ID: 1129329787

View in Genome Browser
Species Human (GRCh38)
Location 15:74821118-74821140
Sequence CCCGCAGAGCCTGCAGGATC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 219}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129329787_1129329799 30 Left 1129329787 15:74821118-74821140 CCGGATCCTGCAGGCTCTGCGGG 0: 1
1: 0
2: 1
3: 19
4: 219
Right 1129329799 15:74821171-74821193 GACAATGGAAGAAGCAGCTGGGG 0: 1
1: 0
2: 2
3: 32
4: 368
1129329787_1129329794 15 Left 1129329787 15:74821118-74821140 CCGGATCCTGCAGGCTCTGCGGG 0: 1
1: 0
2: 1
3: 19
4: 219
Right 1129329794 15:74821156-74821178 TGGCCCAGGCTGAGAGACAATGG 0: 1
1: 0
2: 3
3: 50
4: 1067
1129329787_1129329797 28 Left 1129329787 15:74821118-74821140 CCGGATCCTGCAGGCTCTGCGGG 0: 1
1: 0
2: 1
3: 19
4: 219
Right 1129329797 15:74821169-74821191 GAGACAATGGAAGAAGCAGCTGG 0: 1
1: 0
2: 2
3: 46
4: 391
1129329787_1129329792 1 Left 1129329787 15:74821118-74821140 CCGGATCCTGCAGGCTCTGCGGG 0: 1
1: 0
2: 1
3: 19
4: 219
Right 1129329792 15:74821142-74821164 TCTCTCCAAGCAGCTGGCCCAGG 0: 1
1: 0
2: 1
3: 33
4: 294
1129329787_1129329791 -5 Left 1129329787 15:74821118-74821140 CCGGATCCTGCAGGCTCTGCGGG 0: 1
1: 0
2: 1
3: 19
4: 219
Right 1129329791 15:74821136-74821158 GCGGGGTCTCTCCAAGCAGCTGG 0: 1
1: 0
2: 1
3: 8
4: 114
1129329787_1129329798 29 Left 1129329787 15:74821118-74821140 CCGGATCCTGCAGGCTCTGCGGG 0: 1
1: 0
2: 1
3: 19
4: 219
Right 1129329798 15:74821170-74821192 AGACAATGGAAGAAGCAGCTGGG 0: 1
1: 0
2: 1
3: 38
4: 377

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129329787 Original CRISPR CCCGCAGAGCCTGCAGGATC CGG (reversed) Exonic
901811796 1:11771608-11771630 GTTGCAGGGCCTGCAGGATCTGG - Exonic
902633984 1:17723208-17723230 CCAGAAGAGCCTGTAGGATCAGG - Intergenic
903034892 1:20486776-20486798 CCCGCAGGGCCTCCAGGAGGGGG + Intergenic
903955451 1:27022242-27022264 CACGCAGAGACTGAAGGATGAGG - Intergenic
904006252 1:27364772-27364794 CCCGCAGGGCCTGCAGGTCAGGG + Exonic
904756581 1:32771577-32771599 CCTGAAGGGCCTGCAGGCTCAGG - Exonic
904810363 1:33159740-33159762 CCAGCCGCTCCTGCAGGATCTGG + Exonic
905378317 1:37540557-37540579 CACTCAGAACCTGCAGGCTCAGG - Exonic
906132601 1:43469431-43469453 TCCACAGAGCCAGCAGGAGCTGG - Intergenic
907282737 1:53361749-53361771 CCCCCAGAGTCTGCAGCACCTGG - Intergenic
907554555 1:55333310-55333332 CCCTCAGAGCCTGCCCAATCTGG - Intergenic
909643201 1:77888968-77888990 CCCGCCGAGCCCGCAGGATGCGG - Intronic
910200677 1:84695384-84695406 CCTGCACAGCCTGCAGAACCGGG - Intergenic
910644620 1:89500149-89500171 GCCTCAGAACCTGCAGGACCTGG - Intergenic
