ID: 1129332938

View in Genome Browser
Species Human (GRCh38)
Location 15:74837058-74837080
Sequence CAGAGTAACCTGAGGGAGGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 258}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129332923_1129332938 28 Left 1129332923 15:74837007-74837029 CCTGCCCTCCCCTCCAGTATACA 0: 1
1: 0
2: 0
3: 24
4: 239
Right 1129332938 15:74837058-74837080 CAGAGTAACCTGAGGGAGGCTGG 0: 1
1: 0
2: 1
3: 38
4: 258
1129332928_1129332938 18 Left 1129332928 15:74837017-74837039 CCTCCAGTATACAGCACAGCCAT 0: 1
1: 0
2: 3
3: 18
4: 221
Right 1129332938 15:74837058-74837080 CAGAGTAACCTGAGGGAGGCTGG 0: 1
1: 0
2: 1
3: 38
4: 258
1129332933_1129332938 -1 Left 1129332933 15:74837036-74837058 CCATCAAACCATCTGTGGGGTGC 0: 1
1: 0
2: 2
3: 3
4: 78
Right 1129332938 15:74837058-74837080 CAGAGTAACCTGAGGGAGGCTGG 0: 1
1: 0
2: 1
3: 38
4: 258
1129332927_1129332938 19 Left 1129332927 15:74837016-74837038 CCCTCCAGTATACAGCACAGCCA 0: 1
1: 1
2: 0
3: 25
4: 173
Right 1129332938 15:74837058-74837080 CAGAGTAACCTGAGGGAGGCTGG 0: 1
1: 0
2: 1
3: 38
4: 258
1129332924_1129332938 24 Left 1129332924 15:74837011-74837033 CCCTCCCCTCCAGTATACAGCAC 0: 1
1: 0
2: 0
3: 15
4: 171
Right 1129332938 15:74837058-74837080 CAGAGTAACCTGAGGGAGGCTGG 0: 1
1: 0
2: 1
3: 38
4: 258
1129332926_1129332938 20 Left 1129332926 15:74837015-74837037 CCCCTCCAGTATACAGCACAGCC 0: 1
1: 0
2: 1
3: 12
4: 168
Right 1129332938 15:74837058-74837080 CAGAGTAACCTGAGGGAGGCTGG 0: 1
1: 0
2: 1
3: 38
4: 258
1129332929_1129332938 15 Left 1129332929 15:74837020-74837042 CCAGTATACAGCACAGCCATCAA 0: 1
1: 0
2: 0
3: 11
4: 118
Right 1129332938 15:74837058-74837080 CAGAGTAACCTGAGGGAGGCTGG 0: 1
1: 0
2: 1
3: 38
4: 258
1129332934_1129332938 -9 Left 1129332934 15:74837044-74837066 CCATCTGTGGGGTGCAGAGTAAC 0: 1
1: 0
2: 0
3: 7
4: 122
Right 1129332938 15:74837058-74837080 CAGAGTAACCTGAGGGAGGCTGG 0: 1
1: 0
2: 1
3: 38
4: 258
1129332925_1129332938 23 Left 1129332925 15:74837012-74837034 CCTCCCCTCCAGTATACAGCACA 0: 1
1: 0
2: 1
3: 8
4: 206
Right 1129332938 15:74837058-74837080 CAGAGTAACCTGAGGGAGGCTGG 0: 1
1: 0
2: 1
3: 38
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129332938 Original CRISPR CAGAGTAACCTGAGGGAGGC TGG Exonic
900482592 1:2906404-2906426 CAGAGGCCCCTGAGGGATGCTGG - Intergenic
900484433 1:2914719-2914741 CAGAGCAGGATGAGGGAGGCTGG + Intergenic
901948936 1:12726043-12726065 CAGAGAGCCCTGTGGGAGGCTGG - Exonic
901964979 1:12859194-12859216 CAGCGATACCAGAGGGAGGCAGG - Exonic
902393190 1:16118207-16118229 GATAGGAGCCTGAGGGAGGCAGG + Intergenic
903336420 1:22627490-22627512 CAGAGTCACCTGGGGGAGCTGGG - Intergenic
903807073 1:26013145-26013167 GAAACTAACTTGAGGGAGGCTGG + Intergenic
904603511 1:31686260-31686282 CAGGGTAACTTCGGGGAGGCAGG - Exonic
905940238 1:41857240-41857262 CAGAGTAAACAGAGAGAAGCCGG - Intronic
