ID: 1129329186

View in Genome Browser
Species Human (GRCh38)
Location 15:74818159-74818181
Sequence TTGGATTTACAGAAGGGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 173}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129329186_1129329192 0 Left 1129329186 15:74818159-74818181 CCTGGCCCCTTCTGTAAATCCAA 0: 1
1: 0
2: 0
3: 9
4: 173
Right 1129329192 15:74818182-74818204 GTCCCAACACTCCGTCAGGCAGG 0: 1
1: 0
2: 0
3: 7
4: 95
1129329186_1129329191 -4 Left 1129329186 15:74818159-74818181 CCTGGCCCCTTCTGTAAATCCAA 0: 1
1: 0
2: 0
3: 9
4: 173
Right 1129329191 15:74818178-74818200 CCAAGTCCCAACACTCCGTCAGG 0: 1
1: 0
2: 2
3: 2
4: 60
1129329186_1129329193 1 Left 1129329186 15:74818159-74818181 CCTGGCCCCTTCTGTAAATCCAA 0: 1
1: 0
2: 0
3: 9
4: 173
Right 1129329193 15:74818183-74818205 TCCCAACACTCCGTCAGGCAGGG 0: 1
1: 0
2: 0
3: 14
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129329186 Original CRISPR TTGGATTTACAGAAGGGGCC AGG (reversed) Intronic
901848582 1:12000525-12000547 TTGGATTACCAGAAGGGTCAAGG - Intronic
903909582 1:26712846-26712868 TGGGAGTTACAGAAGTGGTCAGG + Intronic
904415369 1:30358282-30358304 TTGGATTGATAGAAGGGCTCTGG - Intergenic
904495665 1:30885182-30885204 TGGGGTTTACAGAAGGAGGCTGG + Intronic
904756207 1:32770156-32770178 CTGGATTGACAGGAGGGGCAGGG + Exonic
907227014 1:52957222-52957244 TTAAATAGACAGAAGGGGCCAGG - Intronic
909014146 1:70365262-70365284 TTTGGTTTACAGAAGTGCCCAGG - Intronic
916170533 1:161998463-161998485 CTTGAGTTACAGAGGGGGCCTGG + Intronic
917647796 1:177046198-177046220 TTGGAGTTACAGCTGGTGCCAGG - Intronic
922997108 1:229973025-229973047 TTGGAATTGCAGAGGGGGCTAGG + Intergenic
1063189741 10:3682183-3682205 TTTCATTTGCAGAAGGGGCAGGG + Intergenic
1063229029 10:4045583-4045605 TTGTATTTACAGTAGAGACCGGG + Intergenic
1066284622 10:33952603-33952625 TTTGATTAACAGAAGAGCCCCGG + Intergenic
1068367357 10:56068313-56068335 CTGGGTTTTCAGAAGGGCCCTGG + Intergenic
1070481699 10:76889370-76889392 TTGCCTTTACAGTAGGGGACAGG + Intronic
1072069975 10:91906892-91906914 TTAGATTTAAAGAAGTGGCAAGG - Exonic
1072663841 10:97380154-97380176 TTGGCTTTATACAAGAGGCCAGG - Intronic
1073732478 10:106306356-106306378 TTTGATTTAATGATGGGGCCTGG - Intergenic
1074360240 10:112819933-112819955 GTGGAGCTACATAAGGGGCCTGG - Intergenic
1075784184 10:125037543-125037565 TTGGACTTACTGAAGAGCCCAGG - Intronic
1076296819 10:129391956-129391978 CTAGATTTCCAGAAGGGGTCTGG + Intergenic
1077116175 11:885595-885617 TTGGCTATAGAGAAGGGCCCAGG - Intronic
1077419234 11:2441859-2441881 TTGGATTTTCAGTAGAGGCGGGG + Intergenic
1077802962 11:5559819-5559841 CTGGATTTAATGCAGGGGCCTGG + Intronic
1078607384 11:12788925-12788947 TGGGGTTTAGAGATGGGGCCTGG + Intronic
1079757970 11:24289794-24289816 TAGGACTTACAGAAGGAGCCTGG + Intergenic
