGG - Intronic
1120171868 14:81254396-81254418 CTTTGTTCCACCATTCAGTCTGG + Intergenic
1120423180 14:84314309-84314331 CTTTCTGACAGCCCTCAGTCTGG + Intergenic
1120771857 14:88387942-88387964 TTTTTTCCCAGCACTCTGGGAGG + Intronic
1120825208 14:88948828-88948850 CATTTTCCCACCCCACAGTCTGG + Intergenic
1120882372 14:89423916-89423938 CCTCTTCCCAGTAGTCAGTCTGG - Intronic
1121289815 14:92764841-92764863 CTGTTTCAGAGCACTCAGGCAGG + Intergenic
1121291382 14:92778657-92778679 CTGTTTCAGAGCACTCAGGCAGG - Intergenic
1121872042 14:97417115-97417137 CTCTTTCCAAGAACTCTGTCAGG - Intergenic
1125537636 15:40451450-40451472 TTTTTTTCCAGCACTTAGTCTGG + Intronic
1128396641 15:67232806-67232828 CTTTTTGCCAGCACTAACACTGG - Intronic
1129287933 15:74541032-74541054 CTTCCTCCCACAACTCAGTCGGG + Intergenic
1129325504 15:74798414-74798436 CTTTTTCCCAGCACTCAGTCAGG + Intronic
1129342783 15:74897135-74897157 CTTTCTCCCAACACGGAGTCAGG + Exonic
1129559586 15:76552513-76552535 CCTTTTCCCAGGAGTCAGTTGGG - Intronic
1130675696 15:85950088-85950110 CATTTTCCTAGCACTCAGAAAGG + Intergenic
1132943001 16:2517578-2517600 CTGTGTCCCAGCACTCAGCAGGG - Intronic
1133529187 16:6638690-6638712 CTTATTACGAGCACTCATTCCGG + Intronic
1134256137 16:12613198-12613220 CATTTTCCTAGCCCTCATTCAGG + Intergenic
1134844155 16:17425714-17425736 CTTTCCCCCAGCACACAGCCAGG + Intronic
1137237686 16:46628890-46628912 GTTTTTCCCATTACTAAGTCGGG - Intergenic
1138583569 16:57956841-57956863 CTTTATCCCAGCCCTGAGCCAGG - Intronic
1140744509 16:77969306-77969328 CATTTTCCTAGCCCTCACTCAGG + Intronic
1140747463 16:77993795-77993817 CATTTTCCTAGCCCTCACTCAGG - Intergenic
1141735741 16:85851400-85851422 GTTTTCCCCAGCACTGACTCTGG + Intergenic
1142007907 16:87698813-87698835 CTGCTTCCCTGCACACAGTCGGG + Intronic
1142542599 17:671975-671997 CTTTTTCCCAATTCTCATTCTGG - Intronic
1142882173 17:2890213-2890235 CTGTTTTCCAGCACTGAGACAGG - Intronic
1147486790 17:40822899-40822921 ATTTTTCTCAGCACTAATTCAGG + Intronic
1148741805 17:49897358-49897380 CTTCTCCCCAGCCCTCAGGCAGG + Intergenic
1151668646 17:75559471-75559493 CTTGGTCCCAGGACTCTGTCAGG + Intronic
1152188298 17:78872459-78872481 CATTTTCTCAGCACTCAGGGAGG + Intronic
1153193424 18:2568220-2568242 CTTCATCCCTGCACTCAGTAAGG - Intronic
1153939381 18:9964710-9964732 CTCTTTCCCAGCCCTCAGCTGGG - Intergenic
1158613030 18:58960539-58960561 CTTTTGCCCAGTGCTCAGGCAGG - Intronic
1158635425 18:59152038-59152060 TTTTGTCCCAGCCCTCAGTTTGG + Intronic
1160018307 18:75160752-75160774 CCTTTCTCCAGCACTCAGTCGGG - Intergenic
1161792687 19:6369992-6370014 CTTTTTCTCATCACTCGGCCAGG - Intergenic
1163019892 19:14476288-14476310 CTATTTCCCAGCACTAAGGAGGG - Intergenic