906212525 1:44019988-44020010 GAGAGGAAGCTGAGGAAGGCTGG + Intronic
906291039 1:44619318-44619340 CAAAGAAGCCAGAGGGAGGCTGG + Intronic
906514765 1:46432380-46432402 CACAGTTACCTCAGGGTGGCAGG + Intergenic
906722116 1:48015831-48015853 GAGAGTCACCGGAGGGAGGCTGG - Intergenic
909576381 1:77181251-77181273 CAGAGGAATTTCAGGGAGGCAGG - Intronic
911144377 1:94538583-94538605 CAGAGCCACCTGAGGGATGGTGG + Intronic
912186046 1:107276980-107277002 AAGAGGAAGCTGGGGGAGGCTGG + Intronic
912972671 1:114298730-114298752 CAGAGAAACCAAAAGGAGGCTGG - Intergenic
914456413 1:147841146-147841168 CAGGGAACCCAGAGGGAGGCGGG - Intergenic
914799774 1:150952222-150952244 CAGAGTAATCTGAAAAAGGCAGG - Intronic
915597308 1:156902909-156902931 CAGGGCAGTCTGAGGGAGGCGGG + Intronic
916383936 1:164245864-164245886 CAGAGTAACTTGGGAGAGGAGGG + Intergenic
916873466 1:168942244-168942266 GAGGCTAATCTGAGGGAGGCTGG - Intergenic
916949367 1:169763321-169763343 CACAGTAACCTGATGGAACCTGG + Intronic
917337300 1:173938772-173938794 CAGAGGACCCTGAGGGAGGAGGG - Exonic
917745958 1:178007403-178007425 CAGAGCAAAATGAGGGAGGCAGG + Intergenic
920022504 1:202966794-202966816 GAGAGTGACCTGAGGCCGGCGGG + Exonic
921360841 1:214329840-214329862 CAGAGGCAGCTGAGGGAGGCAGG + Intronic
923201551 1:231717471-231717493 CAGAGTCAGCAGAGGGAGGCGGG - Intronic
923445739 1:234069670-234069692 CTGAGGACCCTGGGGGAGGCTGG - Intronic
924466830 1:244305781-244305803 TAGGGTAACCTGAAGGGGGCTGG - Intergenic
924709066 1:246519346-246519368 CAGAGGACCCTGGGGGAGGTGGG - Intergenic
1063883551 10:10554601-10554623 CAGGGTCACCACAGGGAGGCTGG - Intergenic
1064121860 10:12625687-12625709 CAGATTTCCCTGAGGGTGGCTGG - Intronic
1064559149 10:16578675-16578697 CAGAATAACATGGAGGAGGCAGG - Intergenic
1066745296 10:38601359-38601381 CAGAGTATCTTGGGGGAGGCAGG + Intergenic
1067257723 10:44660775-44660797 GAAATTAACCAGAGGGAGGCGGG + Intergenic
1067748197 10:48952348-48952370 CACTGTAATCAGAGGGAGGCTGG - Intronic
1069491307 10:68863347-68863369 CCGAAGAACCTGAGGAAGGCGGG - Intronic
1069984779 10:72275572-72275594 CAGAGCAGCCGGAGGGAGGGGGG + Exonic
1070799557 10:79237191-79237213 CAGAGTAAGCCGAGGGGGACTGG + Intronic
1071849939 10:89558467-89558489 CGCAGCAACCTGAAGGAGGCAGG + Intergenic
1072913346 10:99522338-99522360 CAGAGTAACCGGGGTGAGCCCGG + Intergenic
1073183830 10:101603195-101603217 CAGAGAGACCTGAGGAGGGCAGG - Intronic
1073190390 10:101646682-101646704 CACAGTAACCCAAAGGAGGCTGG + Intronic
1073299645 10:102463101-102463123 CTGAGCAAGCTGAGGGAGCCTGG + Intronic
1073750104 10:106515631-106515653 CTGAGTAGCCTGAGGAATGCTGG - Intergenic
1074438278 10:113453008-113453030 GAGAGTCAGCTGAGGGAGGAAGG - Intergenic
1076568227 10:131413209-131413231 CAGAGTCAGCTGGTGGAGGCTGG + Intergenic
1078493211 11:11788522-11788544 CAGAGTAACCTAAGTGAAGCAGG - Intergenic
1080154932 11:29098625-29098647 CTGAGCAACCTGAAGGAAGCTGG - Intergenic
