ID: 1129332702

View in Genome Browser
Species Human (GRCh38)
Location 15:74835903-74835925
Sequence GGTCATTGCTGCCCACACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 205}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129332702_1129332711 8 Left 1129332702 15:74835903-74835925 CCTGGGTGTGGGCAGCAATGACC 0: 1
1: 0
2: 2
3: 18
4: 205
Right 1129332711 15:74835934-74835956 CCCTTCTCCTGGATCTCTGGGGG 0: 1
1: 0
2: 1
3: 25
4: 234
1129332702_1129332713 14 Left 1129332702 15:74835903-74835925 CCTGGGTGTGGGCAGCAATGACC 0: 1
1: 0
2: 2
3: 18
4: 205
Right 1129332713 15:74835940-74835962 TCCTGGATCTCTGGGGGCTGAGG 0: 1
1: 0
2: 2
3: 42
4: 593
1129332702_1129332707 5 Left 1129332702 15:74835903-74835925 CCTGGGTGTGGGCAGCAATGACC 0: 1
1: 0
2: 2
3: 18
4: 205
Right 1129332707 15:74835931-74835953 CAGCCCTTCTCCTGGATCTCTGG 0: 1
1: 0
2: 4
3: 27
4: 321
1129332702_1129332708 6 Left 1129332702 15:74835903-74835925 CCTGGGTGTGGGCAGCAATGACC 0: 1
1: 0
2: 2
3: 18
4: 205
Right 1129332708 15:74835932-74835954 AGCCCTTCTCCTGGATCTCTGGG 0: 1
1: 1
2: 3
3: 35
4: 223
1129332702_1129332709 7 Left 1129332702 15:74835903-74835925 CCTGGGTGTGGGCAGCAATGACC 0: 1
1: 0
2: 2
3: 18
4: 205
Right 1129332709 15:74835933-74835955 GCCCTTCTCCTGGATCTCTGGGG 0: 1
1: 0
2: 7
3: 34
4: 292
1129332702_1129332704 -3 Left 1129332702 15:74835903-74835925 CCTGGGTGTGGGCAGCAATGACC 0: 1
1: 0
2: 2
3: 18
4: 205
Right 1129332704 15:74835923-74835945 ACCCTGGTCAGCCCTTCTCCTGG 0: 1
1: 0
2: 3
3: 20
4: 199
1129332702_1129332715 15 Left 1129332702 15:74835903-74835925 CCTGGGTGTGGGCAGCAATGACC 0: 1
1: 0
2: 2
3: 18
4: 205
Right 1129332715 15:74835941-74835963 CCTGGATCTCTGGGGGCTGAGGG 0: 1
1: 0
2: 3
3: 22
4: 346
1129332702_1129332716 24 Left 1129332702 15:74835903-74835925 CCTGGGTGTGGGCAGCAATGACC 0: 1
1: 0
2: 2
3: 18
4: 205
Right 1129332716 15:74835950-74835972 CTGGGGGCTGAGGGCAGATGTGG 0: 2
1: 1
2: 19
3: 101
4: 777

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129332702 Original CRISPR GGTCATTGCTGCCCACACCC AGG (reversed) Intergenic
901319232 1:8329708-8329730 GGTCCTGCCTCCCCACACCCTGG - Intronic
901739803 1:11334683-11334705 GGGCCTTCCTGCCCACGCCCCGG - Intergenic
902558363 1:17260470-17260492 GGTCATGGCTGCCCAGTACCTGG - Intronic
902638538 1:17751112-17751134 GGTCACTCCTGCCCCCTCCCTGG + Intergenic
903000628 1:20263008-20263030 GCCCAATGCTGCCTACACCCGGG + Intergenic
904267689 1:29326997-29327019 GGCCATTGCTGTCCCCATCCAGG + Intergenic
904415021 1:30355495-30355517 GGTCATTGGTGACCACAGCAAGG + Intergenic
904431726 1:30468690-30468712 TGTCATTGCTTCCCTCACCGTGG - Intergenic
910423924 1:87100376-87100398 GGACATTGCTCCCCACATCCCGG - Intronic
910515427 1:88054703-88054725 GGACATTTCTACACACACCCTGG - Intergenic
910802062 1:91156990-91157012 GTTCATTGCTCCACACATCCAGG - Intergenic
912074053 1:105850280-105850302 GGACACTGCTTTCCACACCCTGG + Intergenic
912522516 1:110255552-110255574 AGTCATTGCTACAGACACCCAGG + Intronic
