ID: 1129335187

View in Genome Browser
Species Human (GRCh38)
Location 15:74847841-74847863
Sequence TTCCCTCACCTCCCCTGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 289}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129335187_1129335191 5 Left 1129335187 15:74847841-74847863 CCTGTCCAGGGGAGGTGAGGGAA 0: 1
1: 0
2: 3
3: 30
4: 289
Right 1129335191 15:74847869-74847891 TCCTTAAGTTACAAGGCATCTGG 0: 1
1: 0
2: 0
3: 9
4: 94
1129335187_1129335189 -2 Left 1129335187 15:74847841-74847863 CCTGTCCAGGGGAGGTGAGGGAA 0: 1
1: 0
2: 3
3: 30
4: 289
Right 1129335189 15:74847862-74847884 AACCGTCTCCTTAAGTTACAAGG 0: 1
1: 0
2: 0
3: 1
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129335187 Original CRISPR TTCCCTCACCTCCCCTGGAC AGG (reversed) Intronic
900310097 1:2029395-2029417 TTCCCTGACCTGGCCTGGCCCGG - Intronic
901423343 1:9165355-9165377 TTCCCCCAGGTCCCCTAGACAGG - Intergenic
902437941 1:16410032-16410054 GTCCCTCACCTCCTGGGGACAGG + Exonic
902620268 1:17646744-17646766 GCCCCTCACCTCCCCAGGGCTGG - Intronic
902717694 1:18283663-18283685 TTCCCTCAACACCCCTGCCCTGG + Intronic
902737165 1:18408843-18408865 TGCCCTCGCCTGCCCTGGAGTGG - Intergenic
903742546 1:25566709-25566731 TTACTCCACCTCCCCTGCACCGG + Intronic
903779107 1:25810359-25810381 TTGCCTCACCTCCTCAGGGCTGG + Intronic
903951550 1:26998650-26998672 TTCCCCCATCGCCCCTGGCCAGG - Intronic
904470000 1:30730281-30730303 TGCCCTCACCTGCCCAGGCCTGG + Intergenic
905418289 1:37820032-37820054 TTCACTCAGCACCCCAGGACAGG + Intronic
905444399 1:38016200-38016222 TTCCCTCCCCTCCCCACAACTGG - Intronic
906117408 1:43366007-43366029 GTCCCTCACCTCCCCAGCTCTGG + Intronic
908123586 1:61008220-61008242 TTGCCACATCTCCCCTAGACAGG + Intronic
908907937 1:69037946-69037968 TTCCCTCACCTCTCCTGAAGAGG - Intergenic
912257383 1:108074371-108074393 TTCCCTCACCTCCTCTCCACAGG + Intergenic
912725566 1:112056466-112056488 TTCCCTCAGCTGCCCTGCAAAGG + Intergenic
912864674 1:113246626-113246648 TTCCCTCCCCTCTGCTGGAGTGG + Intergenic
912999371 1:114564319-114564341 TTCCCTCACTTCCCCAGAATAGG - Intergenic
914430734 1:147618961-147618983 CACCCCCACGTCCCCTGGACCGG + Exonic
917725139 1:177820961-177820983 GTCCCTCTCCACCTCTGGACAGG + Intergenic
919870501 1:201817218-201817240 TTGCCTCACCTCCCGAGGATAGG + Exonic
920252553 1:204631349-204631371 TCCCCTCACCTCCTCTGTCCTGG + Intronic
920384615 1:205561687-205561709 TCCCCTCCCCTCCCCTGTAGGGG - Intergenic
920570368 1:207011860-207011882 TTCCTTCTCCTCCCCTGACCTGG + Intronic
922533367 1:226361674-226361696 TTGCCTCATCTCCCCGGGGCTGG + Intronic
922597002 1:226821766-226821788 ATCCCTCACCTCTCCTAGATGGG + Intergenic
923262030 1:232276650-232276672 TGCCCTGATCTCCCCTGGATAGG - Intergenic
923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG + Intronic
1064153864 10:12887505-12887527 TCCCCTCCCCTCCCTTTGACAGG - Intergenic
1065514904 10:26515397-26515419 TTCCCTCACTTCATATGGACTGG - Intronic