1080603363 11:33842600-33842622 CTGGATTTACAACAGGAGCCTGG + Intergenic
1086698983 11:89877792-89877814 TTGGATTTTTAGTAGGGACCAGG + Intergenic
1086707187 11:89966710-89966732 TTGGATTTTCAGTAGGGACTAGG - Intergenic
1087109131 11:94444078-94444100 TTGTATTTTCAGTAGGGGACAGG + Intronic
1087216684 11:95502533-95502555 TTTGAGTTACAGAAGGTGCCAGG + Intergenic
1087853447 11:103060536-103060558 TTGGGTATACACAAGGGTCCTGG + Intergenic
1088330178 11:108643151-108643173 TTGTATTTTCAGAAGAGGCGAGG - Intergenic
1089260258 11:117219353-117219375 TTGCTTCTAGAGAAGGGGCCAGG + Intronic
1094212876 12:27910732-27910754 TAGGAGTTACATAAGGGTCCAGG - Intergenic
1095145263 12:38719966-38719988 TCTGATTTACAAATGGGGCCTGG - Intronic
1098450870 12:70616893-70616915 TTGGTTATACATAAGGGTCCTGG - Intronic
1101390855 12:104298967-104298989 TTGGGTATACACAAGGGTCCTGG - Intronic
1103716479 12:122948226-122948248 TTGGATTTACTGGCTGGGCCCGG - Intronic
1104525490 12:129516920-129516942 ATGGATTTGAGGAAGGGGCCAGG - Intronic
1108592597 13:51924375-51924397 TTTGTTTTAGAGAAGGGGTCTGG - Intergenic
1112449013 13:99492621-99492643 TTGCATTGACGGCAGGGGCCTGG + Intergenic
1112505554 13:99972561-99972583 TTAGATCTACAGTAGGGGCGGGG + Intergenic
1114752666 14:25223124-25223146 TTGTATTTTCAGAAGAGGCAGGG - Intergenic
1119310145 14:73639343-73639365 TTGGAGGTACAGAAGGTGGCAGG - Intergenic
1119567423 14:75640660-75640682 CAGCATTTACAGAAGGGGCAAGG - Intronic
1119643514 14:76331321-76331343 GTGAATTCACAGATGGGGCCAGG - Intronic
1121908124 14:97766080-97766102 CTGGATTGACAGAAGAAGCCAGG - Intergenic
1121952262 14:98181878-98181900 CTGGATTGACAGAGGGGGCCTGG - Intergenic
1122081035 14:99268211-99268233 TTAAATTTACAGACAGGGCCAGG - Intronic
1122269424 14:100561875-100561897 TTGGGGTTACAGGTGGGGCCAGG - Intronic
1123179907 14:106460036-106460058 TGGGACTCACAGGAGGGGCCTGG + Intergenic
1124964179 15:34421046-34421068 TTGGCTTTTCAGCAGGAGCCAGG - Intronic
1124980792 15:34567274-34567296 TTGGCTTTTCAGCAGGAGCCAGG - Intronic
1127460568 15:59194817-59194839 TAGGATTTAGGGAAGTGGCCTGG - Intronic
1129329186 15:74818159-74818181 TTGGATTTACAGAAGGGGCCAGG - Intronic
1129474814 15:75777858-75777880 TAGGAGTCACTGAAGGGGCCTGG + Intergenic
1131217747 15:90553568-90553590 TTGAAATTATAGAAGGGGCGGGG + Intronic
1131464636 15:92645616-92645638 TTGTTTTTATATAAGGGGCCAGG + Intronic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1136778319 16:32883066-32883088 TGGGACCCACAGAAGGGGCCAGG - Intergenic
1136867360 16:33768718-33768740 TGGGAATTTCAGAGGGGGCCTGG - Intergenic
1136892301 16:33978448-33978470 TGGGACCCACAGAAGGGGCCAGG + Intergenic
1137889249 16:52141114-52141136 TTGAAATGCCAGAAGGGGCCAGG - Intergenic
1138093675 16:54195822-54195844 TTGCATCTCCAGAAGGGGCAGGG + Intergenic