915302505 1:154959527-154959549 GGTCCTGGCTACCCACCCCCAGG - Exonic
916717598 1:167458289-167458311 ACTCATTCCTGCCCACACCAGGG - Intronic
919177230 1:194033794-194033816 GGACACTGCTCCCCACATCCAGG - Intergenic
921891651 1:220359904-220359926 GGTCCTGGCTTCCCACACCAGGG - Intergenic
1063395064 10:5678731-5678753 GGTCATTCCTGCCCAGAGCAGGG - Intergenic
1067044784 10:42979333-42979355 GGGGAATGCTGCCCCCACCCAGG - Intergenic
1068876609 10:62003517-62003539 GGTAATGGCTGCCTTCACCCTGG + Intronic
1070108572 10:73460762-73460784 GGACACTGCTCCCCACAGCCAGG + Intronic
1071456121 10:85852838-85852860 GGACATTGCAGGTCACACCCTGG + Intronic
1072587871 10:96798658-96798680 TATCATTGCTGCCTACACCCTGG + Intergenic
1072888062 10:99297727-99297749 GTTCACTGCTGGCCACCCCCTGG + Intergenic
1073150065 10:101305455-101305477 GGTCAGTTCTGCCCACCCACTGG + Intergenic
1075711342 10:124532308-124532330 GGGCATTGCTGCTCAGGCCCTGG + Intronic
1076330798 10:129664656-129664678 TGTCTTTGCTGCCCCCATCCTGG - Intronic
1076644838 10:131945990-131946012 GGTCACTTCTGCCCAGAGCCTGG + Intronic
1076763874 10:132620063-132620085 GGTCAGTGCTCCCCACATCTAGG - Intronic
1077517035 11:3008194-3008216 GGTCAGTGCTGCCCAAAGGCAGG - Intronic
1078453124 11:11455019-11455041 AGTCATTCCTGCCCATCCCCAGG + Intronic
1084268100 11:68015205-68015227 GGTCAGGGGTGCCCAGACCCTGG + Intronic
1085121350 11:73969483-73969505 GGTGATTGCAGCCCACAGCTTGG - Intronic
1089394875 11:118130049-118130071 GCTCAGTGCTGGCCACACCTGGG + Intergenic
1092735132 12:11575258-11575280 GACCATTGATGCTCACACCCAGG - Intergenic
1093371876 12:18375800-18375822 GGACACTGCTCCCCACATCCAGG + Intronic
1096524255 12:52201194-52201216 GCTCATTGCCGCCCAGATCCAGG + Intergenic
1098474293 12:70882372-70882394 CGTGACTGCTGCCCACCCCCTGG + Intronic
1099890876 12:88586829-88586851 GGTCACTGCTCCCCACATTCTGG - Intergenic
1103859245 12:123998825-123998847 GGTCAGAGCTGCACACACACAGG - Intronic
1104178136 12:126352153-126352175 GGTCATGGCTGCCCACCTCATGG + Intergenic
1104591233 12:130085891-130085913 GGGTATTGCTGCTCAGACCCAGG + Intergenic
1104619407 12:130299711-130299733 GGTCTTGGCTGCTCACCCCCTGG + Intergenic
1105701955 13:22940597-22940619 GGGCCCCGCTGCCCACACCCTGG + Intergenic
1108500387 13:51065063-51065085 GGTGTTTGCTGCCCACACCCAGG + Intergenic
1113778223 13:112960980-112961002 GGTCACTGCAGCCCAAACACTGG - Intronic
1114081324 14:19203514-19203536 GGACACTGCTCCCCACATCCTGG + Intergenic
1114832690 14:26164144-26164166 GGTCCTTGCTGGCCACCCACTGG - Intergenic
1115374687 14:32661340-32661362 CTTCATTGCTTACCACACCCTGG + Intronic
1115568639 14:34646983-34647005 GGTTATTGCTGCCCAGATCAGGG - Intergenic
1117981592 14:61347424-61347446 GGGCATTGGTACCCATACCCAGG + Intronic
1119028656 14:71174342-71174364 AGCCATTGCTGCCCACCCCCAGG - Intergenic
1120858678 14:89235049-89235071 GGTCACTTCTGCCCACTCTCTGG + Intronic
1120868773 14:89318740-89318762 AGTCACTGCTGCGCACAACCAGG - Intronic
1122043518 14:99007356-99007378 GATCTTGGCTGGCCACACCCTGG - Intergenic