1065963795 10:30754686-30754708 TTCCCTCACCTACCCTCCCCGGG + Intergenic
1067676002 10:48377590-48377612 TTTCCACCCCTCCCCTGGATTGG + Intronic
1067785566 10:49243009-49243031 TTCCTTCCCCTCCCCTTGCCAGG - Intergenic
1069833948 10:71296978-71297000 TTCCCTCACCTCCACCAGAGTGG - Intronic
1070319329 10:75343083-75343105 TTCCCAAGCCTCCCCTGGACAGG + Intergenic
1070722898 10:78769041-78769063 CTCCCTCACCACCCCTGGCTAGG + Intergenic
1070868684 10:79728169-79728191 TTTCCTCACCTCCTCTGGCCCGG - Intergenic
1071431399 10:85609695-85609717 TTGCCTGCCCTCCCCTGGCCCGG - Intronic
1071635597 10:87250384-87250406 TTTCCTCACCTCCTCTGGCCCGG - Intergenic
1071659642 10:87487590-87487612 TTTCCTCACCTCCTCTGGCCCGG + Intergenic
1072198744 10:93140021-93140043 TTCCCTCCCCACCCCTGCTCTGG + Intergenic
1074145243 10:110711362-110711384 TTCCCACACCTCCCCTCTCCTGG - Intronic
1074273393 10:111977284-111977306 TTGCCTCAGCACACCTGGACAGG - Intergenic
1074479569 10:113806986-113807008 TTCCCTCCCCTCCCCTGTGTGGG + Intergenic
1075538358 10:123290652-123290674 TTCCCTCATCTCCCTGGGCCTGG - Intergenic
1075570570 10:123538798-123538820 TTCACTGAGCTTCCCTGGACAGG + Intergenic
1075584881 10:123650537-123650559 TTCCCTCTCTTCTCCTGGATGGG + Intergenic
1076584297 10:131534860-131534882 TTCCCTGGCCTCACCTGGGCAGG + Intergenic
1076683931 10:132188171-132188193 TTGCCTGACCTCCCCTGGGAAGG - Intronic
1076726944 10:132418418-132418440 TTCCCTCATGTGCCCTGGAGAGG - Intergenic
1076762310 10:132611712-132611734 CTCCCTCACCCTCCCTGGACAGG - Intronic
1077076614 11:705218-705240 TTCCCACCCCTACCCAGGACCGG + Intronic
1077119105 11:898683-898705 CTCCCCCACCTGGCCTGGACTGG - Intronic
1077167156 11:1148864-1148886 TCGCCTCACCTCCCCTCGGCAGG - Intergenic
1078569912 11:12448726-12448748 TTCCATCCCCTCCCCATGACAGG - Intronic
1078806817 11:14714180-14714202 AACCCTCCCCTCCCCTGGACTGG - Intronic
1081281365 11:41212579-41212601 TTCCCACCCCTCCCCTCAACAGG + Intronic
1081527573 11:43937030-43937052 CTCCCTCCACTCCCCTGGATGGG - Intronic
1083493994 11:63034441-63034463 TTCCCTCAACTCCCCGGCAATGG + Intergenic
1083856292 11:65394600-65394622 TTTCCTCACCTGTCCTGGGCTGG + Intronic
1083952597 11:65965228-65965250 TTCCCTTGCCTGCCCTGGCCAGG - Intronic
1083956673 11:65987648-65987670 TTCTCTCACTGCCCCTGAACAGG - Intergenic
1084497594 11:69513905-69513927 CTCCCTCGCTTCCCATGGACGGG - Intergenic
1084938328 11:72599171-72599193 TTCCCCTCCCACCCCTGGACTGG + Intronic
1084961915 11:72721308-72721330 TTACCCCTCCTCCCCAGGACTGG - Intronic
1085811911 11:79690822-79690844 TTCCTACACCTCCCCTGGCAGGG - Intergenic
1089202271 11:116731673-116731695 GTCCCTCCGCTCCCCTGGCCAGG - Intergenic
1089390300 11:118097433-118097455 TACCCTCACCTCCACATGACTGG - Intronic
1089482867 11:118821226-118821248 TTACATCACCTTCCATGGACTGG + Intergenic
1089637237 11:119822934-119822956 TTCCCTAACCTCCACTGGCCTGG - Intergenic
1090357565 11:126150147-126150169 TTCCCTCTGCTCTCCTGGACTGG - Intergenic