1138224888 16:55284643-55284665 TTGGATTTTCACAGGGAGCCTGG + Intergenic
1140601932 16:76486793-76486815 TTGGGCTTACAGAGGGTGCCTGG - Intronic
1140804563 16:78521024-78521046 GTGTGTTTCCAGAAGGGGCCTGG - Intronic
1203080741 16_KI270728v1_random:1145175-1145197 TGGGACCCACAGAAGGGGCCAGG - Intergenic
1203104800 16_KI270728v1_random:1347485-1347507 TGGGAATTTCAGAGGGGGCCTGG + Intergenic
1203128714 16_KI270728v1_random:1614883-1614905 TGGGAATTTCAGAGGGGGCCTGG - Intergenic
1142672687 17:1494445-1494467 TGAGATTTGCAGAAGTGGCCAGG - Intergenic
1142959301 17:3542717-3542739 GTGGAGTTACAGGAGGGCCCCGG + Intronic
1143332636 17:6148897-6148919 TTGGAGTTAGAGAAGGAGGCTGG - Intergenic
1143347535 17:6261019-6261041 TGGGGTTTAGAGAAGGGGTCAGG - Intergenic
1146744206 17:35313767-35313789 TTGGGTTTTCAGAAGGGCTCTGG + Intergenic
1147054326 17:37822831-37822853 TTAGATTTACAGAAAAGGGCCGG + Intergenic
1148739087 17:49881745-49881767 CAGGATTTAGAGAAGGGGCTTGG - Intergenic
1149771360 17:59324434-59324456 TTGTATTTTTAGAAGAGGCCGGG + Intergenic
1152344699 17:79743879-79743901 CTGGATTTACAGAGGAGGACAGG - Intergenic
1153695513 18:7636759-7636781 TTGGATTTAAACAAAGGGACTGG + Intronic
1153720499 18:7896673-7896695 TTAGATATACTGAAGGGTCCTGG + Intronic
1157315898 18:46589383-46589405 TCTGTTTTAAAGAAGGGGCCAGG - Intronic
1160079766 18:75714319-75714341 TTGGCTTTAGAGGTGGGGCCTGG + Intergenic
1160732405 19:647204-647226 CCGGCTTTTCAGAAGGGGCCAGG + Intergenic
1160895599 19:1400611-1400633 TTGGATTTGCAAGAGTGGCCAGG + Intronic
1161638856 19:5406990-5407012 TAGGATTTAGAGAGGGGGCGTGG + Intergenic
1162913095 19:13860542-13860564 CTGGAATTACAGATGGAGCCCGG - Intergenic
1163882815 19:19942028-19942050 TTGGATTTACAAAACAGGGCCGG - Intergenic
1164270987 19:23671506-23671528 TTGCATTGACAGCAGGGACCTGG - Intronic
1165063121 19:33214543-33214565 TTGGGTTTACGGCAGGTGCCGGG - Intronic
1165660871 19:37579067-37579089 TTGGATTTTCAGAAGGGCTCTGG - Intronic
1166441362 19:42818246-42818268 TTAGAAATACAGGAGGGGCCGGG + Intronic
1167289093 19:48614855-48614877 CTGTGTTTACACAAGGGGCCGGG - Intergenic
1168109216 19:54182156-54182178 TGTGATTCACAGAAGGGACCGGG + Intronic
925121875 2:1425027-1425049 ATGACTTTACAGAAGGGGCACGG - Intronic
925121901 2:1425416-1425438 ATGACTTTACAGAAGGGGCACGG - Intronic
927744272 2:25601947-25601969 TTGTATTTTCAGTAGAGGCCGGG - Intronic
928718397 2:34090487-34090509 TTGGATTTTCAGTAGAGACCGGG - Intergenic
934232165 2:90193843-90193865 TTCTATTTACAAAAGGGGCAAGG + Intergenic
939927033 2:148187372-148187394 TTGGAGTTGCAGAAGGGGTGAGG + Intronic
944132624 2:196363131-196363153 TTGCATGTCCAGAAGAGGCCTGG - Intronic
944540452 2:200749019-200749041 TTTAATTTTCAGAAGTGGCCTGG - Intergenic
946611864 2:221467175-221467197 TTGGAATTAGAGAAGGGGTAAGG + Intronic