1122269320 14:100561266-100561288 GGGCCTTGCTGCCCACCCCTTGG - Intronic
1122353656 14:101111369-101111391 GGTCTCTGCTGCCCACACACAGG - Intergenic
1122465097 14:101928049-101928071 GGTCAGGGCCGCCCACACACAGG + Intergenic
1122786462 14:104166457-104166479 GTGCATGGCTGCCCACAGCCTGG + Intronic
1123116956 14:105899179-105899201 AGTCCCTGCAGCCCACACCCTGG - Intergenic
1123599510 15:21952777-21952799 GGGCATCACTGCCCACAGCCGGG + Intergenic
1124663151 15:31567761-31567783 GGACACTGCTCCCCACATCCTGG + Intronic
1125522485 15:40356109-40356131 GGTCACTGCGGGCCACCCCCTGG + Exonic
1127553136 15:60060761-60060783 GTCCAGTGCTCCCCACACCCAGG - Intronic
1127592575 15:60440648-60440670 GGAGATTGCTGGCCCCACCCTGG - Intronic
1128106886 15:65051696-65051718 GGTCATTGCTGTCCACCCTTTGG + Intronic
1128305273 15:66594314-66594336 GGTCACTGGTGCTCACAGCCAGG + Intronic
1128496404 15:68200921-68200943 GGGCAGAGCTGCCCACAGCCAGG - Intronic
1129332702 15:74835903-74835925 GGTCATTGCTGCCCACACCCAGG - Intergenic
1131183828 15:90258383-90258405 GCTCATTCCTGCCCACCCCAGGG - Intronic
1131198882 15:90379660-90379682 GGACACTGCTTCCCACATCCAGG - Intergenic
1131378005 15:91941160-91941182 GAGCAGTGCTGCCCACAACCAGG - Intronic
1131970220 15:97884622-97884644 GGTCATTGCTGGTCGCACTCAGG + Intergenic
1132495097 16:259292-259314 AGGCATTGTTGCCCACCCCCTGG + Intronic
1132858329 16:2057549-2057571 GCTCAGCTCTGCCCACACCCTGG + Intronic
1133678333 16:8096921-8096943 GGCCATAGCTGACCACACCGAGG - Intergenic
1134690620 16:16188941-16188963 GGTGTTTGCTGTCCACACTCTGG - Exonic
1140481977 16:75266820-75266842 GGTCAGCGCTGCCCACCCCAGGG + Intronic
1142752621 17:1997986-1998008 GGACATCGCTGCCCGCCCCCAGG - Intronic
1144074491 17:11704524-11704546 GGTCAGTGCTGTACAGACCCTGG - Intronic
1145017374 17:19408112-19408134 GCTCTTGGCTGCCCACTCCCAGG + Intergenic
1148892225 17:50816538-50816560 GGCCATTGGTGCCCAAGCCCTGG + Intergenic
1149025065 17:52017912-52017934 GGGCATTGCTCCCCACTTCCTGG + Intronic
1152323658 17:79623285-79623307 GCCCACTGCTGCCCACAGCCTGG + Intergenic
1152388605 17:79989931-79989953 GGGTGTTGCTGCCCACCCCCAGG + Intronic
1154357842 18:13635804-13635826 GAGCATGGCTGCCCAGACCCAGG - Intronic
1154499105 18:14985698-14985720 GGACACTGCTCCCCACATCCTGG - Intergenic
1155793000 18:29997650-29997672 GGACACTGCTCCCCACATCCTGG + Intergenic
1156789424 18:40953607-40953629 GGACACTGCTCCCCACATCCAGG + Intergenic
1157574547 18:48734719-48734741 GGGCATTGCTCCCACCACCCTGG - Intronic
1159911919 18:74153386-74153408 GGTCATTGGCCCCAACACCCTGG - Intronic
1160541942 18:79628645-79628667 GCTCATGGCTGCCCAGGCCCAGG - Intergenic
1160576048 18:79854252-79854274 GGCCACTGCTGCCCTCACACAGG - Intergenic
1160805327 19:990033-990055 GGTCCTGGCTGCCCACACTGGGG + Intronic
1160894743 19:1397139-1397161 GGTCACTGCTGCCCACTGCAGGG - Intronic
1160929072 19:1561185-1561207 GGTCATTGCAGCCAGGACCCTGG - Intronic
1162032778 19:7924668-7924690 GCTCATTTCTGCCCCCAACCCGG - Exonic
1163125540 19:15242467-15242489 GCTCAGTGCTCCCCACACCATGG + Intronic