1080628211 11:34050707-34050729 CAGTGCATCCTGAGGGAGCCTGG - Intergenic
1081920394 11:46769954-46769976 TAGAGTTACCTGATGCAGGCTGG + Exonic
1082649831 11:55776128-55776150 CAGGGTAAACAGAGGGAAGCAGG + Intergenic
1083693556 11:64427081-64427103 GAGAATAACCTGAGTGTGGCAGG + Intergenic
1083949438 11:65945929-65945951 CAGATGAAACTCAGGGAGGCAGG + Intronic
1084189457 11:67492367-67492389 CAGAGGCACCTGAGGCAGGCTGG + Intronic
1084193875 11:67512321-67512343 CAGAGTTCCGTGAGGGAGGTGGG + Intergenic
1084582468 11:70032510-70032532 GAGAGTGAGCAGAGGGAGGCGGG + Intergenic
1084662523 11:70554551-70554573 CAGAGGAACCTGGGGGAGGGGGG - Intronic
1085953300 11:81359377-81359399 CAGAGCAGCCTGAGGGCTGCTGG + Intergenic
1088889547 11:114033736-114033758 CAGAGTAACCTGAAGGACTCAGG - Intergenic
1090247694 11:125228526-125228548 CGGAGTCACCTGGGGGAGGGAGG + Intronic
1090763592 11:129857660-129857682 CATAGTAACCTGAGGGACCCAGG + Intronic
1091415372 12:278267-278289 CAGAGTAAACTGACAGAGGGGGG + Intergenic
1091534362 12:1391591-1391613 CAGGGAAAGCCGAGGGAGGCAGG - Intronic
1092871844 12:12812576-12812598 CAGAGTAACCTGGGGAGGGTGGG - Intronic
1093057023 12:14566157-14566179 CAGAGGTACCTGGGGGAGGCTGG - Intronic
1095552956 12:43466076-43466098 CAGAGAAACCTGAAGGAAGGTGG + Intronic
1095862226 12:46930172-46930194 CTCTGTAACTTGAGGGAGGCAGG + Intergenic
1095870186 12:47018334-47018356 CAGAGAAACCTGAGCCAGGTGGG - Intergenic
1095909241 12:47409040-47409062 CAGATAAGCCTGAGAGAGGCAGG - Intergenic
1096396946 12:51273283-51273305 AAAAGTAACCTTAGGGAGGGAGG + Intergenic
1096975793 12:55698671-55698693 CCGTGCCACCTGAGGGAGGCTGG - Intronic
1096981247 12:55729095-55729117 CCGCGTCACATGAGGGAGGCCGG - Intronic
1097718948 12:62999656-62999678 CAGTGGAACCTGATGGGGGCAGG + Intergenic
1101436256 12:104667326-104667348 CACAGTGAGCTGAGTGAGGCTGG - Intronic
1101984327 12:109433791-109433813 CAGCACATCCTGAGGGAGGCAGG + Intronic
1103405582 12:120672731-120672753 CAAAGAAACCCAAGGGAGGCTGG + Intergenic
1103477877 12:121232111-121232133 CAGGGTCCCTTGAGGGAGGCAGG + Intronic
1104030589 12:125063318-125063340 CAGAGCACCCTGAGGGGTGCTGG + Intergenic
1106495768 13:30272980-30273002 CAGAGTCACAGTAGGGAGGCAGG - Intronic
1106782572 13:33074375-33074397 CAGGGTCACCTGGGAGAGGCTGG - Intergenic
1106909870 13:34452198-34452220 TAGAGTATCATGAGGCAGGCAGG + Intergenic
1108590065 13:51905448-51905470 CAGAGCAACCCAAGGGAAGCCGG + Intergenic
1110046747 13:70841697-70841719 CAGAGCAGCCTGAGGGCTGCTGG - Intergenic
1110097785 13:71552008-71552030 AGGACTAATCTGAGGGAGGCAGG - Intronic
1112718768 13:102217858-102217880 CAGAGTAAGCTGAGAAAGCCCGG + Intronic
1113365155 13:109669034-109669056 GAGAGGAGCCTGAGGGAGGAAGG + Intergenic
1113793114 13:113041195-113041217 CAGAGTCACCAGAGGGATGAAGG - Intronic
1115441689 14:33443088-33443110 CAGTGTTAACTGAGGGAAGCTGG - Intronic
1115648031 14:35383886-35383908 AAGGGTAAACTGAGGGAGGGAGG + Intergenic