1164420221 19:28084744-28084766 CTATTTCCGAGCTCTCTGTCTGG - Intergenic
1166095381 19:40535393-40535415 CAGTTTCCCATCAGTCAGTCAGG - Intronic
1167717457 19:51153068-51153090 CATCTGCCCAGGACTCAGTCAGG - Exonic
925104555 2:1279707-1279729 CTTTTCTCCAGCGGTCAGTCAGG + Intronic
925741631 2:7009983-7010005 CTATTTGCCAGCACTCTGTTAGG + Intronic
925987315 2:9226818-9226840 CTCTCTCCCAGCACTCACCCAGG + Intronic
926903235 2:17780413-17780435 TTATTTCCCAGAACTCAGTGAGG + Intronic
927758435 2:25727779-25727801 CTTATTCCCCACACTCAGTGTGG + Intergenic
927910312 2:26893141-26893163 TTGTTTCCCAGCACTCCCTCAGG + Intronic
931432056 2:62216073-62216095 CTCTCTCCCAGAACTCAGGCAGG - Intronic
932023431 2:68111529-68111551 CTTTTTCCCAGCACTTAGGGAGG + Intergenic
932460313 2:71878049-71878071 CTCTTCCCCAGCACTCTGTGCGG + Intergenic
932522590 2:72428632-72428654 CTTTTTCCACCCACTCAGCCTGG - Intronic
932566740 2:72915777-72915799 CCTTTTCCCCACCCTCAGTCTGG - Intergenic
933496897 2:83061352-83061374 CTTTTTCAGAGCCCTCACTCTGG - Intergenic
934541114 2:95175852-95175874 CTTTTGCCCAGTAATCATTCAGG + Intronic
934710401 2:96510367-96510389 GGTTTTCCCAGCCCTCAGTTTGG - Intergenic
936523207 2:113225591-113225613 CTTTTTCACAGAACCCACTCAGG + Intronic
937787638 2:125921048-125921070 CTTTTTCCCTACACTTACTCCGG + Intergenic
939770669 2:146312435-146312457 TTATTTCCCAGCATGCAGTCTGG + Intergenic
939955903 2:148527489-148527511 ACTTTTCCCAGCACTCAGCTGGG + Intergenic
940029012 2:149240880-149240902 CATAATCCCAGCTCTCAGTCCGG - Intergenic
940334546 2:152511685-152511707 CTCTTTCACAGCAGTCACTCTGG - Intronic
940649239 2:156425124-156425146 CTCTTGCCCGTCACTCAGTCTGG + Intergenic
942664965 2:178307762-178307784 CTTCTTCCCAGCAGTCAGGAAGG - Intronic
945326587 2:208489220-208489242 CTTTTTCTCTGCACTCTCTCTGG + Intronic
945634688 2:212333188-212333210 GTTTTTCCCAGGGCTCAATCTGG - Intronic
946533664 2:220603544-220603566 CTTTTTCCTATTACTCATTCTGG + Intergenic
946603075 2:221372824-221372846 ATTTTTCTCTGCATTCAGTCAGG - Intergenic
1168756497 20:322051-322073 CTTCTTTCCATCACCCAGTCTGG + Intergenic
1171258783 20:23712509-23712531 CTTTTGCCCATTACACAGTCTGG + Intergenic
1172372863 20:34408924-34408946 CTTTTTCCTAGGACTCCTTCTGG + Intronic
1172973526 20:38890200-38890222 CTGGTCCCCAGCATTCAGTCTGG + Intronic
1174111237 20:48199399-48199421 CTTTTTCCCAGGACACAGCAAGG + Intergenic
1174709868 20:52692957-52692979 CTTTTTCCAATAACTCAGGCTGG - Intergenic
1176240373 20:64073106-64073128 CTTCTCCCCAGCCCTGAGTCTGG + Intergenic
1177522014 21:22238682-22238704 CTTTTTCCCAGCACTTTGGGAGG - Intergenic
1178733806 21:35131003-35131025 GTATTTTCCAGCACTCATTCTGG + Intronic