1164415797 19:28045643-28045665 GTTCATAGCTGCCCTCACCGAGG + Intergenic
1164532275 19:29057573-29057595 TCTCAGGGCTGCCCACACCCAGG - Intergenic
1164839495 19:31381617-31381639 TGACTTTCCTGCCCACACCCAGG + Intergenic
1164867731 19:31618886-31618908 GGTCATTGCTCTTCACACTCTGG + Intergenic
1168264793 19:55216867-55216889 GGTCCTGGCTGGCCCCACCCAGG - Intergenic
1168642044 19:58037292-58037314 GGGCAGTGCTGGCCACACCACGG + Intronic
926098792 2:10100137-10100159 GCTCTTTGCTGCCTCCACCCAGG + Intergenic
928709449 2:33987786-33987808 GGACATTGCTCCCCACATCCTGG - Intergenic
929637726 2:43542708-43542730 GTTGATTGCTGCCCAAACCCAGG + Intronic
930523368 2:52496174-52496196 GGTGATTGCTGACCATACCTGGG - Intergenic
932716670 2:74105533-74105555 GGCCAATGTTTCCCACACCCCGG + Exonic
936470097 2:112791310-112791332 GGACACTGCTGCCCGCATCCAGG + Intergenic
937326212 2:120990711-120990733 GGTCATCGCTGCCCAGAGCCTGG + Exonic
938498075 2:131813807-131813829 GGACACTGCTCCCCACATCCTGG - Intergenic
939482830 2:142770962-142770984 GGACATTGCTCCCCACATTCTGG + Intergenic
939961334 2:148568701-148568723 GGCCAGTGCTGCCCAGACCTGGG + Intergenic
940251116 2:151677965-151677987 TGACATTGCTGACCACATCCTGG + Exonic
943268789 2:185771543-185771565 GGACACTGCTGCTCACATCCTGG - Intronic
944480634 2:200154082-200154104 GCTCACTGCTGCTCACCCCCAGG - Intergenic
948607105 2:239142883-239142905 GATCATTGCTGAGCTCACCCAGG - Intronic
1170860206 20:20095692-20095714 GACCACTGCTGCCCACACCCTGG - Intronic
1171325939 20:24292859-24292881 GCTCATTAGTGCCCACTCCCAGG - Intergenic
1172848321 20:37943655-37943677 TCTCACTGCTGCCCACCCCCAGG - Intronic
1173067662 20:39728728-39728750 GGACATTGTTCCCCACATCCAGG + Intergenic
1173263027 20:41453203-41453225 GGCCTTGCCTGCCCACACCCCGG - Intronic
1173746983 20:45445141-45445163 GGTTAGTTCTGCCTACACCCAGG + Intergenic
1176008239 20:62877623-62877645 GGGCACTCCTGCCCACGCCCAGG + Intergenic
1176170720 20:63695271-63695293 GGGCTTTGCTGCTCACTCCCAGG - Intronic
1178416699 21:32411044-32411066 GGGCAGTGCTGCCCACTCCCAGG + Intergenic
1178765123 21:35443261-35443283 GGACCCTGCTGCCCACTCCCTGG - Intronic
1179122451 21:38560429-38560451 GGTCATTTCTGCCCAACCCGGGG + Intronic
1180027446 21:45175863-45175885 GGCCATTGCTGCCCTCCTCCAGG - Exonic
1180499449 22:15919172-15919194 GGACACTGCTCCCCACATCCTGG - Intergenic
1181683235 22:24510591-24510613 GGTAAGGGCTGCCCACAGCCAGG + Intronic
1182248343 22:28978974-28978996 AATCATTGCTCCCCTCACCCTGG + Intronic
1183507994 22:38220058-38220080 GGTGACTGCAGCCCAAACCCAGG + Exonic
1183720008 22:39557282-39557304 GGGCATTACTGACCACCCCCGGG - Intergenic
1184114977 22:42417076-42417098 GGTCTTTTCTGCCTCCACCCAGG + Intronic
1184210239 22:43031036-43031058 GGTCTTTGCTATCCACCCCCAGG - Intergenic
1184892268 22:47387315-47387337 GGTCGTGGCTGTCCCCACCCAGG - Intergenic
1185078413 22:48695719-48695741 TGCCCCTGCTGCCCACACCCTGG - Intronic
949135122 3:555079-555101 GGTAATTTCTGCCTACACCGTGG - Intergenic
949205772 3:1438017-1438039 GGTCACTGCTGTCCACAGTCAGG + Intergenic