1116961352 14:50971486-50971508 ATGAGTAATTTGAGGGAGGCTGG + Intergenic
1121730803 14:96185717-96185739 CAGAGTGACCTTGGGGAGGCGGG + Intergenic
1122672411 14:103382871-103382893 CAGAGTTAGCTGTGGGAGGATGG - Intergenic
1123008484 14:105335785-105335807 CAGAGAAAGCTGAGTGAGGCTGG + Intronic
1127754822 15:62081884-62081906 CAGAGTAAGATGATGGAGACTGG + Intergenic
1127886649 15:63207385-63207407 CAGAGGAGTCTGAGAGAGGCCGG - Intronic
1129332938 15:74837058-74837080 CAGAGTAACCTGAGGGAGGCTGG + Exonic
1130103168 15:80909314-80909336 CAGAGTTCCCTGAGGGAAGGAGG - Intronic
1130282752 15:82532225-82532247 GAGAGGACCCTGGGGGAGGCAGG + Intergenic
1130342657 15:83012315-83012337 TAGAGTAACCGCAGGGAGGGTGG + Intergenic
1131646635 15:94351983-94352005 CAGAGGAAACTGAGGAAGGATGG - Intronic
1132010445 15:98270999-98271021 CAGAATAGCAGGAGGGAGGCAGG + Intergenic
1132038864 15:98507873-98507895 CTGAGTAAGCTCAGGCAGGCTGG + Intronic
1132116181 15:99138046-99138068 CAGGGTGTCCTGAGGGATGCTGG + Exonic
1132321439 15:100928444-100928466 CAGTGTTCCCTGAGTGAGGCTGG - Intronic
1133424652 16:5677504-5677526 CAAAGCAACATGAGGGAGGCAGG - Intergenic
1133853202 16:9525306-9525328 CACAGCAACCTGAGGGAGGAAGG - Intergenic
1134297940 16:12963119-12963141 CAGAGGTGCCTGAGGGAAGCAGG + Intronic
1134444632 16:14321549-14321571 CAGAAGGCCCTGAGGGAGGCAGG + Intergenic
1136737771 16:32478290-32478312 CAGAGTATCTTGGGGGAGGCAGG - Intergenic
1137396363 16:48118276-48118298 CAGAGAAAACCGAGGGAGGAGGG - Intronic
1137531956 16:49283394-49283416 GAGCGTACCCTGGGGGAGGCCGG - Intergenic
1137948179 16:52755975-52755997 CAGAGTAACCAGGAGGAGCCAGG + Intergenic
1138052224 16:53791313-53791335 CACAGTAACCTTAAGTAGGCAGG + Intronic
1138364867 16:56466809-56466831 AAGAGTAAAATGAGGCAGGCTGG + Intronic
1140281310 16:73557468-73557490 CAGAGCAGCCTGAGGGCTGCTGG + Intergenic
1142253200 16:89002212-89002234 CAGAGCAGCCGGAGGGACGCAGG + Intergenic
1142253238 16:89002320-89002342 CAGAGGAGCCGGAGGGACGCAGG + Intergenic
1142253413 16:89002814-89002836 CAGAGGAGCCGGAGGGACGCAGG + Intergenic
1142253484 16:89003013-89003035 CAGAGGAGCCGGAGGGACGCAGG + Intergenic
1142253511 16:89003087-89003109 CAGAGGAGCCGGAGGGACGCAGG + Intergenic
1203015302 16_KI270728v1_random:351287-351309 CAGAGTATCTTGGGGGAGGCAGG + Intergenic
1203033637 16_KI270728v1_random:624445-624467 CAGAGTATCTTGGGGGAGGCAGG + Intergenic
1142707206 17:1703197-1703219 CAGTGAAACTTGAGGAAGGCAGG - Exonic
1143563133 17:7706845-7706867 CAGAGAAGTGTGAGGGAGGCTGG - Intronic
1143563554 17:7708761-7708783 CAGAGGAAGCTGGGGAAGGCAGG - Intronic
1145104306 17:20102538-20102560 CAGAGTCAGCTGAGTGTGGCTGG + Intronic
1147160195 17:38565033-38565055 CAGAGGCTCCTGGGGGAGGCTGG - Intronic
1148892642 17:50819287-50819309 CAAAGTAACGTGTGGGAGGCTGG + Intergenic
1149865214 17:60147835-60147857 CAGAGTAAGAGGAAGGAGGCTGG + Intergenic
1149867170 17:60157373-60157395 TAGAGGAGGCTGAGGGAGGCTGG + Intronic
