ID: 1129328015

View in Genome Browser
Species Human (GRCh38)
Location 15:74812328-74812350
Sequence ATGCTTTTGTTGAGGAAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129328011_1129328015 -4 Left 1129328011 15:74812309-74812331 CCCTTCTTTTTTCCATGTAATGC No data
Right 1129328015 15:74812328-74812350 ATGCTTTTGTTGAGGAAACCAGG No data
1129328012_1129328015 -5 Left 1129328012 15:74812310-74812332 CCTTCTTTTTTCCATGTAATGCT No data
Right 1129328015 15:74812328-74812350 ATGCTTTTGTTGAGGAAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129328015 Original CRISPR ATGCTTTTGTTGAGGAAACC AGG Intergenic
No off target data available for this crispr