948859310 2:240745225-240745247 ATGGATTTACAGCTGGGGCATGG - Intronic
1169156350 20:3333287-3333309 TTGGATTTTCAGAAGAGGAAAGG - Intronic
1170054743 20:12189260-12189282 CTGGATTTACAGAATGAGTCAGG - Intergenic
1172884345 20:38221313-38221335 TCGGATGGACAGGAGGGGCCTGG + Intronic
1173307329 20:41862906-41862928 CTGGATTTATAGCAGGGGCAGGG - Intergenic
1174364936 20:50050871-50050893 TTCCATTCCCAGAAGGGGCCTGG - Intergenic
1175504514 20:59472173-59472195 TTGGCTTTACAATAGGGACCCGG - Intergenic
1175807346 20:61837252-61837274 TGGGAGTGAGAGAAGGGGCCAGG + Intronic
1177493601 21:21860906-21860928 TTGATTTCACAGAAGGGGACTGG - Intergenic
1177654354 21:23998600-23998622 TTTGATTTGGAGAAGGGGCCAGG - Intergenic
1178289005 21:31350459-31350481 TTGGTGTTGCAGATGGGGCCTGG + Intronic
1181327175 22:22058682-22058704 TTGGATTCACAGAAGTGACTGGG - Intergenic
1184307504 22:43616365-43616387 TAGGATTTAAAGATAGGGCCGGG + Intronic
1184635571 22:45826048-45826070 TTTGATTTAGAGACAGGGCCTGG - Intronic
950459382 3:13112205-13112227 TTGAACTTAGAGCAGGGGCCAGG - Intergenic
953031718 3:39184176-39184198 CTGGAGCTACAGACGGGGCCAGG - Exonic
954508971 3:51105238-51105260 TTGAATTTTAAGGAGGGGCCTGG + Intronic
958666987 3:97153810-97153832 TTGGAATTTCTGATGGGGCCAGG - Intronic
959841857 3:110985318-110985340 TCTGTTTTAAAGAAGGGGCCAGG - Intergenic
962605329 3:137028004-137028026 TTGGAGTTCCAGAAGGGGAGAGG + Intergenic
964901347 3:161662668-161662690 TTGGATTAAAAGAATGGGCAGGG + Intergenic
967240207 3:187431127-187431149 TTGGGTTTACAGAGAGGGCAAGG - Intergenic
967416482 3:189224306-189224328 TTGTATTTTCAGTAGGGGCAGGG - Intronic
968590270 4:1455166-1455188 TTGGAGTTGGAGATGGGGCCTGG - Intergenic
980187215 4:129477150-129477172 TTGGATTTTCAGAAGAAGCCAGG - Intergenic
985677877 5:1241674-1241696 TAGGATTTACAGGATGAGCCGGG + Intronic
986423584 5:7608676-7608698 TTAGATTTTCATGAGGGGCCAGG - Intronic
987285567 5:16452952-16452974 TTGTATTTCTAGAAGGGGTCTGG - Intronic
993355533 5:86902580-86902602 TTGGTTTTACAGAAGGAGGAGGG - Intergenic
993551390 5:89278144-89278166 TAGGATTCACAGATGGGGTCCGG + Intergenic
994178949 5:96743071-96743093 TTGTATTTTCAGAAGGGTTCTGG + Intronic
995971982 5:117983713-117983735 TTGGAGATACAGCAGGGGCAGGG - Intergenic
999671332 5:153961064-153961086 CTGGATTGTCAGAAGAGGCCTGG - Intergenic
999730397 5:154473076-154473098 TTGGGTTTTCTGAAGAGGCCTGG + Intergenic
999761485 5:154704472-154704494 TTGTATTTTTAGTAGGGGCCAGG - Intergenic
1002756425 6:164873-164895 TTGGATTTACTGAAGGCCCATGG - Intergenic
1002776897 6:336066-336088 TTGGCTGTATAGAAGGGACCTGG + Intronic
1004111206 6:12720655-12720677 CTGGATTTGCAGGAGGGGCGGGG + Intronic
1004424421 6:15497751-15497773 CTGGAGTTAAAGCAGGGGCCGGG + Intronic
1004700219 6:18071745-18071767 TTGGATTTATAGAAGCAGACTGG - Intergenic