1150135268 17:62691962-62691984 CACAGTAACCAGAGGTAGGATGG + Intronic
1151476928 17:74349385-74349407 CAGAGCAACGTGAGGCTGGCCGG - Intronic
1151686220 17:75648269-75648291 AAGATTTACCTGAGGGAGTCAGG - Intronic
1152147843 17:78579805-78579827 CAGAGCAGCCTGAGGGCTGCTGG - Intergenic
1152736520 17:82000008-82000030 CAGAGTTCCCAGAGGGAGGATGG - Intronic
1153025550 18:669242-669264 CAGAGGCACCTGAGGGAGGCAGG + Intronic
1154269121 18:12904233-12904255 CAGAGGAGCCTGAGGGCTGCTGG - Intronic
1156269407 18:35517242-35517264 CAGACTGACCTGAGGTAGCCAGG + Intergenic
1157872248 18:51241315-51241337 GGGAGTAACCTGCGGGAGGCTGG + Intergenic
1160418684 18:78729225-78729247 CTGAGTAACATGGGGGCGGCAGG + Intergenic
1160825685 19:1079625-1079647 GACAGAAACCTCAGGGAGGCGGG - Intronic
1161120589 19:2523659-2523681 CTGTGGAACCTGAGTGAGGCTGG + Intronic
1161237499 19:3205135-3205157 CACAGTGCCCAGAGGGAGGCGGG - Intronic
1161977747 19:7615655-7615677 CACAGCAACCCGAGCGAGGCCGG - Exonic
1162149090 19:8632197-8632219 TAGAGGAGCCAGAGGGAGGCAGG + Intergenic
1162705522 19:12551916-12551938 CAGTGTAACAGGAGGGAGGAGGG + Intronic
1163146945 19:15386529-15386551 CACACTAAGCTGGGGGAGGCAGG - Intronic
1163632166 19:18423081-18423103 CAGAGTGGGCTGAGGGAGGCTGG + Intronic
1166040096 19:40197095-40197117 GAGGGTAAACTGATGGAGGCTGG + Intronic
1167190129 19:47981655-47981677 CAGAGTAAACTGAGGGCAGATGG - Intronic
925641126 2:5986714-5986736 CAGAGGAACCTGGGCCAGGCTGG - Intergenic
927464746 2:23328747-23328769 CAGTGAAACCAGAGGGAGGCAGG - Intergenic
927495847 2:23551182-23551204 CAGCGTAAACTGAGGGAAGAAGG - Intronic
934188893 2:89767403-89767425 CAGATTATCTTGGGGGAGGCAGG - Intergenic
934307698 2:91840550-91840572 CAGAGTATCTTGGGGGAGGCAGG + Intergenic
935997909 2:108793896-108793918 AAGAGTTTCCTGAGGGTGGCAGG - Intronic
937987169 2:127643064-127643086 CAGAGATGCCTGCGGGAGGCGGG + Exonic
940285721 2:152031525-152031547 CAGCACAACCTGAGGGAGGAAGG + Intronic
940834066 2:158500912-158500934 CAGAGTAAAAGCAGGGAGGCTGG - Intronic
944587468 2:201185344-201185366 CAAAGCAATCTGGGGGAGGCAGG - Intronic
945653298 2:212591842-212591864 CAGGGTACCTTGAGGGAGGAGGG - Intergenic
946153760 2:217793770-217793792 CAGAATCCCCTGAGGGAGGGAGG + Intergenic
947541856 2:230985396-230985418 CAGGGTAACCTGTGCAAGGCTGG + Intergenic
947742567 2:232491287-232491309 CAGAGTAACCAGAGGAAAGAGGG - Intergenic
948303929 2:236932654-236932676 GATAGTAGCCTGAGGGAGGGGGG + Intergenic
1170787778 20:19482327-19482349 CAGAGAAGCCTGGGGGAGGGAGG - Intronic
1172420798 20:34815798-34815820 CATAGGAAAATGAGGGAGGCTGG + Intronic
1172626338 20:36349602-36349624 CAGAGAAACAGGAAGGAGGCCGG + Intronic
1172643366 20:36455147-36455169 CAGAGTAAGAGGAGGGAGGGAGG - Intronic
1173361933 20:42352354-42352376 TAGAGGAACCTTAGGGAGGCGGG + Intronic
1173545491 20:43894685-43894707 GGGAGTGAGCTGAGGGAGGCTGG - Intergenic