1179782762 21:43712884-43712906 CTCCTTTCCAGGACTCAGTCAGG + Intergenic
1182518392 22:30871699-30871721 CTTGGTCCCAGCTCCCAGTCCGG - Intronic
1182879136 22:33718321-33718343 ATTTTTCCCAGCACCTGGTCTGG - Intronic
952861754 3:37818613-37818635 GTATTCCCCAGCACACAGTCTGG + Intronic
953117266 3:40005312-40005334 CTTTCTCACAGCACTCTGCCAGG - Intronic
954894595 3:53964806-53964828 CTTTTTCCCAGCACCATGCCTGG + Intergenic
955229611 3:57087053-57087075 CTGTTTCCCAGCACACACTTTGG + Intergenic
955584489 3:60462019-60462041 CTGTGTACCAGCACTGAGTCAGG - Intronic
957658115 3:83109338-83109360 ATTTTTCCCAGTAGTCATTCAGG - Intergenic
959193063 3:103140681-103140703 CCTTTTACGAGCACTCAGTAAGG + Intergenic
959585470 3:108021431-108021453 TTATTTCCCAGCCCTCATTCTGG - Intergenic
961423533 3:126827379-126827401 CTATTTCCCATCATTCATTCTGG - Intronic
961554868 3:127690774-127690796 CTTTTTCCCAGCAATAAGTGGGG - Exonic
962381359 3:134900613-134900635 CTTTTTCCCATCTCTCTGCCAGG - Intronic
963095250 3:141531085-141531107 CTGTTTACCACCAGTCAGTCTGG + Intronic
963173999 3:142279850-142279872 CTTTTTGCCAGCACTCAGATGGG - Intergenic
965321305 3:167254834-167254856 ATTTCTCCAAGCATTCAGTCAGG + Intronic
965455414 3:168894107-168894129 GGTTTCTCCAGCACTCAGTCTGG - Intergenic
966739765 3:183221702-183221724 GTTTGACCCAGCACTCACTCAGG - Intronic
967043376 3:185714852-185714874 CTTTTTCTCAGTATTCAGGCAGG + Intronic
968524525 4:1049231-1049253 CTCTGTCCCACCACTCAGGCAGG + Intergenic
970346487 4:15157910-15157932 TTTTGACCCAGCACTCATTCAGG + Intergenic
970438350 4:16057316-16057338 CTCTTTCCCAGGATGCAGTCAGG + Intronic
970747969 4:19322182-19322204 CTTTTTGCCAGACCTCAGTAAGG - Intergenic
971117867 4:23668789-23668811 TTTTTTCCCTCCACTCAGTGAGG + Intergenic
973224811 4:47771308-47771330 ATTTTTCCCAGAAATCATTCTGG - Intronic
975876611 4:78846379-78846401 CTTTTTCCAAACACTCTGACTGG - Intronic
976091947 4:81467877-81467899 CTTTTTGACAGCACTCAATTAGG - Intronic
979463004 4:121004334-121004356 CTTGTTCTCCCCACTCAGTCTGG - Intergenic
980778729 4:137469029-137469051 CATTTTCCTAGCCCTCACTCAGG - Intergenic
981499946 4:145439263-145439285 CTTATTCCCATCACTCACTTGGG + Intergenic
982194518 4:152897269-152897291 CTTCTCCCCAGCACCCACTCAGG - Intronic
984624968 4:181996601-181996623 TTTTTTCCCATCATTCTGTCAGG + Intergenic
986641751 5:9878863-9878885 CTTGTGGCCAGCACTCACTCAGG - Intergenic
987442990 5:17980094-17980116 CTTTTTCCTATCACCCAGGCTGG - Intergenic
987923613 5:24313798-24313820 TATTTTCCCAGCAGTCATTCAGG + Intergenic
990399264 5:55421148-55421170 CTTTTGTCTAGCACTTAGTCAGG + Intronic
990846631 5:60147867-60147889 CTTTCTCCAATCACTCACTCTGG - Intronic
