ID: 1129330697

View in Genome Browser
Species Human (GRCh38)
Location 15:74825833-74825855
Sequence GCTGGGAGTGCGCTCCAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 136}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129330685_1129330697 23 Left 1129330685 15:74825787-74825809 CCTCACCCTAATCTCTGTGAAGG 0: 1
1: 0
2: 0
3: 13
4: 195
Right 1129330697 15:74825833-74825855 GCTGGGAGTGCGCTCCAAGCAGG 0: 1
1: 0
2: 0
3: 10
4: 136
1129330688_1129330697 17 Left 1129330688 15:74825793-74825815 CCTAATCTCTGTGAAGGCTTCCA 0: 1
1: 0
2: 1
3: 19
4: 210
Right 1129330697 15:74825833-74825855 GCTGGGAGTGCGCTCCAAGCAGG 0: 1
1: 0
2: 0
3: 10
4: 136
1129330684_1129330697 27 Left 1129330684 15:74825783-74825805 CCAGCCTCACCCTAATCTCTGTG 0: 1
1: 0
2: 2
3: 27
4: 275
Right 1129330697 15:74825833-74825855 GCTGGGAGTGCGCTCCAAGCAGG 0: 1
1: 0
2: 0
3: 10
4: 136
1129330692_1129330697 -6 Left 1129330692 15:74825816-74825838 CCCCTTCTGAGTACCTGGCTGGG 0: 1
1: 0
2: 3
3: 20
4: 216
Right 1129330697 15:74825833-74825855 GCTGGGAGTGCGCTCCAAGCAGG 0: 1
1: 0
2: 0
3: 10
4: 136
1129330695_1129330697 -8 Left 1129330695 15:74825818-74825840 CCTTCTGAGTACCTGGCTGGGAG 0: 1
1: 0
2: 0
3: 34
4: 268
Right 1129330697 15:74825833-74825855 GCTGGGAGTGCGCTCCAAGCAGG 0: 1
1: 0
2: 0
3: 10
4: 136
1129330690_1129330697 -3 Left 1129330690 15:74825813-74825835 CCACCCCTTCTGAGTACCTGGCT 0: 1
1: 0
2: 0
3: 16
4: 230
Right 1129330697 15:74825833-74825855 GCTGGGAGTGCGCTCCAAGCAGG 0: 1
1: 0
2: 0
3: 10
4: 136
1129330694_1129330697 -7 Left 1129330694 15:74825817-74825839 CCCTTCTGAGTACCTGGCTGGGA 0: 1
1: 0
2: 4
3: 22
4: 170
Right 1129330697 15:74825833-74825855 GCTGGGAGTGCGCTCCAAGCAGG 0: 1
1: 0
2: 0
3: 10
4: 136
1129330687_1129330697 18 Left 1129330687 15:74825792-74825814 CCCTAATCTCTGTGAAGGCTTCC 0: 1
1: 0
2: 1
3: 16
4: 183
Right 1129330697 15:74825833-74825855 GCTGGGAGTGCGCTCCAAGCAGG 0: 1
1: 0
2: 0
3: 10
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129330697 Original CRISPR GCTGGGAGTGCGCTCCAAGC AGG Intergenic
901817458 1:11803057-11803079 GCTGGCACTGCCCTCCAAGCAGG + Exonic
903451405 1:23456047-23456069 GCTTGGAGTTAGCTCCAGGCTGG + Intronic
904039098 1:27574182-27574204 GCTGGCAGAGAGCTCCAGGCTGG - Intronic
905757266 1:40521575-40521597 GCTGGGACTGCACTCCAGCCTGG - Intergenic
906108417 1:43308121-43308143 GCTGGCAGTGAGCTCCTTGCTGG - Intronic
906841954 1:49148592-49148614 GCTGGCTGTGCAGTCCAAGCAGG + Intronic
906928937 1:50149344-50149366 GCTGAGATTGCGCTCCAGCCTGG + Intronic
908350886 1:63285907-63285929 GCTGGGAGTGGTCTGGAAGCTGG - Intergenic
911236158 1:95414758-95414780 GATGGGAGTGTGAACCAAGCAGG + Intergenic
919921101 1:202166920-202166942 GCTGGGAGTGGGCTACAGGTAGG + Intergenic
922908745 1:229197720-229197742 GCGGGGAGTGAGCTGGAAGCTGG + Intergenic
924318711 1:242825465-242825487 GGTGGGTGTGCACTCCAAGCAGG - Intergenic
1063854763 10:10237249-10237271 GCTGAGATTGCACTCCAACCTGG - Intergenic
1066245320 10:33577570-33577592 GCTGAGATTGCGCTCCAGCCTGG + Intergenic
1070809391 10:79290002-79290024 GCTGGGTGTGCCCTGGAAGCTGG - Intronic