1176097906 20:63352768-63352790 CAGAGGACCCTGGGGGAGGGGGG - Intronic
1178710411 21:34911748-34911770 CAGAGCAAGCCGAGGGAGACAGG - Intronic
1178788689 21:35677812-35677834 CAGAGTCCCCTGAGGGAGTGAGG + Intronic
1179232324 21:39516017-39516039 TACAGTAAACTGAGGCAGGCAGG - Intergenic
1179401776 21:41090975-41090997 CAGTACAACCTGTGGGAGGCAGG + Intergenic
1180534778 22:16387632-16387654 CAGAGTGTCCTGGGGGAGGCAGG + Intergenic
1180706818 22:17815329-17815351 CACAGCAACGTGAGGGAGGTGGG + Intronic
1181024542 22:20120552-20120574 CAGAGTCGTCTGAGAGAGGCAGG + Intronic
1181694276 22:24585174-24585196 CACTGTACCCTGTGGGAGGCAGG + Intronic
1181696528 22:24595422-24595444 CAGGGTAACCCCAGGGAGACGGG - Intronic
1181915158 22:26273933-26273955 CAGAGTCACCTGAGAGAGCAGGG + Intronic
1184003798 22:41694334-41694356 AATAGAAACCAGAGGGAGGCTGG + Exonic
949985437 3:9537179-9537201 CAGAGGAAATGGAGGGAGGCTGG - Intronic
950150341 3:10681979-10682001 CAGAGATACCTGAGGCAGTCAGG + Intronic
950446017 3:13039109-13039131 CAAAGTACCCTGAGGTCGGCTGG + Intronic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
952354195 3:32570132-32570154 AGGAGGAACCTGAGGGAGGGCGG + Intronic
952388572 3:32860677-32860699 GGGAGTAACCTGAGGAAGGTGGG - Intronic
952729968 3:36628423-36628445 CAGAGTTACCTGGGGGACACTGG + Intergenic
952887530 3:38020760-38020782 CAGAGTGAACTGAAGGAAGCTGG + Intronic
953196823 3:40742210-40742232 CAGAGTGTCCTGAGAGGGGCTGG - Intergenic
953907858 3:46877304-46877326 CAGAGAAATCAGAGGGGGGCTGG - Intronic
954149816 3:48651791-48651813 CTGGGGAACCTGAAGGAGGCAGG - Intronic
955286634 3:57647817-57647839 CAGAGTAACCTGAATGAGACAGG + Intronic
955286833 3:57649830-57649852 TAGAGTAACCTGAATGAGACAGG - Intronic
956618096 3:71193075-71193097 CAGAGGAACCTGAGAGAATCAGG - Intronic
958140761 3:89559491-89559513 CAGAGTCACCTGAGGAATGCAGG - Intergenic
961017918 3:123481772-123481794 CAGAGAGGGCTGAGGGAGGCAGG + Intergenic
961022612 3:123521654-123521676 CAGAGTCACCACAGGGAGGAGGG + Intronic
961682492 3:128608399-128608421 CCGAGGAAACTGAGGCAGGCAGG + Intergenic
963399667 3:144781935-144781957 CAGAGAGACCTGAGGGAGAGTGG + Intergenic
968728051 4:2257311-2257333 AAGAGTCCCCTGAGGGATGCTGG - Intronic
969576556 4:8039346-8039368 CAGGGAAGCCTGAGGAAGGCTGG - Intronic
970191896 4:13525269-13525291 CAGAGTAGCCTCAGAGAGGGAGG + Intergenic
971452409 4:26812288-26812310 CAGAGGAAGCTGAGGAAGGAAGG - Intergenic
972323949 4:37997817-37997839 CAGAGTAGACTGAGGGTGGATGG + Intronic
974499247 4:62677506-62677528 GAGAGAAACAAGAGGGAGGCTGG - Intergenic
975098317 4:70483264-70483286 CAGAGTAAAGTGAGGGAGATGGG - Intergenic
975872014 4:78789696-78789718 CAGACTAACCTGGGAGAAGCTGG - Intronic
976456025 4:85247568-85247590 CAGAGCAAAATGAGGGAGGCAGG - Intergenic
977050628 4:92125073-92125095 CAGAAAAACCTGTGGTAGGCTGG - Intergenic
977507040 4:97915667-97915689 CAGAGCAAAATGACGGAGGCAGG + Intronic