1090839128 11:130473973-130473995 TTCCCTCCTCCTCCCTGGACTGG + Exonic
1091794651 12:3291106-3291128 TTCCCTCCTCTCCCCTGGTCTGG + Intergenic
1096651462 12:53063939-53063961 AGCCCTCACATCCCCTGGCCTGG + Exonic
1096695157 12:53344403-53344425 TTCCATCACCTCCCCTACATAGG + Intronic
1096779422 12:53983627-53983649 TTCTCTCTCCACCCCTGGATGGG + Intergenic
1096978141 12:55712054-55712076 TTCACTCACCTCTCCAGCACTGG + Intronic
1098463287 12:70758309-70758331 GTACCTCACCTTCACTGGACTGG + Intronic
1103631631 12:122266260-122266282 CGCCCTCGCCTCCCCTGGTCCGG - Intronic
1104685290 12:130780851-130780873 TGCCATCACCTCCCGTGGAATGG + Intergenic
1104943422 12:132405236-132405258 CTCCCTCAGCTGCCCTGGTCTGG + Intergenic
1105673128 13:22642452-22642474 TTCCTTCATCTCCCCAGGACTGG - Intergenic
1105848959 13:24317840-24317862 TCCCCTCCCCTCCCCTCCACTGG - Intronic
1106376822 13:29197218-29197240 TTGCCCCCCATCCCCTGGACAGG + Intronic
1108502793 13:51083827-51083849 TCCCCTGACCTCACCTGGCCTGG - Intergenic
1112904048 13:104395359-104395381 TTCCCACACTTCCCCTGGGCAGG + Intergenic
1112940374 13:104854538-104854560 TTCCCTCACCTCTCCTCAAGTGG - Intergenic
1113120155 13:106917272-106917294 TCCCCTCAAACCCCCTGGACCGG - Intergenic
1113429047 13:110233382-110233404 TTCCCTCCCCTCCCGTTGGCTGG - Intronic
1114438285 14:22726247-22726269 TCCCCTCAACCCCCATGGACTGG - Intergenic
1115852457 14:37598836-37598858 TTGCCTACCCTTCCCTGGACGGG + Intronic
1118753488 14:68822610-68822632 TTCCTTCATTTCCCCTAGACAGG - Intergenic
1121433930 14:93906506-93906528 CTCCTCCACCTCCCCTGGCCTGG + Intergenic
1121649511 14:95547463-95547485 TGCCCTCAGCTCACCTGCACTGG - Intergenic
1122345177 14:101054129-101054151 TTCACTCACCTCCCTTGGAGTGG - Intergenic
1122897637 14:104768433-104768455 TGCCCTCACTTCCACTGGAGGGG - Intronic
1123016115 14:105376534-105376556 TTCCTCCACCTCCCCTGGGCTGG - Intronic
1123172568 14:106388532-106388554 TTCCCTCACCTCCCAGGTCCTGG - Intergenic
1124111320 15:26791760-26791782 CTCCCTCACCTCACCTCAACTGG + Intronic
1124398969 15:29331885-29331907 TTCCATCACCTCAGCTGCACTGG - Intronic
1126145342 15:45468399-45468421 TTCCCCCACATCCCCAGGACAGG - Intergenic
1127727025 15:61760256-61760278 TTCCCTCACTTCCCCAGTGCTGG - Intergenic
1128091482 15:64922046-64922068 TCCCCTCGGCTCCCCTGGCCTGG + Intronic
1128594447 15:68930869-68930891 GTCCCTCTCCTCTCCTGGTCAGG + Intronic
1129235892 15:74223509-74223531 TTCCCTCAATTACCCTGGAGCGG + Intergenic
1129335187 15:74847841-74847863 TTCCCTCACCTCCCCTGGACAGG - Intronic
1129738960 15:77980595-77980617 TTCCCTGACTTCCCCAGGCCAGG - Intergenic
1129846994 15:78772583-78772605 TTCCCTGACTTCCCCAGGCCAGG + Intronic
1130254905 15:82321308-82321330 TTCCCTGACTTCCCCAGGCCAGG - Intergenic
1130600069 15:85268698-85268720 TTCCCTGACTTCCCCAGGCCAGG + Intergenic
1131270780 15:90946536-90946558 TTCCCTCCCTTCCCCTCCACTGG - Intronic
1131347821 15:91667192-91667214 TTCCCTCACCTGCTCTGCATTGG - Intergenic