1071035674 10:81241211-81241233 GCTGAGATTGCACTCCAACCTGG + Intergenic
1071736175 10:88303419-88303441 CCTGGGACTGCCCTGCAAGCAGG - Intronic
1073099437 10:100999241-100999263 GCTGGGTGTGTTCTCCGAGCCGG + Intronic
1075533453 10:123250137-123250159 GCTGGGAGTGTGCTGGAAGCAGG + Intergenic
1075740564 10:124693517-124693539 ACTGGGAGTGCACTCCACCCAGG - Intronic
1077662964 11:4085384-4085406 GCTGGGAGTGAGCCCAAAGGGGG + Intronic
1077792971 11:5461402-5461424 GCTGAGACTGCACTGCAAGCTGG + Intronic
1078033686 11:7780620-7780642 CCTGGGACTGAGCTCCCAGCAGG + Intergenic
1078856155 11:15207627-15207649 GGAGGGAGTGGGCTGCAAGCGGG + Intronic
1080763317 11:35273358-35273380 GCTGGGAGTGTCATCCAGGCTGG - Intronic
1083333388 11:61909450-61909472 GCTGGAAGTGGGCTCCTTGCAGG - Intronic
1085035473 11:73297304-73297326 CCTGGCAGTGCGCTCGACGCCGG + Exonic
1086725078 11:90172107-90172129 ACTGGGAGTTCAATCCAAGCAGG + Intronic
1088712757 11:112523539-112523561 GCTGGGAGTGAGCCTAAAGCAGG + Intergenic
1088725138 11:112627975-112627997 GCTGAGAGTCACCTCCAAGCTGG - Intergenic
1089457176 11:118632465-118632487 CCTGGCAGTGCCCTCCAAGCTGG - Intronic
1090473958 11:127003474-127003496 CCTCGGAGTGCGCTGCAAGAGGG + Intergenic
1091000337 11:131905708-131905730 GCTGGAAGTGCACTTCATGCAGG + Intronic
1091457313 12:617642-617664 GCTGGGAGTGCTCAGCCAGCCGG - Intronic
1092582454 12:9858323-9858345 GCTGGGGCTGTGCTACAAGCTGG - Intronic
1096462366 12:51829083-51829105 GCTGTGAGTCGGCTCCAGGCCGG + Intergenic
1100628092 12:96357408-96357430 GCTGTGACTGCACTCCAACCTGG + Intronic
1102034268 12:109761901-109761923 GGTGGGAGTGCACTGCAAACCGG - Intronic
1102101236 12:110280860-110280882 GCTGGGAGCGCGGTCCACGCGGG - Intronic
1112365458 13:98752281-98752303 GCCGGGAGTGCGCTTGGAGCGGG - Intronic
1113640938 13:111956325-111956347 GCTGGGAGGGCCCTGCCAGCCGG + Intergenic
1116833958 14:49750140-49750162 TCTGGCAGTGCGAGCCAAGCAGG - Intronic
1117353542 14:54902786-54902808 GCTCGGAGTGTGATCTAAGCAGG - Exonic
1117556027 14:56884814-56884836 GCTGGGGATGCGCTCCAACCTGG + Intergenic
1119293572 14:73515626-73515648 GCTGAGATCGCGCTCCAACCTGG + Intronic
1122587581 14:102820072-102820094 GCTGGGAGGGCACTCCCGGCAGG + Intronic
1124342030 15:28895727-28895749 GCTGGGACTGCGCTGGATGCTGG + Intronic
1124965208 15:34428475-34428497 GCTGGGACTGCGCTGGATGCTGG - Intronic
1125493480 15:40167392-40167414 GCTGAGATTGCGCTCCAGCCTGG - Intronic
1129330697 15:74825833-74825855 GCTGGGAGTGCGCTCCAAGCAGG + Intergenic
1129439823 15:75572661-75572683 GCTGAGACTGCGCTCCAGCCTGG + Intronic
1129459889 15:75695303-75695325 GCTGGGAGGGGGCTGCAGGCAGG - Intronic
1129463259 15:75710453-75710475 GCTGGGAGCACCCTCGAAGCAGG + Intronic
1129721627 15:77880949-77880971 GCTGGGAGCACCCTCGAAGCAGG - Intergenic
1132687936 16:1170087-1170109 GCTGGGAGCTCGCTGTAAGCCGG - Intronic
1133224051 16:4332230-4332252 GCAGGCAGTGGGCTCCCAGCTGG - Exonic
1134016461 16:10891852-10891874 GCTGGGATCTCGCTGCAAGCCGG + Intronic
1134041710 16:11073683-11073705 GCTGGGAGGGCCATCCAGGCAGG - Intronic
1136054758 16:27680173-27680195 GCTGGGCGTGTGCTGCATGCTGG - Intronic