910646986 1:89524900-89524922 CCCGCTGAGCCCGCAGCCTCCGG + Exonic
912517884 1:110227291-110227313 CCCACAGAGCCTGCATGGGCTGG - Intronic
912617016 1:111112416-111112438 CCTGTACAGCCTGCAGCATCAGG + Intergenic
913299662 1:117357856-117357878 GCAGCAGAGTCTGCAGAATCGGG + Intergenic
915347133 1:155203240-155203262 CCCGCAGCTCCACCAGGATCTGG + Exonic
917469417 1:175313957-175313979 ACGGCAGAGCCTGCTGGAACGGG - Intergenic
918097558 1:181347546-181347568 ATCCCAGAGCCTGCAGGGTCTGG - Intergenic
919309808 1:195893480-195893502 CCCGCTGAACCTGCTGGATGGGG + Intergenic
921117621 1:212108920-212108942 CACGGAAAGCCTGCAGGATAAGG + Intergenic
921348211 1:214208731-214208753 CCCGCAGAGTCAGCACAATCGGG + Intergenic
921625265 1:217372632-217372654 TCCACAGAGCCTGCAGGAGCTGG + Intergenic
922766437 1:228158814-228158836 CGCGCAGCGCCTGCAGGGCCAGG - Exonic
922798969 1:228355449-228355471 TCCCCAGAGCCAGCAGGATGGGG - Intronic
923475545 1:234327929-234327951 CCCGCAGGGCCCTCAGGAGCTGG - Intergenic
924024365 1:239817213-239817235 GCCTCAGAGCCTTCAGGGTCTGG - Intronic
1063432308 10:6001018-6001040 CCTTCAGAGCCTGCAGACTCAGG - Intergenic
1063432320 10:6001207-6001229 CCTTCAGAGCCTGCAGACTCAGG - Intergenic
1063957049 10:11276835-11276857 CACGCAGAGCGTGCAGGGGCTGG - Intronic
1064304933 10:14157057-14157079 CCCACAGAGCCTGGGGGTTCAGG + Intronic
1065963143 10:30750481-30750503 CCCCTTCAGCCTGCAGGATCCGG - Intergenic
1067508068 10:46873208-46873230 CCAGAAGAGCCTGCAGCATCTGG - Intergenic
1067654181 10:48178637-48178659 CCAGAAGAGCCTGCAGCATCTGG + Intronic
1069719590 10:70541110-70541132 CCCGCAGGGCCTCCAGCAGCTGG - Exonic
1069929678 10:71874091-71874113 CCCACAGGGGCTGCAGGATTAGG - Intergenic
1073111612 10:101066229-101066251 CCCGCAGTGGCGCCAGGATCCGG - Intronic
1073945062 10:108740876-108740898 CCAGCAGAGGCTGCAGTAGCAGG - Intergenic
1074066823 10:110022955-110022977 CACCCAGGGCCTGCATGATCTGG - Intronic
1074847020 10:117407315-117407337 CCCCCTGGGCCTGCAGGAGCTGG + Intergenic
1075949809 10:126467503-126467525 CCCACAGTCACTGCAGGATCTGG + Intronic
1076427112 10:130374790-130374812 CCAGCATAGGCTGCAGGTTCCGG - Intergenic
1076581995 10:131517993-131518015 CCCCCAGTGCCTGCAGAATGGGG + Intergenic
1076734409 10:132452292-132452314 CACCCAGAGACTGCAGGGTCGGG - Intergenic
1076845490 10:133067636-133067658 TTCCCAGAGCCTGCAGGAGCCGG + Intergenic
1077090405 11:775803-775825 CCCCCAGAGCCTTCTGGATTGGG - Intronic
1077331004 11:1983758-1983780 GCCTCAGAGCCTTCAGGTTCCGG - Intronic
1078091613 11:8267949-8267971 CCCACAGATCCTGCAGGTGCAGG - Intronic
1079187005 11:18246885-18246907 CCAGCAGAGTCTGCAGAAACTGG - Intronic