977547858 4:98406362-98406384 CAGTGAAACCTAAGGAAGGCTGG + Intronic
979342404 4:119541845-119541867 CAGAGTCACCTGGGGGAGCTTGG + Intronic
983639670 4:169933409-169933431 TAGAGTGACCTGGGGGAGGATGG + Intergenic
983699270 4:170571336-170571358 CAAAATTACCTGAGGTAGGCAGG - Intergenic
985896368 5:2751820-2751842 CAGAGAGACGGGAGGGAGGCGGG + Intergenic
986192352 5:5509286-5509308 CAGAGTGAACTGAGGTAGGAGGG + Intergenic
986485268 5:8229705-8229727 CAGAGTGTCCTGAGCCAGGCTGG + Intergenic
986560873 5:9059966-9059988 GAGAGTATCCTGAGTGAGACAGG + Intronic
986884534 5:12216862-12216884 CCCAGTTACCTCAGGGAGGCAGG + Intergenic
987115913 5:14726553-14726575 AAGAGTGACGGGAGGGAGGCTGG + Intronic
989408269 5:41086725-41086747 AAGAGAAACCAGAAGGAGGCTGG - Intergenic
989534714 5:42550374-42550396 CAGGGGAACCTTGGGGAGGCAGG - Intronic
993498709 5:88639236-88639258 CTGAGTAACTTGGGGAAGGCAGG + Intergenic
993687821 5:90961563-90961585 CGTAGTAAACTGAGGGAGGAGGG + Intronic
997529872 5:134575418-134575440 CAGAGAAACTGGAAGGAGGCTGG + Intronic
1002446028 5:179290692-179290714 CAGAGAGCACTGAGGGAGGCTGG - Intronic
1003081354 6:3024139-3024161 CAGAGTTGCCGGAGGGAGGGTGG - Intergenic
1005129777 6:22492734-22492756 AAGAGTAACATGAGGCAGTCCGG - Intergenic
1005450907 6:25971324-25971346 CAGAGTCATGTGTGGGAGGCAGG - Intronic
1005492684 6:26361094-26361116 TAGAGAAGCCTGAGGGAAGCTGG - Intergenic
1005783216 6:29215715-29215737 AAGGGTAACCGGAGGGTGGCAGG - Intergenic
1006360535 6:33584693-33584715 CACAGTCAGGTGAGGGAGGCAGG - Intergenic
1006828714 6:36955919-36955941 CCCAGTCACCTGAGGGTGGCTGG - Intronic
1007956125 6:45919363-45919385 CAGAGTAACCATGGGGATGCTGG + Intronic
1008559526 6:52710130-52710152 CAGAGCACCCTGAGGGCTGCTGG - Intergenic
1008559650 6:52711548-52711570 CAGAGCAACCTGAGGGCTGCTGG + Intergenic
1009240403 6:61179469-61179491 CAGAGTCACCTGGTGGAAGCTGG + Intergenic
1009442639 6:63699883-63699905 GAAAGAAACCTGAGGGAGGCCGG - Intronic
1013313766 6:108922077-108922099 CAGAGTACTCTGATGGAGGAAGG + Intronic
1013858212 6:114601588-114601610 CAAGGTAAATTGAGGGAGGCAGG + Intergenic
1015190603 6:130467816-130467838 CAGAGTGAGCAGAGGGAGGGAGG - Intergenic
1016356733 6:143226800-143226822 CAGAGTTCCCTGAGAGAGGATGG - Intronic
1019759231 7:2797056-2797078 CAGAGCAATCTGAGGGACTCAGG + Intronic
1019791324 7:3015716-3015738 CAGAGTTACCTGATGCAGCCAGG - Intronic
1019835755 7:3381504-3381526 GGGAGTGACCTGAGGGAGACTGG + Intronic
1021275658 7:18647885-18647907 TAAAGTAACATGAGGGTGGCTGG - Exonic
1021298577 7:18941184-18941206 AAGAATAACGGGAGGGAGGCAGG - Intronic
1022025447 7:26444021-26444043 CAGAGCCACATGAGGGACGCTGG + Intergenic
1022505676 7:30907583-30907605 CAGAGAACCCTGATGGAGGGTGG - Intergenic
1023485940 7:40686956-40686978 TGGAGTAACCTGAGGAAGGTGGG - Intronic
1024793361 7:52992732-52992754 GAGAGTGTCCTGAGGGAGGTAGG + Intergenic
1028774191 7:94658635-94658657 CAGAGAAACCGCAGGGGGGCGGG - Intronic