1005957123 6:30671976-30671998 TTTAATTAACAGAGGGGGCCGGG - Intronic
1013969685 6:116002198-116002220 TTGGATATACAGATGTGGACTGG + Intronic
1015714748 6:136180917-136180939 GTGGAGCTACAGAAGGAGCCAGG + Intronic
1017017686 6:150115144-150115166 TGGGATTTAGAGAAGTGACCAGG - Intergenic
1018905586 6:168073600-168073622 TTTGAGGCACAGAAGGGGCCGGG + Intronic
1019710042 7:2514010-2514032 TTGGTCTTACAGACGGGTCCAGG - Intronic
1021202500 7:17741993-17742015 TAGGATTTTCAGAAGGGCTCTGG - Intergenic
1023231934 7:38041411-38041433 TAGGAATTACTGTAGGGGCCGGG + Intergenic
1024201849 7:47116488-47116510 TTGGATTGACATAGGTGGCCAGG - Intergenic
1027418933 7:78001250-78001272 GTGGCTTTACAGAAGAGTCCTGG + Intergenic
1029858725 7:103545929-103545951 TTAAATAGACAGAAGGGGCCGGG - Intronic
1031447232 7:121870440-121870462 TTGGATTTACAAAATGCTCCAGG + Intergenic
1035168195 7:157003796-157003818 TTGATTTTATGGAAGGGGCCCGG + Intronic
1036650009 8:10636232-10636254 TTGGCTTTAAAGAAGGGTTCTGG + Intronic
1037524822 8:19714471-19714493 TTGGAATTCCAGAAGGAGACTGG - Intronic
1040599024 8:48866208-48866230 GTGGATTTACAGAAAGTGCCAGG - Intergenic
1042145054 8:65719449-65719471 CTTTATTTACAGAATGGGCCAGG - Exonic
1044730587 8:95225812-95225834 TGGGAGGGACAGAAGGGGCCAGG - Intergenic
1044856561 8:96481903-96481925 TTGGCTTTGCAGAGGTGGCCAGG - Intergenic
1048592379 8:135832846-135832868 GAGGATGTACAGAAGTGGCCAGG - Intergenic
1049200724 8:141339397-141339419 CTGGATTTAAAAAAGAGGCCAGG - Intergenic
1050523837 9:6528447-6528469 ATGGGTTTTCAGATGGGGCCAGG + Intergenic
1051688350 9:19682341-19682363 TTGGGCTTACAGAAGGGCCCAGG - Intronic
1052866939 9:33469659-33469681 TAGGATTTCCTGGAGGGGCCAGG + Exonic
1056454385 9:86746053-86746075 TGGGACTTACAGAAAGAGCCAGG - Intergenic
1057429395 9:94980179-94980201 TTTGATTTGGCGAAGGGGCCTGG - Intronic
1059532485 9:115048507-115048529 TAGGTTTTCCAGAAGGGGCAGGG + Exonic
1060058002 9:120432528-120432550 TTGGATTCATATAAGGGGTCTGG - Intronic
1061284470 9:129614182-129614204 TTGGATTCCCAAGAGGGGCCCGG + Intronic
1186826702 X:13347395-13347417 TTGCCTTTACAGAAGGAGCCAGG + Intergenic
1187941918 X:24390960-24390982 TTATATTTAAAGAAGGTGCCTGG - Intergenic
1187962458 X:24579692-24579714 ATGGATAAACAGCAGGGGCCAGG - Intronic
1188025724 X:25207274-25207296 TTTGTTTTACAAAAAGGGCCAGG + Intergenic
1193334508 X:80272804-80272826 TTTGTTTTAAAGAAGGGGTCAGG - Intergenic
1197216434 X:123871113-123871135 TTGTATTTTTAGTAGGGGCCGGG + Intronic
1197794191 X:130282949-130282971 TCGCATTGACAGTAGGGGCCTGG - Intergenic
1198801548 X:140452773-140452795 TTGGAGATACAGAAGGAGCAGGG + Intergenic
1199543448 X:148982787-148982809 CTGAGTTTACAGCAGGGGCCAGG + Intronic
1200101512 X:153690995-153691017 TGGGACCCACAGAAGGGGCCAGG + Intronic