1137572741 16:49577527-49577549 GCTGGGACATCCCTCCAAGCAGG + Intronic
1140044593 16:71432144-71432166 GATGAGAGTGCGCTGCATGCGGG - Intergenic
1141682669 16:85553527-85553549 GCTGGGAGGGGGCGCCAGGCGGG + Intergenic
1141933143 16:87218245-87218267 GCTGGGGGTGAGGTCCATGCTGG - Intronic
1142122347 16:88393192-88393214 GCTGGGAGGGCACTCCAGGGCGG - Intergenic
1143171613 17:4933803-4933825 GCTTGGAGTGGGCTCCAGGGTGG - Exonic
1143974695 17:10821201-10821223 GCTGGGAGGGCACACCAGGCAGG - Intergenic
1144630062 17:16866834-16866856 GCTGTGAGATCCCTCCAAGCTGG + Intergenic
1144651312 17:17008962-17008984 GCTGTGAGATCCCTCCAAGCTGG - Intergenic
1145006191 17:19339668-19339690 CCTGGCAGTGCTCTGCAAGCTGG + Intronic
1145049466 17:19648448-19648470 GCTGGGAGTGGGCGCCCTGCCGG - Intronic
1147308264 17:39578487-39578509 GCTGAGAGGGCCCTCCATGCAGG + Intergenic
1149747680 17:59115103-59115125 GCTGAGATTGCGCTCCAGCCTGG - Intronic
1151803096 17:76389185-76389207 GCTGGGAGGCTGCTCTAAGCTGG + Intergenic
1157400735 18:47384241-47384263 GCTTGGTGTGCACTCCAGGCTGG - Intergenic
1158213995 18:55080159-55080181 GCTGGGAGAGCGCTGCCAGAGGG - Intergenic
1161310499 19:3591364-3591386 ACTGGGATTGGTCTCCAAGCTGG - Exonic
1161673932 19:5632004-5632026 GCTGTGATTGCTCTCCAACCTGG + Intronic
1163140879 19:15347717-15347739 GCTGGCACTGCACTCCAACCTGG + Intergenic
1166194803 19:41198595-41198617 GCTGGGAGTCAGCTCCCAGGGGG + Exonic
925988470 2:9234784-9234806 GCCGGAAGTGGGCTCCAGGCTGG - Intronic
928447594 2:31347045-31347067 TCAGGAAGTGCTCTCCAAGCAGG - Intronic
932491823 2:72127507-72127529 TCTGCGAGTGCCCTCCAAACTGG + Intergenic
934903793 2:98181631-98181653 GCTGGGATTGCGCTGTATGCTGG - Intronic
941918464 2:170827494-170827516 GGAGGGAGTGTGCTCCACGCTGG + Intronic
943876523 2:193073345-193073367 GCTGGGAGTGCCCCCACAGCTGG - Intergenic
946806863 2:223479627-223479649 GCTGGCAGTGCTATCCAGGCAGG + Intergenic
1169690793 20:8329361-8329383 GCTAGGAGTGCACTCCAGACTGG - Intronic
1170381658 20:15766836-15766858 GCTTGGAGTTCTCTCCATGCGGG + Intronic
1171372339 20:24669855-24669877 GCTGGGATGGAGCTCCAGGCAGG + Intergenic
1172954775 20:38748460-38748482 GCTGGACGCGCGCTCCAAGATGG + Exonic
1174404503 20:50294664-50294686 GCTGGGAGAGCGTTCCCAGTAGG + Intergenic
1175279788 20:57795310-57795332 GCTGTGTGTGCCCTCCAAGGTGG + Intergenic
1178689722 21:34740899-34740921 GCTGGGAGAGCCTGCCAAGCTGG - Intergenic
1181436180 22:22912243-22912265 GCTGGGACTGAGCTCCAAAGGGG - Intergenic
1181807423 22:25383519-25383541 CCTGGGAGAGGGCTCCCAGCAGG + Intronic
950230813 3:11274237-11274259 TCTGGCACTGCGCTGCAAGCTGG + Intronic
952668740 3:35939964-35939986 GCTAGGAGTGAGCTTAAAGCAGG - Intergenic
953435797 3:42876150-42876172 GGTGGGAGTGGGCTCAAGGCAGG - Exonic
956494229 3:69807087-69807109 GCTGGGGGAGCCCTCCAAGCAGG + Intronic
960579905 3:119267884-119267906 ACTGGGAGAGAGCTCCCAGCAGG + Intergenic
961372743 3:126441319-126441341 GCTGCTAGTGCGCCACAAGCAGG + Intronic
962602866 3:137007910-137007932 GGTGGGATTGCGTTCCAAGATGG - Intronic
965648477 3:170908843-170908865 GCTGAAAGTGCGCTCCACGCCGG - Intergenic