1028876302 7:95827110-95827132 CAGAGTAAACAAAGGGATGCAGG + Intronic
1030106864 7:105994917-105994939 CAGTGCAACCTGAGGGCAGCTGG + Intronic
1031682521 7:124692074-124692096 CAGTGTAACCTCAATGAGGCAGG - Intergenic
1034072283 7:148198105-148198127 CTGAGAAGCCTGAGGGTGGCTGG + Intronic
1034116683 7:148589729-148589751 CAGAGTAATCTTAGGGATTCTGG + Intergenic
1034275977 7:149824046-149824068 CAGGGTAGACTAAGGGAGGCAGG - Intergenic
1038020747 8:23550337-23550359 CAGAGAAACGTGAAGGAGGGCGG - Intronic
1038499932 8:28035430-28035452 CATAGTCATCTGAGTGAGGCTGG + Intronic
1042927889 8:73985173-73985195 CAGAGTAATCTCAGGAAGACTGG + Intergenic
1046353506 8:113047093-113047115 CTGAGTGGTCTGAGGGAGGCTGG + Intronic
1046808635 8:118507885-118507907 CCCAGTACCCTGAGGGAGGGTGG + Intronic
1047990107 8:130277174-130277196 CACGGTAACCTGAGTGAGACTGG + Intronic
1049565322 8:143335039-143335061 CAGGGAAACCAGGGGGAGGCCGG - Intronic
1049657876 8:143806746-143806768 AAGAGCAACCTGAGGGTGCCTGG - Intronic
1049738674 8:144223522-144223544 CTGAGAAACCAGAGGGAGCCAGG - Intronic
1050119862 9:2297154-2297176 CAGAGTGACTGGAGTGAGGCTGG + Intergenic
1052521574 9:29554431-29554453 CAGAGCAGCCTGAGGGCTGCTGG - Intergenic
1053054264 9:34984906-34984928 CAGAGTCAGAGGAGGGAGGCAGG + Intergenic
1055001392 9:71453512-71453534 CAGAGGAATCCGAGGGAAGCTGG - Intergenic
1056393891 9:86164052-86164074 CAGAGCAACCTGAGGGCTGCTGG + Intergenic
1056625358 9:88248699-88248721 AAGAGTAACTTGGGGAAGGCAGG + Intergenic
1057088526 9:92234635-92234657 CAGGGTAACCTGAGACAGCCAGG + Intronic
1057179670 9:93022983-93023005 CAGATTAAACGGAGGGAGGCAGG - Intronic
1057604506 9:96489418-96489440 CAGTGTGACCTGATGGGGGCGGG - Intronic
1058355025 9:104074244-104074266 CAGAGCAACCTCAGGGTAGCTGG - Intergenic
1061045158 9:128160779-128160801 CCGAGGCACCTGAGGGAGGCAGG + Intronic
1061211813 9:129198084-129198106 CAGACGACCCTGAGGGAGGCAGG + Intergenic
1061516756 9:131094625-131094647 CTGAGAAACTGGAGGGAGGCGGG - Intergenic
1061620215 9:131807120-131807142 CAGAGTAGCCTGAGGGGGAGAGG + Intergenic
1061628602 9:131857064-131857086 GAGATGAACCTGAGGGAGGCCGG - Intergenic
1062261473 9:135665190-135665212 CACAGGACCCTGAGGGTGGCGGG + Intronic
1062523265 9:136968373-136968395 TGGAGGGACCTGAGGGAGGCTGG + Intergenic
1189089881 X:38070509-38070531 GAGAGAAACCAGAGGTAGGCAGG - Intronic
1190654069 X:52595912-52595934 CACTGTAAACTGAGGGAGGCTGG + Intergenic
1193798302 X:85904170-85904192 CACATAAACCTGAGGAAGGCAGG + Intronic
1195473548 X:105260057-105260079 CAAAGTCACCTGAAGGAGGTGGG + Intronic
1195640426 X:107168862-107168884 CTGACTACTCTGAGGGAGGCTGG + Intronic
1200232046 X:154448993-154449015 CCACGGAACCTGAGGGAGGCTGG - Intronic
1200703258 Y:6420194-6420216 CAAAGTGACCTCAGGTAGGCTGG - Intergenic
1201030852 Y:9744513-9744535 CAAAGTGACCTCAGGTAGGCTGG + Intergenic
1201318160 Y:12668602-12668624 AAGACTAACCTGAGGGGGGCTGG - Intergenic