ID: 1129335624

View in Genome Browser
Species Human (GRCh38)
Location 15:74850609-74850631
Sequence GGAGCTGTTGCCCGAGAACC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 120}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129335620_1129335624 -6 Left 1129335620 15:74850592-74850614 CCAAAGTCCACTCCCTTGGAGCT 0: 1
1: 0
2: 0
3: 11
4: 168
Right 1129335624 15:74850609-74850631 GGAGCTGTTGCCCGAGAACCAGG 0: 1
1: 0
2: 0
3: 10
4: 120
1129335618_1129335624 10 Left 1129335618 15:74850576-74850598 CCACAGGATGGAGAGGCCAAAGT 0: 1
1: 0
2: 2
3: 17
4: 258
Right 1129335624 15:74850609-74850631 GGAGCTGTTGCCCGAGAACCAGG 0: 1
1: 0
2: 0
3: 10
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129335624 Original CRISPR GGAGCTGTTGCCCGAGAACC AGG Exonic