995828151 5:116324747-116324769 CTATTGCCCAGCACCCAGGCTGG + Intronic
997528296 5:134567358-134567380 CTGTTTCCCAGCACACAGCTGGG - Intronic
997618537 5:135270158-135270180 CTTTTTCCCCCCACCCAGTGGGG + Intronic
1000022251 5:157328173-157328195 CTCTATCTCAGCACCCAGTCCGG - Intronic
1000501655 5:162058680-162058702 CTGTCACCTAGCACTCAGTCTGG + Intergenic
1001590183 5:172859473-172859495 TTTTTTCCCACCCTTCAGTCTGG - Intronic
1001644886 5:173272965-173272987 CTTTCTCCCATCACACAGGCTGG - Intergenic
1002864740 6:1111015-1111037 CTGTTTCCCAGCACTCTGTGTGG + Intergenic
1003040574 6:2683871-2683893 CTTTATCCCTGAATTCAGTCTGG - Intronic
1003584883 6:7379220-7379242 CTTTTTCCTAGCAGTCATTTGGG - Intronic
1006253555 6:32811344-32811366 CTTTGTCCCAGCCCTGAGCCAGG + Intergenic
1007910760 6:45512235-45512257 CTTTTTCCCAGACCCCAGGCAGG + Exonic
1008397590 6:51026640-51026662 CTTTATCCCAGAACCCAGTAAGG - Intergenic
1010597348 6:77780100-77780122 ATTTTTCCCACCCCTCAGACCGG - Intronic
1010923120 6:81708971-81708993 CTTTTTACCAGCACTTGGTATGG + Intronic
1014135932 6:117890031-117890053 TTCTTTCCCAGCACTTAGTACGG - Intergenic
1014237125 6:118970350-118970372 CTATTTCACAACACTCAGGCAGG + Intronic
1014854884 6:126387921-126387943 CTTTTTACTAGAAGTCAGTCGGG - Intergenic
1015602888 6:134927788-134927810 CTGTTTCCCAGGAAGCAGTCTGG + Intronic
1015642574 6:135351626-135351648 GTTTGTCCCAGTACTCACTCTGG - Intronic
1018757010 6:166858695-166858717 CATTCTCCCAGCACTCACTTGGG - Intronic
1022729527 7:33009442-33009464 CTTTTTCCCTTCACTCTCTCAGG + Intergenic
1024329769 7:48144251-48144273 GTTTTTCCCACCACTCTGACTGG - Intergenic
1026178581 7:68019008-68019030 CTTGCACTCAGCACTCAGTCAGG - Intergenic
1027530550 7:79325924-79325946 CCTATTCCCAGCACTCAATGTGG - Intronic
1028125031 7:87103104-87103126 CTGTCACCCAGCACTCACTCTGG - Intergenic
1029672085 7:102040317-102040339 CTCTTTCCCAGCTCTGAGTGTGG - Intronic
1031783473 7:125998899-125998921 CTTGTTCCCATCACTGAGTTTGG + Intergenic
1032913626 7:136462285-136462307 CTTCTTCCCAGCCATCAGGCAGG - Intergenic
1033221285 7:139527605-139527627 CTTGTTCCCAGAACCCAGGCGGG - Intronic
1033266460 7:139891316-139891338 GTGTTTTCCAGCACTCAGTGTGG + Intronic
1035170178 7:157012996-157013018 CTTGTTCCCAGCAGACAGTTTGG + Intergenic
1035226709 7:157437959-157437981 CCTTTGCCCACCACACAGTCTGG + Intergenic
1036719892 8:11164358-11164380 TCTTTTCCCAGCACTTACTCAGG + Intronic
1036915911 8:12803475-12803497 CTTATTCCCAGCACCCAGAAGGG + Intergenic
1037665835 8:20969463-20969485 CTCCTTCCCATCACACAGTCAGG - Intergenic
1038200420 8:25407832-25407854 CTTTCTCCCATCATTCAGGCTGG - Intronic