950362911 3:12462428-12462450 GGTCCCTGCTCCCCACCCCCAGG + Intergenic
954127332 3:48539253-48539275 GGTCATAGCTGCCAACATCGTGG - Exonic
954151635 3:48660696-48660718 GGTCATTGATGTCCACCACCTGG + Exonic
954510786 3:51123102-51123124 GGTTATGGCTGACCACACCCTGG - Intronic
954711676 3:52508035-52508057 GGGCATGGGTGCCCACTCCCAGG + Intronic
959268349 3:104172089-104172111 TGTCCTTGCTGCCCCCACCCAGG + Intergenic
961008583 3:123421511-123421533 GGTCATAGTGGACCACACCCAGG - Intronic
961447393 3:126987340-126987362 GGTCAGCGCTGCCCAGATCCTGG - Intergenic
961780987 3:129319921-129319943 GGTCTGTGTTGGCCACACCCAGG - Intergenic
962414770 3:135172203-135172225 GTTCAGTGCTGCAGACACCCAGG + Intronic
963786153 3:149536508-149536530 GGCCAGTGCTGCTCACAGCCAGG + Intronic
963993067 3:151676061-151676083 AGTCAGTTCAGCCCACACCCAGG - Intergenic
964423454 3:156529035-156529057 AGTCACTGCTGCCCTCACTCAGG - Intronic
965865904 3:173203590-173203612 GGACATTGCTTCCCATATCCTGG - Intergenic
967373331 3:188773160-188773182 GGTAATTCCTTCCCACAGCCAGG + Intronic
969507797 4:7598923-7598945 GGGCCTTGCTGGCCACAGCCTGG + Intronic
972739182 4:41874481-41874503 GGTCAATCCTGCCCAGACCCTGG + Intergenic
972907476 4:43768524-43768546 GGTCTTTGCTCCCCACATTCTGG - Intergenic
980234252 4:130084327-130084349 GGTCTCTTCTCCCCACACCCAGG + Intergenic
981871124 4:149487201-149487223 TGTCATTTCTAGCCACACCCTGG - Intergenic
988397030 5:30708504-30708526 GGACACTGCTTCCCACATCCTGG + Intergenic
991358102 5:65790956-65790978 GGTCATTGCTACCAGCACCCTGG + Intronic
993580964 5:89660764-89660786 GGATATTGCTCCCCACATCCTGG + Intergenic
994175338 5:96704129-96704151 AGTCCTTGCTGCACACACACGGG - Intronic
996284235 5:121769989-121770011 GGACACTGCTCCCCACATCCAGG + Intergenic
997554941 5:134787944-134787966 GGTCATTGCAGCCTAGATCCTGG - Intronic
997575894 5:134976936-134976958 GGACACTGCTCCCCACATCCTGG - Intronic
1003133914 6:3418443-3418465 GGTCATGGCTGCCCAAGGCCAGG - Intronic
1004968336 6:20879776-20879798 GCTGTTTGCTGCCCACACCTCGG + Intronic
1007182400 6:39939078-39939100 GGTCAGTGTTGCCCTCACTCTGG + Intergenic
1007333889 6:41137392-41137414 TGTCCTTGATGCCCACACTCTGG - Intergenic
1007408096 6:41646259-41646281 GGTCAGTGCTGTCCAGGCCCTGG - Exonic
1012089466 6:94873563-94873585 AGTCACTGCTGCTGACACCCAGG - Intergenic
1012304140 6:97629343-97629365 GGACACTGCCACCCACACCCAGG - Intergenic
1018923164 6:168189678-168189700 GGACGTGGCTGCCCTCACCCTGG - Intergenic
1019002274 6:168764109-168764131 GGACACTGCTCCCCACATCCTGG - Intergenic
1019209367 6:170392815-170392837 GGACATGGCTCCACACACCCTGG - Intronic
1020142977 7:5622533-5622555 GGTCCCTGCTGCTCACACCTGGG - Intronic
1021702884 7:23337547-23337569 GCACATTGCTGCCCTCACACAGG + Intronic
1026155533 7:67822648-67822670 GTTCACTGCTGCCCAGACCTGGG + Intergenic
1026994403 7:74606268-74606290 GGTCACTCCTGCCCCCATCCTGG - Intergenic
1027501159 7:78952870-78952892 GGACCTTGCTACTCACACCCAGG - Intronic
1032098370 7:128951817-128951839 GGACCTTGATGCCCACATCCTGG + Intergenic