1079189798 11:18268014-18268036 CCAGCAGAGTCTGCAGAAACTGG + Intronic
1079472429 11:20790701-20790723 CCCGTAGAGCAGGCAGGAGCAGG - Intronic
1083951463 11:65958961-65958983 CCTGCATAGCCTGCTGGAACAGG - Exonic
1087292738 11:96338317-96338339 GCTGCAGAGTCTGCAGGAACAGG - Intronic
1089015691 11:115163434-115163456 GACTCAGAGCCTCCAGGATCTGG - Intergenic
1089504866 11:118956389-118956411 ACAGCAGAGCCAGCAGAATCAGG - Exonic
1090190539 11:124763496-124763518 CCCGCAGAGCGGGCAGCGTCAGG - Intergenic
1090472196 11:126990327-126990349 CCCTCACACCCTGCAGAATCAGG + Intronic
1202813983 11_KI270721v1_random:38934-38956 GCCTCAGAGCCTTCAGGTTCCGG - Intergenic
1091760496 12:3084188-3084210 CCCCAGGAGCCTGGAGGATCAGG - Intronic
1091821148 12:3476007-3476029 TCAGCAGAGCCTTTAGGATCTGG + Intronic
1095271618 12:40225239-40225261 CCAGCAGATCCTCCAGGATTTGG - Exonic
1096152940 12:49325863-49325885 CCCCCAGAGGCTACAGGCTCTGG + Exonic
1097249431 12:57624487-57624509 TCCACACAGCCTGCAGGATAGGG - Intronic
1097925312 12:65121116-65121138 CCCGCAGTGCCAGCAGGCACAGG + Exonic
1100186493 12:92145391-92145413 CCAGCAGCTCCTGCAGGCTCTGG + Exonic
1100330108 12:93573410-93573432 CCCGCAGGCCCAGCAGCATCTGG + Intronic
1101764083 12:107682558-107682580 TCCGCAGAGCAGGCAGGAGCTGG - Intergenic
1102965430 12:117121622-117121644 CCCGCAGATCCTGCAGCCCCCGG - Intergenic
1105071409 12:133236128-133236150 CCCGCAGAGCCTGCTCCTTCCGG - Intergenic
1108118651 13:47159983-47160005 TCCACAGAGCCAGCAGGAGCTGG + Intergenic
1108359963 13:49659955-49659977 CCTGCAGAGGCTGCAGGCCCTGG - Intergenic
1111160871 13:84393610-84393632 CCAGCAGAGCTAGCAGGCTCTGG + Intergenic
1112024971 13:95403663-95403685 CCTGCACAGCCTGCAGAACCAGG - Intergenic
1113467730 13:110524096-110524118 CCGGCAGAGCCTGGTGGAGCTGG - Exonic
1115374365 14:32657119-32657141 CCAGGAGATCATGCAGGATCTGG - Intronic
1117920543 14:60722788-60722810 CCCGCAGAGACTGCCGGCGCCGG - Intronic
1118755902 14:68843570-68843592 CTCACAGAGCCTGCAGGACGGGG - Intergenic
1119027338 14:71164514-71164536 CCTGCAGCCACTGCAGGATCTGG + Intergenic
1119597294 14:75947025-75947047 CCCCCAGGGCCTGCATGATCTGG - Intronic
1120967958 14:90184292-90184314 CCAGGAGAGCCTGAAGGATGCGG + Exonic
1122549612 14:102543030-102543052 GCCTCAGAGCCTGCAAGATATGG + Intergenic
1122577505 14:102751381-102751403 CCGGCAAAGCCTGCACGATGGGG + Intergenic
1124573011 15:30883269-30883291 CCCGCGGAGCCTGGTGGAGCTGG - Intergenic
1126547513 15:49889251-49889273 TCCTCAGCTCCTGCAGGATCAGG + Intronic
1126579882 15:50232981-50233003 CCCGCTGGGTCTGCTGGATCAGG + Intronic
1128860805 15:71070165-71070187 CCAGCCAAGGCTGCAGGATCTGG - Intergenic