1038583192 8:28767966-28767988 CTTATTCCCAGCACTGTTTCAGG - Exonic
1039210023 8:35203703-35203725 CTTGTTCTAACCACTCAGTCTGG + Intergenic
1039433001 8:37540283-37540305 CGTTTTCCCATAACCCAGTCAGG - Intergenic
1039513856 8:38114235-38114257 CATTTTCCCAGGTCTCTGTCTGG - Exonic
1041157680 8:55004976-55004998 CTTTTTCCCAACACTGCGTTAGG + Intergenic
1041394321 8:57375808-57375830 CTCTTCCCCAGCACTCAGCATGG + Intergenic
1041571193 8:59338323-59338345 ATTCTTCCCTGCACTCATTCTGG - Intergenic
1045568436 8:103345194-103345216 CTGTTTTCCAGGACTCTGTCAGG + Intergenic
1048300761 8:133249364-133249386 CTCTTTCCCAGCTCACAGCCTGG + Intronic
1048984035 8:139721627-139721649 CATTTTCCCAGCACTGTGTAAGG + Intergenic
1049559590 8:143302617-143302639 CTGTATCCCAGCACTCTGTGAGG + Intergenic
1050086727 9:1973683-1973705 CTTCTTCACAGCCCCCAGTCTGG + Intergenic
1055075289 9:72208427-72208449 CTTTTTCCAAGTGCTCAGACAGG + Intronic
1055594145 9:77848506-77848528 CTGTATCCCAGCAGTCTGTCAGG - Intronic
1056660343 9:88538602-88538624 CTCTTTCCCAGCACACAGCCAGG + Intronic
1058319496 9:103611773-103611795 GTTTTTCCCAGCACGCAGTTGGG - Intergenic
1058343892 9:103935026-103935048 CCTTGTCCCAGCACTCAGAGGGG + Intergenic
1058742351 9:107956389-107956411 CATATGCCCAGCACTCAGTTAGG - Intergenic
1059999480 9:119945116-119945138 CCTTCTCCCAGCACTCAGGAAGG + Intergenic
1061116637 9:128617618-128617640 CTGTTTCCCATCTCTCATTCAGG + Exonic
1062012168 9:134273080-134273102 CTTTGTCCCATCACCCATTCCGG - Intergenic
1062380663 9:136285189-136285211 CACTGTCCCTGCACTCAGTCTGG + Intronic
1185500249 X:591397-591419 CTTTTTCTCTGCACGGAGTCTGG + Intergenic
1186540624 X:10396367-10396389 CTTATTCCCAGGAATCAATCAGG - Intergenic
1190240744 X:48655976-48655998 CTGTTGCCCAGCACCCAGGCTGG + Intergenic
1190886275 X:54532988-54533010 ATGTTTCACATCACTCAGTCTGG + Intronic
1193747292 X:85297935-85297957 ATTTTTGCCAGAACTCAATCTGG - Intronic
1194155929 X:90388620-90388642 CTTTCACCCAGCACCCAGGCTGG - Intergenic
1194869323 X:99108288-99108310 CTGTTGCCCAGCACCCAGGCTGG - Intergenic
1198319413 X:135504927-135504949 AGTTTCCCCAGTACTCAGTCTGG + Intergenic
1199681059 X:150225016-150225038 CTGTGTCCCAGCAGTCAGGCTGG - Intergenic
1199862583 X:151815176-151815198 CTTTTTCCCAAGAACCAGTCAGG - Intergenic
1199996235 X:153028400-153028422 CTTTTTCCCAGCACTTGACCAGG - Intergenic
1200502276 Y:3965573-3965595 CTTTCACCCAGCACCCAGGCTGG - Intergenic
1201189883 Y:11436979-11437001 CTTTTGCCCTGCCCTCAGTATGG + Intergenic
1201523743 Y:14906450-14906472 CTCTCTCCCATCACTCAGGCTGG - Intergenic
1202380473 Y:24272904-24272926 CTTTTTCCAACCAGTCAGTTTGG + Intergenic
1202490311 Y:25397221-25397243 CTTTTTCCAACCAGTCAGTTTGG - Intergenic