1032166050 7:129545777-129545799 GGTCATTGCTCCCCACACCGGGG - Intergenic
1032471502 7:132182368-132182390 GGTCATTACTGCCCTCCCCTTGG - Intronic
1033045798 7:137961427-137961449 AGTTGTTGCTCCCCACACCCAGG + Intronic
1034541469 7:151761123-151761145 GGTCATTCCTGGGCACACACAGG + Intronic
1035337315 7:158138261-158138283 CGCCATGGGTGCCCACACCCAGG - Intronic
1037706959 8:21323380-21323402 GGACATTGCTGGCCACACCTAGG + Intergenic
1037833884 8:22204988-22205010 GCTCATTGCTGCCCACGCGTGGG - Intronic
1037931366 8:22882327-22882349 AGACAGTGCTGGCCACACCCAGG + Intronic
1040946872 8:52893631-52893653 GGTCATTGCCTCCCACCTCCTGG + Intergenic
1040954471 8:52965495-52965517 GGCCATGGCCGCCCAGACCCAGG + Intergenic
1041661530 8:60406069-60406091 GGTCAGTGCTGACTCCACCCTGG + Intergenic
1048252550 8:132878734-132878756 TTTCCTTGCTGCCCACACCTTGG + Intronic
1049020356 8:139952743-139952765 TGTCACTGCTGCCACCACCCTGG - Intronic
1049184085 8:141239902-141239924 GGTCATTGCCCTCCACTCCCTGG - Intronic
1049592417 8:143468680-143468702 GGTCATAGCAGGCCACAGCCTGG + Intronic
1049641313 8:143717288-143717310 GGTCTCTTCTGCCCCCACCCTGG - Intronic
1049694413 8:143976494-143976516 GGCCTTTCCTGCCCACACCCCGG + Intronic
1051294071 9:15576247-15576269 GATCATTGCTCCCTACAGCCTGG + Intronic
1053262005 9:36675209-36675231 GCTCATTGCAGCCTCCACCCAGG - Intronic
1053308427 9:37000229-37000251 GGCCATTGCTGCCCACCCCTGGG + Intronic
1057090905 9:92257424-92257446 GGTCAAAGCTCCCCACAGCCAGG - Intronic
1057529409 9:95831073-95831095 AGTCATTGCTGCTGACACACAGG + Intergenic
1058914968 9:109556905-109556927 GGTCATTGCAGCCTGCAGCCTGG + Intergenic
1059096143 9:111416865-111416887 GGTCATTACTGCCAATATCCTGG + Intronic
1060277110 9:122190831-122190853 GGGCATTGCTGCCCTCACTGTGG + Intronic
1061161740 9:128899347-128899369 GGGCATTTCTGACCACACCCAGG + Intronic
1061388626 9:130304941-130304963 TGGCATTGCTGGCCACACACTGG - Intronic
1062415036 9:136444356-136444378 GGTCACTGCTGCACCCGCCCCGG + Intronic
1203399575 Un_KI270519v1:73586-73608 AGTCATTGCTGCTGATACCCAGG + Intergenic
1185788263 X:2908820-2908842 GGTGATTGATGGCCACAGCCTGG - Exonic
1185855215 X:3527994-3528016 GTTCAGTGCTGAACACACCCTGG + Intergenic
1189656660 X:43251541-43251563 GGACACTGCTTCCCACATCCTGG - Intergenic
1190056053 X:47181625-47181647 GGGCACTGCTGCCAACAGCCAGG + Exonic
1190620739 X:52284765-52284787 GTTCATTGGTGCCCAAAGCCTGG + Intergenic
1192393368 X:70753819-70753841 GGACATTTCTGCACAAACCCTGG + Intronic
1192510690 X:71718997-71719019 GGACACCGCTGCCCTCACCCCGG - Intergenic
1192516007 X:71762556-71762578 GGACACCGCTGCCCTCACCCCGG + Intergenic
1194765241 X:97841853-97841875 GGACATTGGTGCCAAAACCCGGG + Intergenic
1194783875 X:98058099-98058121 TGACATTTCTGCACACACCCTGG - Intergenic
1194856214 X:98932729-98932751 GGACAATGCTCCCCACATCCTGG + Intergenic
1197042065 X:121949031-121949053 GGACACTGCTCCCCACATCCTGG - Intergenic
1197144786 X:123159476-123159498 TGTGATTGCTGCACACACCCAGG - Intergenic