1131959482 15:97773559-97773581 TTCCCTCACCTCAAGTGGAAGGG + Intergenic
1132002488 15:98194053-98194075 TTCCCTGACCTCCCCAGGAGAGG + Intergenic
1132518432 16:376620-376642 TGCCCTCACCGCCCTGGGACCGG - Exonic
1133172272 16:3988560-3988582 GTCCCCCACCTGCCCTGGAAAGG - Intronic
1133236402 16:4389270-4389292 TTCCCTCTCCTCCCAGGGGCCGG - Intronic
1133814904 16:9189598-9189620 CTGCCTCCCCTCCCCTGCACAGG + Intergenic
1133843811 16:9435955-9435977 CTCCCTCAACTCTCCTGGAAAGG - Intergenic
1134060524 16:11197066-11197088 TTTCTTCACCTCCCCAGAACGGG - Intergenic
1134441350 16:14301518-14301540 GTCTCTCACCTCCTCTGGAATGG - Intergenic
1135345113 16:21682263-21682285 TTCCCACCCATCCCCTGGATTGG - Intronic
1137677519 16:50311098-50311120 TTCCCTCCCCACCACTAGACTGG - Intronic
1138542976 16:57699593-57699615 TTCTCTGTCCTTCCCTGGACAGG + Intronic
1142119618 16:88379508-88379530 TTCCCGTCCCTCCCCTGGCCTGG - Intergenic
1142747779 17:1968625-1968647 TTCCCTCCCATCCCCGGGCCTGG + Intronic
1142831440 17:2552067-2552089 GCCCCTCACCCCACCTGGACAGG - Intergenic
1142869541 17:2811130-2811152 TTCCCTTCCCTCCCCTTGGCTGG + Intronic
1146654835 17:34628991-34629013 TTCCCTCCCCTACCCTGGCAGGG + Exonic
1146763309 17:35496685-35496707 TTTCCTGTCCTCCCCAGGACTGG + Intronic
1147200286 17:38797062-38797084 TTCCCACCACTGCCCTGGACAGG - Intronic
1147314540 17:39613269-39613291 TTCCCTGACCTCCCCAGGCAGGG + Intergenic
1147374803 17:40017124-40017146 TGTCCTCCCATCCCCTGGACTGG + Exonic
1147418380 17:40309602-40309624 TTCCCCCACCTCACCTAGACTGG + Intronic
1148482304 17:47967982-47968004 TTCCATCAACTCACCTGGGCTGG + Intronic
1148717877 17:49728717-49728739 TGCCCTCACCCACCCTGGCCTGG + Intronic
1150490705 17:65572681-65572703 CTCCCCCTCCTTCCCTGGACAGG - Intronic
1155767395 18:29652761-29652783 TTCCCTCTCCTCTCCTGAAGTGG - Intergenic
1156157379 18:34319226-34319248 TTCCCTCACTACCCCTGGGCAGG + Intergenic
1157381494 18:47222392-47222414 TTCCCTCACTTCCCCTGCACAGG - Intronic
1158888224 18:61848984-61849006 TTCCCTGTTCTCCCCTGGGCTGG - Intronic
1160066845 18:75583379-75583401 CCCCCTCACCTACCCAGGACTGG - Intergenic
1161150002 19:2702606-2702628 CGCCCTCACTTCCCCTGGCCCGG + Intronic
1162826251 19:13254103-13254125 TCCTCTCACCTCCTCTGGAGGGG + Intronic
1162967895 19:14164586-14164608 GCCCCCCACCTCCCCTGGCCCGG + Intronic
1163667711 19:18610942-18610964 CTCCCGCCCCTCACCTGGACCGG + Intronic
1165390179 19:35534276-35534298 TTCCCTCACTTCCCAAGGGCGGG + Intronic
1166835327 19:45664188-45664210 TTCCCTCTCCACTCCAGGACAGG + Intergenic
1166887526 19:45971362-45971384 GTCCCTGACCTCTCCAGGACTGG + Intronic
1166990629 19:46690523-46690545 TTCCCTGACCACCCCTACACTGG + Intronic
1167162649 19:47778298-47778320 GTCCCTCACCTCCCCTGGAGAGG - Intergenic
1167611266 19:50508741-50508763 TTCCCTCACCACCCTTAGGCTGG + Intronic
1168615487 19:57833924-57833946 TTCCCTCTCCTCTCCTCGAGTGG + Intronic
1168621298 19:57881523-57881545 TTCCCTCTCCTCTCCTCGAGTGG - Intronic