1129329787 15:74821118-74821140 CCCGCAGAGCCTGCAGGATCCGG - Exonic
1129696173 15:77741711-77741733 CCCACAGAGCCTGCAGCCTCAGG - Intronic
1132481053 16:166255-166277 CGTGAAGAGCCTGCAGGACCAGG - Exonic
1132739227 16:1403057-1403079 CCAGCAGAGCCTGCAGCAGCAGG + Intronic
1132878296 16:2149821-2149843 CCCGCTGAGCCTGCAGGCCTGGG + Intronic
1133301969 16:4787953-4787975 CCAGCAGAGCCTGGAGGGCCAGG + Intronic
1136074683 16:27808824-27808846 CCCGCAGAGGCTGCTCGCTCTGG - Intronic
1136414533 16:30095544-30095566 CCCGGAGAGGCTGCTGGCTCTGG - Exonic
1137585084 16:49659528-49659550 CCGGCAGAGCCAGGAGAATCTGG + Intronic
1137728596 16:50673576-50673598 CCTGCAGCGCCTGCAGGCCCGGG - Exonic
1137977202 16:53041962-53041984 TCAGCAGAGCCTGGAGGAGCAGG - Intergenic
1139650680 16:68360638-68360660 CCCTCGGACCCTGCAGGAGCCGG + Exonic
1141532799 16:84658406-84658428 CCCACAGAGACTCCAGGACCTGG - Intronic
1142115265 16:88353023-88353045 CCCGGTGAGACTGCAGGGTCTGG + Intergenic
1142684883 17:1571984-1572006 CCGCCAGAGCCTGGAGGATGAGG + Intronic
1143188108 17:5022646-5022668 CCCGCAGGGCCTGCAGCTCCCGG - Exonic
1144075938 17:11719383-11719405 CCCGCAGGACCTGCAGGCACAGG + Exonic
1144912985 17:18698354-18698376 CCCGCACAGCCTGGAGCATTTGG + Exonic
1146922640 17:36723493-36723515 GCCTCAGAGTCTGCAGGAGCAGG + Intergenic
1147605651 17:41772393-41772415 CCCTCAGAGACTCCAGGATCTGG + Intronic
1148051086 17:44770186-44770208 CCCTCAGAGCCTCCTGGGTCGGG - Intronic
1148460769 17:47837963-47837985 CCAGCAGAAACAGCAGGATCTGG - Exonic
1151293448 17:73166278-73166300 CCCTCAGGGCCTGCAGAACCCGG - Intronic
1152941905 17:83177222-83177244 CCTGCAGAGCCTGCTGGAGCCGG + Intergenic
1153027021 18:681310-681332 GCTGCAGAGCCTGCAGGTCCAGG - Intronic
1153759404 18:8316206-8316228 CCAGTAGAGACTGCAGGAGCTGG - Intronic
1154107438 18:11534536-11534558 CCTGCAGAGACTGCAGGAGAAGG - Intergenic
1154349251 18:13569261-13569283 GCCCCTGAGCCTGCAGGATGGGG - Intronic
1156528549 18:37792869-37792891 CTCTCAGAGCCTGAAGGACCTGG - Intergenic
1160676154 19:392456-392478 CCCGCTGTCCCTGCAGGCTCTGG - Intergenic
1161727014 19:5935365-5935387 CCCCCGCATCCTGCAGGATCTGG - Intronic
1161977943 19:7616445-7616467 CCCCCACAGCCTGCTGGACCGGG + Intronic
1162052999 19:8046404-8046426 CCCGCACATCCTGCAGGGGCAGG + Intronic
1162053492 19:8049559-8049581 ACCCCAGAGCCTGCAGGGTTGGG - Intronic
1162064850 19:8119141-8119163 CCAGGAGAGCCTGGAGGCTCCGG + Intronic
1162413228 19:10518707-10518729 CCAGCAGGGCCTGAAGCATCAGG - Intergenic
1162932376 19:13963432-13963454 CCCGCCCAGCCTGCAGGCTCGGG + Intronic
1163519750 19:17784862-17784884 CCCCCACAGGCAGCAGGATCTGG - Exonic