968551783 4:1227064-1227086 ACAGAAAGTGCGCTCCAAGCAGG + Intronic
969239183 4:5888162-5888184 GCTGGGAGTGGGCGCCCGGCAGG - Intronic
969862591 4:10049334-10049356 GCTGGGAGTGGCAGCCAAGCAGG - Intronic
971959770 4:33471026-33471048 GGTGGGAGCGAGCTCCATGCAGG + Intergenic
975183028 4:71369103-71369125 GCTGGGAGTGCGCCGCACTCGGG - Intronic
979100947 4:116613471-116613493 GCTGGGATTGTGCTCCAGCCTGG - Intergenic
980275963 4:130651069-130651091 ACTGGGAGAGAGCTCCCAGCAGG + Intergenic
982646109 4:158026858-158026880 CCTGGGACTGAGCTCCCAGCAGG + Intergenic
982822122 4:159954299-159954321 GCTGGGAGTGAACTCAAAGTGGG - Intergenic
995747404 5:115418170-115418192 GCTGGGAAAGTGCCCCAAGCTGG + Intergenic
997303804 5:132824524-132824546 GGTGGGAATGCTCTCCTAGCTGG - Intronic
998297114 5:140981837-140981859 GCTGGGAGTGAGATACAAACTGG - Intronic
1000938880 5:167336321-167336343 GCTTGGAGTGTGTACCAAGCTGG + Intronic
1002799813 6:511685-511707 CCTTGGAGTGCACTCTAAGCTGG - Intronic
1007862177 6:44922030-44922052 GCTGCGAGTGCACTCTAATCAGG + Intronic
1010690998 6:78910838-78910860 GCTGGGTGCGCGCTCCGTGCTGG + Intronic
1011164009 6:84425500-84425522 CCTGTGAATGTGCTCCAAGCTGG - Intergenic
1014683899 6:124470401-124470423 GATGGGAGTGCTTTCCAATCAGG + Intronic
1015701629 6:136041606-136041628 TCTGGGAGTGCCCCCAAAGCTGG + Intronic
1019143140 6:169960901-169960923 GCTGGGAGGAGCCTCCAAGCTGG + Intergenic
1019482885 7:1274521-1274543 GATGGGGGTGCCCCCCAAGCAGG - Intergenic
1019639184 7:2094090-2094112 GCTGGGCGTGTGCTCCCAGCGGG - Intronic
1022508247 7:30920154-30920176 GCTGGGAGGGTTCTCCAAGGCGG + Intronic
1023049087 7:36235576-36235598 GCTGTGAGTGCCTTCCAGGCAGG + Intronic
1024402022 7:48935404-48935426 GCTGAGAGTGCTCTGCAAGTAGG + Intergenic
1031116520 7:117674775-117674797 GCTTGGTGTGAGCTCCAAGCAGG - Intronic
1031483599 7:122304875-122304897 GAGGGGAGGGCGCGCCAAGCGGG - Intronic
1034241628 7:149615819-149615841 GCTGGGAGTGCTCCTCAGGCAGG - Intergenic
1034417957 7:150975061-150975083 GCTGGGACTGGGGTCCCAGCAGG + Intronic
1035827914 8:2664370-2664392 GGTTGCAGTGAGCTCCAAGCTGG - Intergenic
1036432399 8:8702695-8702717 GCTGGGCGTGCGCTGCTGGCAGG + Exonic
1040025417 8:42777228-42777250 GCTGGGAGGGGGATCCAGGCAGG + Intronic
1048185427 8:132235951-132235973 GGCGGGAGTGGGCTCCATGCTGG + Intronic
1048214246 8:132480801-132480823 GCTGGGAGGGCGCGCGAGGCTGG + Exonic
1056755259 9:89377761-89377783 GATGGGAGTGCGGTACAATCTGG - Exonic
1058884654 9:109314166-109314188 GCTGGGAGTGGGCTCCTCCCCGG - Intronic
1060637676 9:125212269-125212291 GCTGAGATTGCGCTCCAGCCTGG - Intronic
1061908343 9:133710200-133710222 GCCTCGAGTGCGCTCCAAGAGGG + Intronic
1062162697 9:135088626-135088648 GCTGGGAGTGGGGCCCCAGCCGG + Intronic
1191168468 X:57417669-57417691 ACTGGGAGACAGCTCCAAGCAGG - Intronic
1193010710 X:76671738-76671760 ACTGGGAGTCATCTCCAAGCAGG + Intergenic
1195172897 X:102286276-102286298 GCTGAGGCTGCGCTGCAAGCGGG + Intergenic
1195185969 X:102400819-102400841 GCTGAGGCTGCGCTGCAAGCGGG - Intronic
1199679070 X:150213138-150213160 GCAGGGGGTGGGCCCCAAGCTGG + Intergenic