ID: 1129335624

View in Genome Browser
Species Human (GRCh38)
Location 15:74850609-74850631
Sequence GGAGCTGTTGCCCGAGAACC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 120}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129335618_1129335624 10 Left 1129335618 15:74850576-74850598 CCACAGGATGGAGAGGCCAAAGT 0: 1
1: 0
2: 2
3: 17
4: 258
Right 1129335624 15:74850609-74850631 GGAGCTGTTGCCCGAGAACCAGG 0: 1
1: 0
2: 0
3: 10
4: 120
1129335620_1129335624 -6 Left 1129335620 15:74850592-74850614 CCAAAGTCCACTCCCTTGGAGCT 0: 1
1: 0
2: 0
3: 11
4: 168
Right 1129335624 15:74850609-74850631 GGAGCTGTTGCCCGAGAACCAGG 0: 1
1: 0
2: 0
3: 10
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129335624 Original CRISPR GGAGCTGTTGCCCGAGAACC AGG Exonic
902466546 1:16622032-16622054 GGAGCTGATGGCCCAGAAGCTGG - Intergenic
902508113 1:16951014-16951036 GGAGCTGATGGCCCAGAAGCTGG + Exonic
903668726 1:25023078-25023100 GGCTCTGTAGCCTGAGAACCTGG + Intergenic
906255478 1:44345907-44345929 GGAGCAGTAGCCTGAGACCCTGG - Intronic
910608939 1:89118939-89118961 GGAGATGTTGCACCAGAAGCTGG + Intronic
915535643 1:156533857-156533879 GCAGCTGTTGCTGGAGCACCAGG - Exonic
915640022 1:157217536-157217558 GGAGCTGAGGCCAGAGACCCAGG - Intergenic
916601523 1:166297903-166297925 GGAGCTGATGCTAGAGGACCCGG + Intergenic
917660368 1:177171628-177171650 GGAGATGTTGCACAAAAACCTGG + Exonic
917755422 1:178093878-178093900 GGAGCTGTGGCCTGAGAGTCAGG + Intergenic
921436531 1:215129925-215129947 GGAGCTCTGGGCCAAGAACCTGG - Intronic
922413435 1:225397530-225397552 GGAGCTGGTGGCCAAGTACCAGG - Intronic
923660748 1:235954982-235955004 GGAGCTGCTGCCCGAAGACTAGG - Intergenic
1066379078 10:34885894-34885916 TGAGCTGTGGCCCAAGAACAGGG + Intergenic
1067046073 10:42985916-42985938 GGACCTGTGGCCTGAGAAACTGG + Intergenic
1073301923 10:102476094-102476116 GGAGCTGTTGCCCAAAAAAATGG + Exonic
1074318460 10:112379750-112379772 GGAGCTGTTGCTCTGGTACCTGG + Intronic
1077981766 11:7308286-7308308 GACACTGGTGCCCGAGAACCAGG + Intronic
1078668922 11:13348074-13348096 GGAGCTGCTGCAGGAGAGCCAGG + Intronic
1080386193 11:31812468-31812490 TCAGCTGTTGCCAGAAAACCGGG + Intronic
1081710512 11:45212764-45212786 GGAGCTGGTGACCGTGCACCGGG + Intronic
1083203245 11:61132428-61132450 GGAGCTTTTCCACGCGAACCCGG + Exonic
1085475015 11:76783961-76783983 GGGGCTGTTGCCCGAGGAACCGG - Intronic
1085737246 11:79049570-79049592 TGGGCTGGTGCCTGAGAACCTGG + Intronic
1086322302 11:85664122-85664144 GGAGCTGCGGGCCGAGAATCGGG - Exonic
1091800789 12:3323354-3323376 GGTGCTGTTGCCCAGGAAGCCGG + Intergenic
1100997337 12:100316637-100316659 GGAGCTGTAGCCTGTGAAGCAGG + Intronic
1102948381 12:117010530-117010552 AGAGCTGTTGAGTGAGAACCGGG - Intronic
1106173318 13:27307798-27307820 GCGGCTGTTGCCTGAGACCCAGG + Intergenic
1108086767 13:46801710-46801732 GGAGCTGTAGCTCATGAACCTGG - Intergenic
1108563153 13:51666607-51666629 GGAGCAGTAGCCCTAGGACCTGG + Intronic
1110569933 13:76992223-76992245 GGAGGGGATGCCCGAGACCCGGG - Exonic
1113879097 13:113612942-113612964 GGAGCTGCTGCCGGCGATCCAGG - Intronic
1114195039 14:20469578-20469600 GGTGCTGTGACCCGGGAACCTGG + Intronic
1116774945 14:49168163-49168185 GGAGCTGGTTCCAGAGGACCTGG + Intergenic
1121666766 14:95678159-95678181 GGAGCTGGTGAGGGAGAACCAGG - Intergenic