1164558103 19:29268995-29269017 CCCAGAGAGCCTGCTGGATTTGG + Intergenic
1165244959 19:34493485-34493507 CCCACAGATCCTGCAGGCCCTGG + Exonic
1166822914 19:45591585-45591607 CCCAAAGAGCTTGCAGGACCCGG + Exonic
1166938327 19:46348260-46348282 CACGGAGACCCTGCATGATCTGG - Intronic
1167188367 19:47964467-47964489 CTTGCTCAGCCTGCAGGATCAGG - Intergenic
1167639099 19:50670583-50670605 TCCCCAGACCCTGCAGGATCGGG + Intronic
925034967 2:677740-677762 CCCCGAGACCCTGCAGGAGCCGG + Intergenic
925771132 2:7284089-7284111 CCCGCAGAGGGTGCAAGAGCAGG - Intergenic
925948882 2:8892906-8892928 TCTGCAGAGCCTGCTGGATCCGG - Intronic
926115536 2:10210661-10210683 CCCGCAAAGCCTGCAGGCCAGGG + Exonic
927636134 2:24818704-24818726 ACCGGAGAGCCTGCAGGAGAGGG - Intronic
928086035 2:28346961-28346983 CCTGCAGAGGCTGCAGGAAGAGG + Intergenic
930692398 2:54378060-54378082 CCTGCAGAGCCGGGAGCATCAGG + Intronic
930946782 2:57084869-57084891 TCCACAGAGCCTGCAGGAGCCGG - Intergenic
932330605 2:70896498-70896520 CTGGCAGAGCCTTCAGTATCCGG - Intergenic
932369924 2:71178500-71178522 CCCGAATAGCCTGCAGAACCAGG - Intergenic
945395251 2:209307890-209307912 TCTGCAGAGCCAGCAGGAGCTGG - Intergenic
948898887 2:240946095-240946117 GGCTCAGAGCCTGCAGGACCAGG + Intronic
949037294 2:241821704-241821726 CCTGTAGAGCCTGCAGAACCGGG + Intergenic
1171085557 20:22235353-22235375 CCCGCAGAGCATCCAGCATATGG - Intergenic
1174449259 20:50609599-50609621 CCGAGAGAGCCTGCAGGAGCTGG - Exonic
1175744334 20:61443726-61443748 CGGGCAGGGCCTGCAGGACCGGG + Intronic
1175891236 20:62316935-62316957 CCTGCACGGCCTGCAGGATGCGG + Exonic
1176119854 20:63449515-63449537 GCCGCAGTGCCTGGAGGGTCTGG + Intronic
1176150379 20:63587882-63587904 CCCGAGGAGCCAGCAGGACCTGG + Exonic
1179150468 21:38805189-38805211 CCCGCGGAGCCTGCGGGATCGGG + Intergenic
1179567304 21:42257353-42257375 CCCGCAGCCTCTGCAGCATCTGG + Intronic
1179991229 21:44949205-44949227 TCCACAGAGCCAGCAGGAGCGGG - Intronic
1180913900 22:19472160-19472182 CCCACAGCACCTGCAGCATCTGG - Intronic
1181530215 22:23513070-23513092 CCAGCAGCGCCTGCAGGACTGGG + Intergenic
1181764920 22:25084525-25084547 CCTGCACACCCTGCAGAATCTGG - Intronic
1181864976 22:25847618-25847640 GACGCAGAGCCTCCAGGATGTGG - Exonic
1182152084 22:28034857-28034879 TCCCCAGAGCAGGCAGGATCTGG - Intronic
1182715174 22:32352547-32352569 CCCGCATCTCCTGCAGAATCTGG - Intergenic
1184262692 22:43328428-43328450 CCCACAGAGCCTGCAGTTTTTGG - Intronic
1184399947 22:44267919-44267941 CCCAGAGGGCCTGCAGGATAAGG - Intronic
1185283599 22:49988763-49988785 CCCGTACAGCCTGCAGAACCAGG + Intergenic
1185324092 22:50217192-50217214 CCCGCCGCACCTGGAGGATCAGG - Exonic