924962585 2:46939-46961 TCCCCCCACCTCCCCCGGGCAGG + Intergenic
926626789 2:15097101-15097123 CTCCCTCCCCTGCCTTGGACAGG - Intergenic
927653378 2:24926305-24926327 TTCCCTCTCCTCTCCTCGATCGG + Intergenic
928722151 2:34133144-34133166 GCCCCCCACCTCCCCCGGACGGG + Intergenic
929342285 2:40835806-40835828 TTGACTGCCCTCCCCTGGACTGG + Intergenic
929857451 2:45649370-45649392 TTCCATCACATGCCCTGGAAAGG + Intergenic
930571071 2:53088092-53088114 TTCCCTCCCCTCCCCTTTCCTGG - Intergenic
932463656 2:71899125-71899147 TCCCCTCACCTCCCCTGAGCAGG - Intergenic
932851760 2:75194427-75194449 TTCCCTCACCCCACCTGGAGGGG - Intronic
933339509 2:81004470-81004492 TTCCCTCTCCTTTCCTGGAGTGG + Intergenic
933637074 2:84720178-84720200 TTCCCACACCACCCATGGCCAGG - Intronic
933797067 2:85928064-85928086 TTCCCTAACCTCACCTTCACGGG - Intergenic
936572541 2:113628560-113628582 TACCCTCCCCTCCCTTGGGCTGG + Exonic
937239142 2:120449223-120449245 TGCCCTGAGCTCCCCTGGGCAGG - Intergenic
938371540 2:130771659-130771681 TTCCCCCACCTCCCCTTGCAGGG - Intergenic
938767355 2:134469199-134469221 TTCCCGCACAGCCCCTGGATAGG - Intronic
941657510 2:168159877-168159899 TTCCCACACCTACCCTGTGCAGG + Intronic
943686939 2:190828589-190828611 TTCCCTTACCTTCACTAGACTGG - Intergenic
947093210 2:226536946-226536968 TTCCCTTACCTCCCATGGTGAGG + Intergenic
948007425 2:234621872-234621894 TGCCCTCCCCACCCCTGGATTGG + Intergenic
948188792 2:236042730-236042752 GGCCCACACCTCCCCTGCACTGG - Intronic
948601582 2:239110803-239110825 TTCCCTCCTCTCCCCTGCAGGGG + Intronic
1169288198 20:4327185-4327207 TTCCCTCCCCTCCAATGGCCTGG - Intergenic
1169350793 20:4866551-4866573 TTCCCTCACATCCCCCATACAGG + Intronic
1169569431 20:6890115-6890137 TTCCCTCTACTCTCCTTGACAGG + Intergenic
1171461444 20:25300331-25300353 CTGCCCCACCTCCCCTGGGCTGG - Intronic
1172035528 20:32008094-32008116 TTCCTTCCCCTCCCTTGGAGGGG - Intergenic
1172711106 20:36924244-36924266 TCCCCTCCCCTCCCCTCAACAGG - Intronic
1173159332 20:40640576-40640598 TGCCTTCACCTCACTTGGACTGG + Intergenic
1174358258 20:50012369-50012391 TTCCCTCACTTCCGCTAGGCTGG + Intergenic
1174509538 20:51040679-51040701 TGACCTCACTTCCCCTGGCCGGG - Intergenic
1175196180 20:57244788-57244810 CTCCCTCCCTTCCCCAGGACAGG + Intronic
1175368645 20:58471907-58471929 GGCCCCCACATCCCCTGGACTGG - Intronic
1180004335 21:45013153-45013175 TGCCTTCACCTCCCCAGGACTGG - Intergenic
1181310877 22:21944088-21944110 TTTCCTCACCTCCCGTGCATTGG + Intronic
1181666526 22:24402160-24402182 TTCTCTCCCCTCCCCTGACCTGG + Intronic
1183597091 22:38819216-38819238 TTCCCTCCCCTTCCCTGCCCAGG + Exonic
1183772300 22:39937472-39937494 TTTCCTCACTTTCCCTGGGCAGG - Intronic
1184066503 22:42124658-42124680 TCCCCTCCCCTCCCCAGGTCAGG - Intergenic
1184066506 22:42124663-42124685 TTCCCTCCCCTCCCCTCCCCAGG - Intergenic
1184068971 22:42136810-42136832 TCCCCTCCCCTCCCCAGGTCAGG - Intergenic
1184068974 22:42136815-42136837 TTCCCTCCCCTCCCCTCCCCAGG - Intergenic