1122130748 14:99603533-99603555 GGCCCTGCTGCGCGAGAACCTGG - Exonic
1122899905 14:104778115-104778137 GGAGGTGTTGCCTGAGCAGCTGG - Intronic
1123051065 14:105542837-105542859 GGAGCTGTTGCAAGAGATACAGG + Intergenic
1124442585 15:29697989-29698011 GGAGCTGTTGCCCAAGATGCAGG - Intergenic
1129335624 15:74850609-74850631 GGAGCTGTTGCCCGAGAACCAGG + Exonic
1131180137 15:90233834-90233856 GGAGCTGCTGGCCGAGTACCAGG - Exonic
1132713065 16:1277852-1277874 GAAGCTCTTGCCCAAGACCCAGG - Intergenic
1133113622 16:3564018-3564040 GCAGATGTTCCCCGAGGACCAGG - Exonic
1134418994 16:14069364-14069386 GCAGTTGTGGCCCGAGAACCAGG - Intergenic
1139563520 16:67758527-67758549 GGATCTGTATCCCGAGACCCTGG - Intronic
1142717631 17:1755641-1755663 GGAGCTGGTGCCCGCCAGCCGGG + Intergenic
1142961704 17:3555784-3555806 GCTGCTGTGGCCAGAGAACCTGG + Intronic
1143663049 17:8339107-8339129 TGAGCTGTGGCCTGAGAAACAGG + Intergenic
1150373398 17:64661507-64661529 GGGGCTGTTCCCCGAGCCCCGGG + Intronic
1150778820 17:68102260-68102282 GGGGCTGTTCCCCGAGCCCCGGG - Intergenic
1152537455 17:80959111-80959133 GCAGCAGCAGCCCGAGAACCTGG + Intronic
1157550201 18:48576071-48576093 GGCGCCGCTGCCCGAGGACCGGG - Intronic
1158100022 18:53819909-53819931 GGAGTTGTTGCCAGAGGACCAGG + Intergenic
1159948706 18:74463066-74463088 GGAGCTGCAGCCCAAGAACGTGG + Intergenic
1160826571 19:1083010-1083032 GGACCTGCCGCCTGAGAACCGGG + Exonic
1160932224 19:1576272-1576294 GGAGCTGTGCCCCGGGACCCTGG - Intronic
1161345564 19:3767300-3767322 GGAGCTGGACCCCGAGAGCCGGG + Exonic
1161887061 19:7005224-7005246 GGAGCTGCTCCCCGATCACCCGG - Intergenic
1161888140 19:7012677-7012699 GGAGCTGCTCCCCGATCACCCGG + Intergenic
1162021881 19:7871823-7871845 AGAGATGTTGCCGGAGAAACAGG + Exonic
1162508915 19:11105358-11105380 GGAGCTGTTGCACTGGAAGCTGG - Exonic
1167486600 19:49766762-49766784 GGAGGCGTTGCCCGAGAGACGGG - Intergenic
1167510741 19:49894336-49894358 GGAGAAGGTGCCCGAGAAGCTGG - Exonic
1167521429 19:49958383-49958405 GGAGCTGTTGGCCCAGGGCCCGG + Exonic
1167523945 19:49972336-49972358 GGAGCTGTTGGCCCAGGGCCCGG - Intergenic
1167591998 19:50409188-50409210 GGGGCTGCTGCCCCAGATCCTGG + Exonic
1167666907 19:50827606-50827628 GGAGCTCTTCCCCCCGAACCAGG + Intronic
1167756118 19:51414921-51414943 GGAGCTGTTGGCCCAGGGCCCGG + Exonic
925993926 2:9276395-9276417 GGAGCTGATGCCAGAGAAGCAGG + Intronic
928584199 2:32741689-32741711 ACAGCTGTTGCCCCAGAACCTGG + Intronic
934740034 2:96713622-96713644 GGAGCTGTTTCCTGAGATCCTGG - Intronic
934753764 2:96810987-96811009 GGAGCTGGGTCCCGAGAGCCTGG + Exonic
947059355 2:226145262-226145284 GGAGCTGTTGGAAGATAACCAGG + Intergenic
1168768140 20:396201-396223 GAAGCTGGTGCTGGAGAACCTGG + Exonic
1171285828 20:23937529-23937551 GTAGCTGGTGCCCGAGAGGCTGG - Intergenic
1172273486 20:33667458-33667480 GGAGCTGCTGTTCGAGACCCTGG + Exonic
1176170052 20:63692669-63692691 GGGGCTGCTGCCTGAGAAACTGG - Intronic
1179607238 21:42524798-42524820 GGAGCTGTGTGCCCAGAACCAGG - Intronic
1181550657 22:23637295-23637317 GGAGCTGGAGCCCCAGACCCTGG + Intergenic
1182419927 22:30244025-30244047 GGAGCCGTTCCCCAACAACCTGG - Exonic
1182696343 22:32201687-32201709 GCAGCTGGAGCCCCAGAACCTGG - Intronic
1182715795 22:32355391-32355413 GCAGCTGGAGCCCCAGAACCTGG + Intronic
1183332736 22:37230089-37230111 GGAGCTGTGGCCCTAGGACAGGG + Intronic