1185410481 22:50679012-50679034 CCCTCAGACCCTGCTGGACCTGG + Intergenic
950454659 3:13085536-13085558 CCAGCAGAGCCTGCAGGAGACGG + Intergenic
953356853 3:42263536-42263558 CCCGCAGATCCCGCGGGCTCCGG - Exonic
953759063 3:45672686-45672708 TCCCCAGGGCTTGCAGGATCTGG - Exonic
953786548 3:45915750-45915772 TCCCCAGAGCTTGCAGGATGGGG + Intronic
963483187 3:145903621-145903643 TCCACGGAGCCTGCAGGAGCTGG + Intergenic
963602143 3:147387979-147388001 CCCAAAGAGGCTCCAGGATCAGG - Exonic
966787946 3:183636895-183636917 CCAGAACTGCCTGCAGGATCAGG - Intronic
968507852 4:980040-980062 CCCGCAGAGCCCCCATGAACTGG - Intronic
968657165 4:1783617-1783639 ACCGCAGAGCCAGCAGCAGCTGG + Intergenic
969531513 4:7733387-7733409 CCCGCAGGGCCACCAGGACCCGG - Exonic
969574868 4:8030879-8030901 CCTGCAGAGCCAGCAGCAGCTGG - Intronic
974179621 4:58366950-58366972 CTCTCAAGGCCTGCAGGATCTGG - Intergenic
977471734 4:97451971-97451993 TCCATGGAGCCTGCAGGATCTGG + Intronic
983371784 4:166869159-166869181 CCTGCTGATCCTGCAAGATCAGG - Intronic
985588354 5:752188-752210 CCAGGAGGGCCTGCAGGCTCAGG + Intronic
985603026 5:844643-844665 CCAGGAGGGCCTGCAGGCTCAGG + Intronic
989217735 5:38922617-38922639 CCAGCAAAGCCTGCAGGGACTGG - Intronic
990856087 5:60268044-60268066 CCTGCACAGCCTGCATGATTAGG - Intronic
995223883 5:109682435-109682457 CCCTCAGACCCTGTGGGATCTGG - Intergenic
996090265 5:119344154-119344176 CTTGCATAGCCTGCAGAATCAGG - Intronic
997303632 5:132823721-132823743 CCCGAGGAGCCGGCAGGAGCTGG + Exonic
999448322 5:151659173-151659195 CCCCCAGAGCCAGCGGGACCCGG - Intergenic
1002159709 5:177307949-177307971 TCCGCAGAAGCTGGAGGATCAGG - Exonic
1002837426 6:876729-876751 CCCGAAGAGCTTGCAGGAGGCGG + Intergenic
1004267287 6:14159821-14159843 CCTGCACAGCCTGCAGAACCAGG + Intergenic
1005805202 6:29468195-29468217 CCAGCCCAGCCTGCAGGTTCTGG + Intergenic
1005897756 6:30192343-30192365 CGGGCAGGCCCTGCAGGATCAGG - Intronic
1008410649 6:51174699-51174721 CCTGAAGAGGCTGCAGGCTCTGG + Intergenic
1010559540 6:77333073-77333095 TCCGCAGAGCCAGCAGGGGCTGG + Intergenic
1010687309 6:78867861-78867883 CACGCAGAGCCTCCAGCAGCAGG + Exonic
1011930277 6:92701935-92701957 TCTGCAGAGCCTGCAGGGGCTGG - Intergenic
1017907541 6:158767380-158767402 CCAGGAGAGCTTGCAGGATGAGG - Exonic
1018384126 6:163287490-163287512 CCCTCACAGCCCGCAGGATCTGG + Intronic
1019019073 6:168902578-168902600 CACGGAGAGCCTGGAGGCTCAGG + Intergenic
1019437071 7:1027948-1027970 CTCGCAGTGCCTGCAGGGCCTGG + Intronic
1019866069 7:3711740-3711762 CCTCCAGGGCCTGCAGGATCTGG - Intronic
1020111551 7:5450844-5450866 TCACCAGAGCCTGCAGAATCTGG - Intronic
1022465447 7:30650120-30650142 CCCTAAGGGCCTCCAGGATCTGG + Intergenic