1184277638 22:43419323-43419345 TTCCCTGACCTCCCCTGGCTGGG - Intronic
1184867600 22:47210116-47210138 TGCCCTCTTCTCCCCTGGACAGG + Intergenic
1185289871 22:50017886-50017908 CTCACTCACCTTCCCTGGCCTGG - Intronic
1185341483 22:50293234-50293256 TCCTCTCCTCTCCCCTGGACAGG - Intronic
1185427647 22:50782319-50782341 TACCCTCCCCTCCCTTGGGCTGG - Exonic
949559661 3:5189206-5189228 TTGACTCCCCTCCCCTGGATGGG + Intronic
950632266 3:14290304-14290326 TTCCCTCATCTTTCCTTGACTGG + Intergenic
952925542 3:38316844-38316866 CTCCCTCTCCTCCCAGGGACAGG + Intronic
953103106 3:39849461-39849483 ATCCATCACATCCCGTGGACCGG - Intronic
953767455 3:45754399-45754421 TGCTGTCACCTCTCCTGGACAGG + Intergenic
954367120 3:50152107-50152129 TACTCTCAGCTCCTCTGGACTGG - Intergenic
954369520 3:50162874-50162896 TTTCCTGACCTCCCCTGGCAGGG - Intronic
954575117 3:51671534-51671556 TTCCCTCACCTCCACGGCCCCGG - Exonic
954932283 3:54294688-54294710 CTCCCTCACATCACCTTGACGGG + Intronic
955231290 3:57101141-57101163 TTCCTTCTCCTACCCTGGCCAGG - Intronic
955552737 3:60101397-60101419 TTCTTTCAGCTCCCCAGGACTGG + Intronic
961007834 3:123416669-123416691 TCCCCTCACAAGCCCTGGACAGG - Intronic
963443674 3:145374290-145374312 TTCCCTCTCCTCTCCTCAACTGG - Intergenic
964284496 3:155102755-155102777 TTCCCTCCCCTTCACTGGGCAGG + Intronic
966941398 3:184750253-184750275 TTTCCTCCCCTCCCCTGACCAGG + Intergenic
968100952 3:195965011-195965033 TCCCCTCTCCTCCCATGGGCTGG - Intergenic
968360512 3:198143735-198143757 CACCCACACCTCCCCTGGGCCGG + Intergenic
969564222 4:7968122-7968144 TCCCCTCGCCTCGCCTGGGCGGG + Intronic
969683446 4:8656023-8656045 TCTCCTCACTTCCCCAGGACGGG + Intergenic
970423535 4:15926535-15926557 TTCCCTCACCTCTTCTTAACTGG + Intergenic
974503727 4:62739350-62739372 TACCCTCCCCACCCCTCGACAGG - Intergenic
976789266 4:88859400-88859422 TTCCTTCCCATCTCCTGGACGGG - Intronic
980073730 4:128270836-128270858 TACCCCCACCTCCCCTGATCAGG + Exonic
980351480 4:131690767-131690789 TTCCCTCACCTCTCAGGGCCAGG - Intergenic
982212066 4:153045820-153045842 TGTCCACACCTCCCCTGGGCTGG + Intergenic
983534728 4:168845120-168845142 CTCCCTCACCTCCTCTGCTCCGG - Intronic
984682512 4:182625788-182625810 TTCCCTCAACGCCACTGGAGAGG - Intronic
984928528 4:184826578-184826600 GGCCCTCAGCTCCCCTGCACCGG - Exonic
986165752 5:5270252-5270274 TTCCCACAACTCTCCTGCACTGG + Intronic
986942232 5:12967911-12967933 TTCCCCCACCCTCCCTTGACAGG + Intergenic
990508177 5:56465663-56465685 TTCCATTTCCTCCCCTGGGCAGG - Intronic
990906660 5:60810844-60810866 TTGACTCACCTCCCCTGGGTCGG - Intronic
991608780 5:68429214-68429236 TCCCATGACCTCCTCTGGACTGG + Intergenic
993093616 5:83457482-83457504 TTCCCTCCCCAACACTGGACTGG - Intergenic
993244829 5:85437428-85437450 ATCCCTCCCCACCCCAGGACAGG - Intergenic
996543401 5:124653042-124653064 TTCCCTTTCCACCCATGGACTGG + Intronic
997002988 5:129784484-129784506 TTCCCTCTCCTCTCCTCGAGTGG - Intergenic
997725802 5:136118918-136118940 TTCCCTCACCTTCTCTGCATGGG - Intergenic