1183381536 22:37492713-37492735 GGTGCTGTTGCCTGAGTGCCTGG - Exonic
1183431585 22:37769166-37769188 GGAGCTGCTGCGCCACAACCAGG + Exonic
1183669560 22:39264521-39264543 GGAGCTGTGGTCAGAGAAGCCGG + Intergenic
1185233254 22:49695165-49695187 GGAGCTGGGGCCACAGAACCGGG + Intergenic
953599406 3:44348342-44348364 GGAGCTGTTCCCAGAGCCCCTGG - Intronic
954369459 3:50162615-50162637 GGAGGTGGTGCCCCAGAGCCTGG - Intronic
954664941 3:52246584-52246606 GGAGCTGTTGCCCCAGAGGGAGG + Intronic
955412509 3:58664952-58664974 GGAGCAGCTGCCCCAGCACCAGG + Intronic
961565799 3:127762561-127762583 GGAGCTGGGGCCTGAGATCCGGG + Intronic
968737497 4:2304906-2304928 GGAGCTGGTGCCCGCGAGGCTGG + Exonic
969104032 4:4791530-4791552 GGAGCTGAGGCCCGACAAGCTGG - Intergenic
971757768 4:30722960-30722982 GGAGTTGTTGCTCGAGAGGCTGG - Exonic
973952386 4:56029485-56029507 GGAGCTGTGGGCCAAGAACCAGG + Intronic
987351356 5:17024992-17025014 GGAGCTGGTGAGAGAGAACCTGG + Intergenic
992627688 5:78649249-78649271 GGAGCAGTTCCCCCAGACCCGGG + Intronic
995846567 5:116500187-116500209 ATAGCTGTTGCCCAAGAACATGG - Intronic
996330496 5:122323131-122323153 GGCGCTGTTGCCCGAGTTCATGG - Intronic
999274866 5:150323494-150323516 GGAGCTCTGGCCCGGGAACCAGG + Intronic
1002414552 5:179112850-179112872 GGAGCTCTTCCCCCAGAGCCTGG + Exonic
1002479000 5:179486932-179486954 GCAGCTGGTGCCTCAGAACCAGG - Intergenic
1003055754 6:2818707-2818729 GAAGCTGTTGCCCGGCAACATGG + Intergenic
1003832830 6:10033369-10033391 GGAGCTGTTGCAAGAGTTCCTGG + Intronic
1004586936 6:17011862-17011884 GGAACTGTAGGCAGAGAACCAGG - Intergenic
1005755219 6:28920078-28920100 GGAGATGTTGCAAGAGAACTGGG + Exonic
1006801839 6:36764799-36764821 GGAGCTGTTTGCAGAGAGCCAGG - Intronic
1007496403 6:42262919-42262941 GCAGCTGTTGCCCCAGGCCCTGG - Intronic
1010378962 6:75205435-75205457 GGCCCTGCTGCCCCAGAACCCGG + Intronic
1010953890 6:82068927-82068949 GAAGCTGTTGGCCGAGGGCCTGG - Intergenic
1011520399 6:88197842-88197864 AGTGCTGTTGCTAGAGAACCTGG + Intergenic
1012836324 6:104273941-104273963 GGAGCTGTTGCCCAAGGAATAGG - Intergenic
1017887382 6:158610316-158610338 GGAGCTGTTGAAAGAGAATCTGG - Intronic
1019022345 6:168929998-168930020 GCAGATGGTGCCCGAGAGCCGGG + Intergenic
1021902279 7:25298061-25298083 GAAGCTGTTGCCAGAGCACATGG + Intergenic
1023373618 7:39535236-39535258 GGAGCTGTGTACCAAGAACCAGG - Intergenic
1028488817 7:91388582-91388604 GAAGCTGTTGCTGGAGAATCAGG + Intergenic
1029735948 7:102465829-102465851 GGAGCTGCTTTCCGAGCACCTGG + Exonic
1033241266 7:139681879-139681901 GGAGATGCTGTCCTAGAACCAGG - Intronic
1034468337 7:151242816-151242838 GGAGCTGGTCCCCGAGTCCCAGG - Exonic
1041681050 8:60591898-60591920 GAAGCTTTTGCACGAGAACATGG + Exonic
1048321471 8:133403793-133403815 GGAGCTTATGCCCAAGAACAAGG - Intergenic
1055134213 9:72808319-72808341 GGTGCTGTTGCCCTAGAGCTAGG + Intronic
1060660250 9:125401170-125401192 GCAGCTGTGGCCCCAGAGCCAGG - Intergenic
1061486099 9:130921180-130921202 GGAACTGTGCCCCGAGACCCTGG - Intronic
1062167946 9:135117711-135117733 GCAGCTGCTGCCCCACAACCTGG + Intronic
1062453924 9:136626971-136626993 GCAGCTGGTGCCCGTGAGCCAGG - Intergenic
1195749724 X:108151726-108151748 GGAGCTGTTGGCCCAGAATTAGG - Intronic
1198312432 X:135435566-135435588 GGAGCTGATGGCCCAGAAGCTGG + Intergenic