1023072139 7:36446436-36446458 CCAGTACAGCCTGCAGAATCAGG - Intronic
1023256487 7:38317878-38317900 CCCACACAGCCTGCAGCACCGGG + Intergenic
1025284981 7:57653746-57653768 GCCGCGGAGGCTGCTGGATCCGG + Intergenic
1027400190 7:77798787-77798809 CGCGCAGTGACTGCAGGCTCCGG + Exonic
1029046865 7:97639253-97639275 CCAGCTGAGACTGCAGGCTCTGG + Intergenic
1029366575 7:100120197-100120219 TCTGCAGAGGCTGCAGGAGCCGG + Intronic
1029491275 7:100871587-100871609 TCCCCATAGCCCGCAGGATCCGG - Exonic
1034471795 7:151258673-151258695 CCTGAAGGTCCTGCAGGATCTGG + Intronic
1035271483 7:157722537-157722559 AACGCAAAGCCTCCAGGATCTGG - Intronic
1036586158 8:10125600-10125622 CCCGCTATACCTGCAGGATCAGG - Intronic
1042103512 8:65298799-65298821 ACCTCAGTGCCTGCAGGACCAGG - Intergenic
1042246487 8:66713089-66713111 GCCGCCGAGCCTGGAGGAACTGG + Intronic
1042624976 8:70748200-70748222 TCTGCAGAGCCAGCAGGAGCAGG + Intronic
1042903073 8:73747110-73747132 CCCGCAGAGCCTGCAGCTGCTGG - Intronic
1044347650 8:91123993-91124015 CCCACACAGCCTGCAGTACCAGG + Intronic
1048474968 8:134734685-134734707 CTTGCAGAGCATGCAGGAACTGG + Intergenic
1049037286 8:140086503-140086525 CCCCCAGAGGCAGCAGGAGCTGG - Intronic
1049687147 8:143943558-143943580 CCCGCACAGGCTGCAGGCTGAGG + Intronic
1049701155 8:144013372-144013394 CTCATTGAGCCTGCAGGATCTGG - Intronic
1049709566 8:144057510-144057532 CCCGCTGAGCCTGGAGGAGGTGG - Exonic
1052235704 9:26211562-26211584 CCTGAAGAGCATGCAGGGTCAGG + Intergenic
1056990156 9:91403171-91403193 CCCGAGGAACCTGCAGAATCTGG - Intergenic
1057298397 9:93862341-93862363 GCCCCAGAGCCTGGGGGATCAGG - Intergenic
1057546445 9:96022617-96022639 CCCGCAGCGCCAGCCGGGTCCGG + Intergenic
1057918583 9:99076773-99076795 ACCCCAGAGACTGCAGTATCAGG + Intergenic
1060150081 9:121282859-121282881 TCCGCAGACCCTGCAGGGCCAGG + Intronic
1060730394 9:126033458-126033480 CCCCAAGAGCCTGCAGGGGCAGG + Intergenic
1061834788 9:133321707-133321729 CGCGCAGAGCCTGGACGCTCAGG - Intergenic
1062124867 9:134854792-134854814 GCCGCACAGCCCGCAGGTTCTGG - Intergenic
1062612994 9:137383342-137383364 TCTGCAGGGCCTGCAGGAGCAGG + Exonic
1203793438 EBV:163577-163599 GAAGCAGAGCCTGCAGGACCAGG - Intergenic
1185449747 X:275860-275882 CGCTCAGAGCCTGCAGGCTTGGG + Intergenic
1185736711 X:2501097-2501119 CCCGCACCGCCTGCAGGACTGGG + Intronic
1186186698 X:7027234-7027256 CCAGCTGAGCCTGCTGCATCAGG + Intergenic
1195454331 X:105051272-105051294 CCCCCAGTCCCTGCAGGCTCGGG - Intronic
1198699543 X:139382456-139382478 ACCCCTGAGCCTGCAGGAACTGG + Intergenic
1199092207 X:143705463-143705485 TCCACAGAGCCTGCAGGAGCTGG + Intergenic