999388020 5:151169268-151169290 TCCCCTCCCCTCCCATGGACAGG + Intergenic
999607610 5:153333265-153333287 GCCCCCCACCACCCCTGGACAGG + Intergenic
1000666407 5:164003156-164003178 GTCACTCACCTACCCTGGAATGG + Intergenic
1000847684 5:166301727-166301749 TTGCCTCCCCTCCCTTGGCCTGG - Intergenic
1001424752 5:171615907-171615929 TTCCCTGAGCTCCGCTGGCCTGG - Intergenic
1001540523 5:172534623-172534645 TTCCATCACCTCCCCAGGGTGGG + Intergenic
1001679238 5:173544198-173544220 TTGCCTCCCCTCCCCTGGCCCGG + Intergenic
1002026901 5:176401889-176401911 TGCCCTCACCGCCCCTGGCCTGG + Intronic
1002171740 5:177378511-177378533 TTCCTTCAGCTCCCCAGCACTGG - Intergenic
1002671182 5:180868832-180868854 CTCACTCACCTCCCCAGGATTGG + Intergenic
1002838438 6:885146-885168 TTCCATCACCACCCCTCGGCCGG - Intergenic
1006193372 6:32222806-32222828 TTTCCTCTCCTCCCCTGCCCAGG - Exonic
1006361313 6:33588858-33588880 TTCCGCCACCTCCCCTCGGCTGG - Intergenic
1006429153 6:33984503-33984525 TTCCCCCAGCGCCCCTGGCCTGG - Intergenic
1006941980 6:37758346-37758368 TTCTGTCACCTCCCCTTGCCAGG - Intergenic
1006943153 6:37766077-37766099 TTCCCTGACCTCCCAGGGGCTGG - Intergenic
1010620204 6:78064208-78064230 TAGCCTCACCTCTGCTGGACAGG - Intergenic
1011899988 6:92281353-92281375 TTCTCAAACCTCCCCTTGACTGG - Intergenic
1012844489 6:104372631-104372653 TTCCTTTTCCTCCCCTAGACTGG - Intergenic
1013155382 6:107488424-107488446 TCCCCTCGCCTCCCCGGGACGGG + Intergenic
1014015198 6:116521598-116521620 TGCCCTCACCTAACCTGGGCAGG - Exonic
1015539100 6:134296908-134296930 TTCCCTGTCCTACCCTGCACAGG + Intronic
1015886518 6:137923675-137923697 TTCCCTGACCTCCCCGAAACAGG - Intergenic
1018244020 6:161804509-161804531 TTCCCTCCCCTCCACTGGTGAGG + Intronic
1018813226 6:167312899-167312921 TGGCCTCTCCTCCCCTAGACTGG + Intronic
1019259492 7:72899-72921 CACCCACACCTCCCCTGGGCCGG - Intergenic
1019570870 7:1711411-1711433 TTCCCTCCCCTCCCCTCCTCTGG - Intronic
1020180689 7:5920193-5920215 TTCCCTCAGCTCCCCCCGAATGG + Intronic
1020302241 7:6804689-6804711 TTCCCTCAGCTCCCCCCGAATGG - Intronic
1022641585 7:32190395-32190417 CTAGCACACCTCCCCTGGACAGG - Intronic
1022820068 7:33950951-33950973 TTCCCTCTCCTCCTCTGGTTAGG + Intronic
1023338756 7:39197131-39197153 TTTCCTCACCTCCCCAGGACAGG + Intronic
1024527382 7:50360265-50360287 TTCCCTCTCATCCCCAGGGCTGG - Intronic
1028840252 7:95421682-95421704 CTACCTCCCCTCCCCTAGACTGG - Intronic
1029488781 7:100859041-100859063 GTCCTTCAGCTCCCCTGGAGAGG - Exonic
1032479065 7:132232251-132232273 GTCCCTCAGCTCCACTGTACAGG + Intronic
1032479488 7:132235127-132235149 ATTCCTCTCCTCCCCAGGACTGG - Intronic
1032532723 7:132635609-132635631 ATTCCTCAGCTCCCCAGGACGGG + Intronic
1032675032 7:134121954-134121976 TTCTCTTAACTCCCCTGGACTGG + Intergenic
1033273939 7:139957013-139957035 ACCCCTCATCTCCCCTGGAGAGG - Intronic
1034337429 7:150332465-150332487 TTCCCTTGCCTCTCCTGGATGGG + Exonic
1035464413 7:159065279-159065301 CTCCCTCCCCTCCCCTGCAGTGG + Intronic
1036742090 8:11372360-11372382 TTCCCTCCCCTCCCCCCGCCAGG + Intergenic
1037812656 8:22096218-22096240 TTCCCCCACCTCTCCCAGACAGG + Intronic
1038149485 8:24929730-24929752 CTCCTTCTCCTCCCCTTGACTGG - Intergenic
1041780033 8:61568034-61568056 TTTCCTCCCCTCCACTGCACTGG - Intronic
1043043707 8:75294596-75294618 TTCTCTCATCTCCCCTGCATTGG + Intergenic
1043142150 8:76603543-76603565 TTGCCTCACCTGCCTTGGTCTGG + Intergenic
1045459362 8:102412611-102412633 CTTCCTCACCTCCCCTAGTCCGG - Exonic
1047778422 8:128092333-128092355 TCCCTTCCCCTCCCCTGGGCAGG + Intergenic
1048245931 8:132799154-132799176 TTACCTCACTTCCCATAGACTGG - Exonic
1048314559 8:133352491-133352513 TTCCCCAACCTGCCCTGGTCTGG - Intergenic
1048975612 8:139671375-139671397 GTCTCTCACCTCCTCTGGGCTGG - Intronic
1049061284 8:140278059-140278081 TGCCCTCCCCACCCCTGCACTGG + Intronic
1051261845 9:15272339-15272361 TTCCCTTAGCTCCCCAGTACTGG + Intronic
1051435908 9:17031386-17031408 TTCCCTTCCCTCCACTGTACGGG - Intergenic
1053155455 9:35775289-35775311 TTGCCTCACCTTCCCTTGAAAGG - Intergenic
1055073916 9:72194509-72194531 TTCCCTCTCCTCTCCTCGAGTGG + Intronic
1056007215 9:82285361-82285383 TTCCCTCTCCTCCCCTAAAGTGG - Intergenic
1057035814 9:91811144-91811166 TTCCCACACCTCCCCTAGGCCGG + Intronic
1057522574 9:95771923-95771945 CTCCCTCACCTTCCCTGAATAGG - Intergenic
1057728894 9:97591487-97591509 TTCCCTGACATCCCCAGCACAGG - Intronic
1057802099 9:98196937-98196959 TTCCCTCCCCTCCTGTGGAGAGG - Intergenic
1060268312 9:122125085-122125107 CCCCCTCACCATCCCTGGACTGG + Intergenic
1061211897 9:129198452-129198474 TTCCGTCCCCTGCCCTGGGCTGG - Intergenic
1061747716 9:132752657-132752679 TTCCCCCAGCTCTCCTGGAATGG + Intronic
1062522893 9:136965968-136965990 GGCCCTCACCTCCCCCGGAAGGG - Intergenic
1062745210 9:138207564-138207586 CACCCACACCTCCCCTGGGCCGG + Intergenic
1186349287 X:8727228-8727250 CACCCTCACCTCTCCAGGACAGG + Intronic
1186564290 X:10645837-10645859 ATCCCTCAACTCTCCTGGATTGG + Intronic
1187826035 X:23334310-23334332 TTCGCTCCCCTCCCCCGGTCCGG - Exonic
1190619448 X:52270476-52270498 CTTCTTCACCCCCCCTGGACTGG - Intergenic
1190914629 X:54801963-54801985 TTCCCTCTACTCCCCTGCAATGG - Intergenic
1192841131 X:74857261-74857283 TTCCCTCTCCTCTCCTGAAGAGG - Intronic
1194016215 X:88624723-88624745 TTTCCTCTCCTCCCCTCGAGAGG - Intergenic
1194835147 X:98672644-98672666 TTCCCTCTCCTCCCCTCAAGTGG + Intergenic
1195327343 X:103768551-103768573 TTCTCTCACCTCCCCAGCCCTGG + Intergenic
1196179427 X:112673530-112673552 TTTCCTCTCCTCCTCTGGCCTGG - Intronic
1196868143 X:120087726-120087748 TTCACACACCTCCCCTGCCCAGG + Intergenic
1199609407 X:149600173-149600195 TTCTCTCCCCTCTCCTGGAGTGG + Intronic
1199629710 X:149769181-149769203 TTCTCTCCCCTCTCCTGGAGTGG - Intergenic
1200126324 X:153816519-153816541 CTGCCCCACCTGCCCTGGACAGG + Intronic
1201266645 Y:12213269-12213291 TTCCTTTTCCTGCCCTGGACAGG + Intergenic